CN108929883B - Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme - Google Patents

Abstract

The invention relates to application of spoIII gene spoIIE in influencing strain growth and enzyme production. The invention relates to a spo II E partial gene fragment and Cm through an insertion inactivation mode^rGene fusion, fusion gene spo II E-Cm^rThe insertion of the bacillus clausii spo II E gene sequence can make the spo II E gene unable to be normally expressed and inactivated, and the spo II E gene inactivated strain not only can obviously reduce sporulation rate to 0.3%, but also can make the growth speed of engineering strain obviously faster than that of original strain, and can implement cell quantity accumulation in shorter time and fermentation production of amylase with higher activity. The invention constructs the bacillus clausii with low spore yield, overcomes the problem that the bacillus clausii cannot realize high-density continuous fermentation in the industrial production process, can effectively improve the production strength of target enzyme, and has wide application prospect.

Description

Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme

Technical Field

The invention relates to application of spoIIAE (spoIIA E) related to sporulation in influencing strain growth and enzyme production, belonging to the technical field of molecular biology.

Background

Bacillus clausii (Bacillus clausii) is an industrial enzyme production strain, and the formation of spores in the production process can affect the fermentation, limit the yield of target enzyme and reduce the production efficiency. The construction of the spore deletion bacterium is an important direction for the modification of cell factories such as the Bacillus clausii. A plurality of sporulation-related genes such as Spo0A, sigmaE, sigmaK and the like are provided, and the single gene functions and the interaction relationship among the genes in the sporulation process are researched and reported, wherein SpoIIE is a main regulator in the sporulation process and is a protein phosphatase required for activating a SigmaF factor in the sporulation process, when a chromosome axis filament is formed, a tubulin homologous protein FtsZ in the center of a cell can be relocated to the vicinity of two poles of the bacterium after one-time spiral structure transition, the relocation is triggered by the expression of the spooIIE, the asymmetric distribution of the bacterium is promoted at one site, and the differentiation and formation of the sporulation are further promoted. Further studies have found that spore genes not only affect spore formation, but also have a regulatory effect on the structure, growth, metabolite production, etc. of the strain, for example, spo0A at a certain threshold value can promote the formation of a bacterial envelope; spo III D is not only essential for sporulation in Bacillus thuringiensis, but is also associated with crystal protein expression; in clostridium sporogenes, genes associated with sporulation can influence sporulation and are also involved in the fermentation production of organic substances such as acetone, butanol and the like. In the Bacillus clausii, SpoIIE gene deleted strains are constructed, so that the growth speed of the strains and the accumulation of biomass can be improved while the formation of spores of the Bacillus clausii is controlled, and the fermentation activity of extracellular enzymes such as amylase and the like is improved.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the application of spoIIAE related to sporulation in influencing the growth of strains and producing enzymes.

The technical scheme of the invention is as follows:

the application of spooiII E related to sporulation in influencing the growth of strains and producing enzymes is disclosed, and the nucleotide sequence of the spooiII E gene is shown as SEQ ID NO. 1.

According to the invention, the preferred enzyme is amylase, and the enzyme activity of the amylase is 5-6 times of that of the original strain.

According to the invention, the sporulation-related gene spoIIE is preferably used for influencing the growth and enzyme production of the strain by the following steps:

(1) extracting genome DNA of the Bacillus clausii, and performing PCR amplification by using the genome DNA as a template to obtain a spo II E related to sporulation of the Bacillus clausii, wherein the nucleotide sequence of the spo II E is shown as SEQ ID NO. 1;

(2) PCR amplification is carried out by taking pHT01 plasmid as a template, and Cm is obtained by amplification^rFragment, Cm^rThe nucleotide sequence of the fragment is shown as SEQ ID NO. 2;

(3) the spo II E gene prepared in the step (1) and the Cm gene prepared in the step (2) are mixed^rThe fragments are fused by adopting overlapping PCR to obtain a fusion gene spo II E-Cm^r；

(4) Fusing the fusion gene spo II E-Cm in the step (3)^rAfter enzyme digestion, concentration, transformation of bacillus clausii competent cells, and screening to obtain positive recombinant bacteria, which can be applied to thallus growth and enzyme production.

Preferably, in step (1), the nucleotide sequence of the PCR amplification primer is as follows, and the BamHI cleavage site is underlined:

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；

spo ⅡE-R：GCCAGCAAAAAGCGTTCCTACAAGTAAGCC；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, primer spo II E-F2.5 μ L, primer spo II E-R2.5 μ L, Bacillus clausii genomic DNA 2.5 μ L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 53 ℃ for 30s, and extension at 72 ℃ for 1min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

Preferably, in step (2), the nucleotide sequences of the PCR amplification primers are as follows, and the BamHI cleavage site is underlined:

Cm^r-F：CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC；

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, primer Cm^r2.5. mu.L of-F, primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 40s for 30 cycles; extension was continued for 10min at 72 ℃.

According to a further preferred embodiment of the present invention, in the step (3), the nucleotide sequences of the amplification primers of the overlapping PCR are as follows, and the BamHI cleavage site is underlined:

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG；

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, gel recovery product spoII E fragment 2 μ L, gel recovery product Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; continuing to extend for 10min at 72 ℃;

the second round of overlapping PCR amplification system is that the following reagents are added on the basis of the first round of PCR amplification system:

2 × HiFi-PCR Master 12.5 μ L, primer spoII E-F1 μ L, primer Cm^r-R 1μL，ddH₂O 10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 25s for 30 cycles; extension was continued for 10min at 72 ℃.

Preferably, in step (4), the enzyme digestion system is as follows, and the total volume is 40 μ L:

overlapping PCR products 20. mu.L, 10 XK Buffer 4. mu.L, BamHI endonuclease 2. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 37 ℃ for 1.5 h.

Preferably, in step (4), the fusion gene spo II E-Cm is fused after concentration^rThe concentration of (b) is 300-500 ng/. mu.L.

According to a further preferred embodiment of the present invention, in the step (4), the bacillus clausii competent cell is transformed by the following steps:

and (3) electrically converting the concentrated enzyme digestion product into bacillus clausii competent cells for 4-5 ms under the condition of 1500-1800V, and then culturing in a liquid recovery culture medium for 3-4 h at 37 ℃ to obtain the bacillus clausii.

Further preferably, the components of the liquid recovery culture medium are as follows, and the components are all in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and water in balance, wherein the pH value is 7.0-7.4.

More preferably, the preparation steps of the bacillus clausii competent cell are as follows:

selecting fresh Bacillus clausii single colony, and culturing to thallus concentration OD₆₀₀And (3) putting the bacillus clausii strain.

Wherein the components of the electrotransfer buffer solution are as follows:

sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

Preferably, in the step (4), the screening step is as follows:

and (3) coating the transformed Bacillus clausii on an LB (Luo-Beauveria-Bertoni) flat plate containing chloramphenicol, culturing at 37 ℃ for 12-24 h, selecting a positive strain, and identifying to obtain the bacillus clausii.

Further preferably, the LB plate containing chloramphenicol is an LB solid medium containing chloramphenicol at a concentration of 25. mu. mol/mL.

Advantageous effects

1. The invention discloses the effect of sporulation related gene spo II E on controlling the growth speed of a strain for the first time, and partial gene fragments of spo II E and Cm are inactivated in an insertion mode^rGene fusion, fusion gene spo II E-Cm^rThe bacillus clausii spo II E gene sequence is inserted into the bacillus clausii spo II E gene sequence, so that the spo II E gene can not be normally expressed and inactivated, and the spo II E gene inactivated strain can obviously reduce the sporulation rate to 0.3 percent, and the growth speed of the engineering strain is obviously higher than that of the original strain, thereby realizing the accumulation of the cell number in a shorter time;

2. the engineering strain constructed by the invention improves the fermentation enzyme activity of amylase, and is beneficial to genetic breeding and industrial production of bacillus enzyme preparation production strains.

Drawings

FIG. 1 is an agarose gel electrophoresis of a Spo II E gene fragment of Bacillus clausii of the present invention;

in the figure: lane M is a DNA molecular weight marker (DNA marker), lanes 1-3 are spo II E gene bands, and the size is 793 bp;

FIG. 2 shows Cm of the present invention^rAgarose gel electrophoresis of the gene fragment;

in the figure: lane M is the DNA molecular weight marker (DNA marker), and lanes 1-4 are Cm^rA gene band with the size of 1259 bp;

FIG. 3 is an agarose gel electrophoresis image of the transformants inactivated by the spo II E gene of Bacillus clausii of the present invention;

in the figure: lane M is DNA molecular weight marker (DNA marker), lanes 1-4 are transformant bands, and the size is 2028 bp;

FIG. 4 is a line graph showing the change in the cell concentration of the spo II E inactivated strain and the starting strain;

in the figure: and B.clausii QL-1 delta spo II E is a spo II E inactivated strain, and B.clausii QL-1 is an original strain.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples, but the scope of the present invention is not limited thereto.

The terms used in the present methods, unless otherwise specified, generally have the meanings that are commonly understood by those of ordinary skill in the art.

In the following examples, various procedures and methods not described in detail and well known in the art are conventional methods. The source of the reagents used, the name of the product, and the components necessary to list them, are indicated at the time of their first appearance, and the same reagents used thereafter, unless otherwise specified, are the same as indicated for the first time.

The source of the biological material is as follows:

the Bacillus clausii (Bacillus clausii) in the examples was purchased from the institute of biotechnology, north beijing, and the strain numbers: BNCC160124, a common commercially available strain;

plasmid pHT01 was purchased from Hangzhou Bao Sai Bio Inc.

The LB solid medium comprises the following components in percentage by mass:

1% of peptone, 0.5% of yeast extract powder, 1% of sodium chloride, 2% of agar and the balance of water, wherein the pH value is 7.0-7.4;

the LB culture medium comprises the following components in percentage by mass:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, and balance water, wherein the pH value is 7.0-7.4

Example 1: preparation of target Gene fragment

Extracting the genome DNA of the Bacillus clausii (according to the specification of an Ezup column type bacterial genome DNA extraction kit)

Designing a primer according to the nucleotide sequence of spo II E gene, introducing a BamHI enzyme cutting site into an upstream primer, and adding Cm into a downstream primer^rThe 5' -end of the fragment is 10 bases, and the primers are synthesized by Biotechnology engineering (Shanghai) GmbH. 2 XHiFi-PCR Master polymerase from Bao bioengineering GmbH was used to amplify spo II E gene using Bacillus clausii genomic DNA as template. The nucleotide sequence of the primers is as follows, wherein the BamHI cleavage site is underlined.

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC

spo ⅡE-R：GCCAGCAAAAAGCGTTCCTACAAGTAAGCC；

The PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, primer spo II E-F2.5 μ L, primer spo II E-R2.5 μ L, Bacillus clausii genomic DNA 2.5 μ L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 53 ℃ for 30s, and extension at 72 ℃ for 1min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

The PCR product was examined by agarose gel electrophoresis, and the result is shown in FIG. 1, where the length of the target gene spo II E is 793bp (SEQ ID NO.1), the cloned PCR product spo II E was gel-recovered using a SanPrep column DNA gel recovery kit, and the resulting DNA solution was stored at-20 ℃ for further use.

(ii) the target Gene Cm^rObtaining of genes

Cm obtained by PCR amplification with pHT01 plasmid as template^rA gene fragment.

The nucleotide sequence of the primer amplified by the PCR is as follows, a BamHI enzyme cutting site is introduced into a downstream primer, 14 bases are added to the upstream primer and the 3' end of spoII E, wherein the underlined represents the BamHI enzyme cutting site:

Cm^r-F：CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG；

PCR amplification system, total volume 50 μ L:

2 × HiFi-PCR Master 25 μ L, primer Cm^r2.5. mu.L of-F, primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 40s for 30 cycles; extension was continued for 10min at 72 ℃.

The PCR product was checked by agarose gel electrophoresis, and the result is shown in FIG. 2, where Cm is the target gene^rIs 1259bp (SEQID NO.2), and the PCR product Cm obtained by cloning is^rThe gel was recovered using a SanPrep column DNA gel recovery kit and the DNA solution was stored at-20 ℃ for further use.

(iii) contacting the spo II E gene obtained in step (i) with the Cm gene obtained in step (ii)^rThe fragments are fused by overlapping PCR to prepare spo II E-Cm^rA fragment;

the nucleotide sequences of the primers used are as follows, the BamHI cleavage site being underlined:

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, gel recovery product spoII E fragment 2 μ L, gel recovery product Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; extension was continued for 10min at 72 ℃.

The second round of overlapping PCR amplification system is that the following reagents are added on the basis of the first round of PCR amplification system:

2 × HiFi-PCR Master 12.5 μ L, primer spoII E-F1 μ L, primer Cm^r-R 1μL，ddH₂O 10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 25s for 30 cycles; extension was continued for 10min at 72 ℃.

Similarly, agarose gel electrophoresis was performed to examine the PCR product and detect the target gene spo II E-Cm^r2028bp (SEQ ID NO.3), and cloning the obtained PCR product spo II E-Cm^rThe gel was recovered using a SanPrep column DNA gel recovery kit, and the resulting DNA solution was stored at-20 ℃ for further use.

Example 2: preparation of Bacillus Clarkii competence

Selecting a fresh single colony of the Bacillus clausii, inoculating the single colony in 10mL LB culture medium, and culturing at 37 ℃ and 200r/min for 12 h;

(ii) inoculating 2.0mL of the bacterial solution to 50mL of GM medium, culturing at 37 deg.C and 200r/min for 4h to OD₆₀₀＝1.0；

(iii) transferring the bacterial liquid to a 50mL centrifuge tube, and carrying out ice bath for 10 min;

(IV) centrifuging at 4 ℃ for 5min at 5000r/min after ice bath, and collecting thalli;

(V) washing the centrifuged thallus with precooled electrotransfer buffer (ETM) for 3 times;

(VI) after the washing, resuspending the cells using 1000. mu.L of an electrotransfer buffer;

(VII) subpackaging the prepared competent cells into 100 mu L/tube, and storing at-80 ℃ for later use.

Wherein, the culture medium GM: LB culture medium +0.5mol/L sorbitol;

electrotransfer buffer (ETM): sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

Example 3: spo II E-Cm^rFragment electrotransformation of Bacillus clausii

Introducing spo II E-Cm^rThe fragment was digested with restriction enzyme BamH I;

the cleavage system (40. mu.L) was as follows:

10 XK Buffer 4. mu.L, BamHI endonuclease 2. mu.L, overlap PCR gel recovery product 20. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 37 ℃ for 1.5 h.

(ii) concentrating the cleaved product

Adding 1/10 volume 3mol/L sodium acetate and 2.5 volume times of anhydrous alcohol, placing in refrigerator at-20 deg.C for 20 min; centrifuging at 12000r/min for 5min to obtain precipitate; adding 300 μ L of 75% (volume percent) absolute ethanol solution into the precipitate, and resuspending the precipitate; 12000r/min, centrifuging for 5min, and air drying at 37 deg.C for 30min to remove ethanol; add 20. mu.L of ddH₂O resuspend DNA and store at-20 ℃ until use.

(iii) electrotransformation

Determination of spo II E-Cm^rElectrically converting the competent cells and the concentrated product at 1500V for 5ms after ice bath for 5min when the concentration of the fragment reaches 470 ng/mu L, recovering and culturing the cells at 37 ℃ for 4h through a liquid recovery culture medium RM, centrifuging at 4000r/min for 5min, suspending and precipitating 100 mu L of supernatant, coating a 25 mu mol/mL chloramphenicol plate, culturing at 37 ℃ for 20h at constant temperature, and screening transformants with chloramphenicol resistance;

the liquid recovery culture medium RM comprises the following components in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and balance water, wherein the pH value is 7.2.

Example 4: culture and identification of positive recombinant bacteria

Selecting the positive recombinant bacterial colony, inoculating the bacterial colony into a liquid LB culture medium containing chloramphenicol resistance, culturing at 37 ℃ for 12 hours, repeatedly freezing and thawing the bacterial liquid for 3-4 times, and taking the bacterial liquid as a template, spo II E-F and Cm^rthe-R is a primer for PCR amplification, an amplification product is verified by agarose gel electrophoresis, and the verification result is shown in figure 3;

the PCR primer sequence is as follows;

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG

wherein the restriction sites are indicated by underlining.

The PCR amplification system is 25 mu L:

2 × HiFi-PCR Master 12.5 μ L, bacterial liquid 2 μ L, spo II E-F1 μ L, Cm^r-R 1μL，ddH₂O 8.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 4min for 25s, 30 cycles; extension was continued for 10min at 72 ℃.

Example 5: measurement of sporulation Rate

Taking the strain identified as the positive recombinant strain in the example 4, repeatedly activating the strain in LB solid culture medium containing 25 mu mol/mL chloramphenicol for 2 times, and statically culturing the strain at 37 ℃ for 20 hours; selecting single colony to culture in 10mL LB liquid culture medium at 37 deg.C and 200r/min for 12h, inoculating 2% of the colony into 100mL LB liquid culture medium containing 25 μmol/mL chloramphenicol, and culturing at 37 deg.C and 200 r/min;

(ii) the method for measuring the sporulation rate comprises:

taking the bacterial liquid cultured for 36h in the step (i), carrying out water bath treatment for 10min at 80 ℃, carrying out ice bath for 5min, diluting by proper times, taking 100 mu L of the bacterial liquid coated on an LB plate, carrying out constant-temperature culture for 24h at 37 ℃, counting the plate, calculating the sporulation rate, comparing the starting strain with the non-heat-treated positive recombinant strain, and obtaining the counting result shown in Table 1.

The spore formation rate (%) is (number of spores/total number of viable bacteria) × 100%.

TABLE 1 determination of sporulation rates of starting strains and of spo IIE-inactivated strains

From the above results, it was found that the sporulation rate of the recombinant Bacillus clausii (spo II E gene-inactivated) strain was 0.3%, that of the starting strain was 89.5%, and that the sporulation rate of the spo II E gene-inactivated strain was significantly reduced.

Example 6: determination of growth cycle

Taking the strain identified as the positive recombinant strain in the example 4, repeatedly activating the strain in LB solid culture medium containing 25 mu mol/mL chloramphenicol for 2 times, and culturing the strain at 37 ℃ for 20 hours; selecting single colony to culture in 10mL LB liquid culture medium at 37 deg.C and 200r/min for 12h, inoculating 2% of the colony into 100mL LB liquid culture medium containing 25 μmol/mL chloramphenicol, and culturing at 37 deg.C and 200 r/min;

(ii) sampling every 2-4 h, diluting by a proper multiple, and measuring the spectrophotometric value at 600 nm.

The change in spectrophotometric value is shown in fig. 4, and the results show: the spo II E gene inactivated strain is in a logarithmic growth phase within 2-18 h, a stationary phase within 18-28 h and a decay phase after 28h, and the OD of the spo II E gene inactivated strain is in a determination period₆₀₀All are larger than original strains, effectively improving the accumulation of the thalli in unit time.

Example 7: determination of enzyme Activity of Amylase

Repeatedly activating the starting strain and the spoIIAE gene inactivated strain identified in example 4 in LB solid medium containing 25. mu. mol/mL chloramphenicol for 2 times, and performing static culture at 37 ℃ for 20 h; selecting a single colony to be cultured in 10mL of liquid LB culture medium at 37 ℃ at 200r/min for 12h, inoculating the single colony in 100mL of fermentation culture medium containing 25 mu mol/mL of chloramphenicol in an inoculation amount of 3%, and culturing at 37 ℃ at 200 r/min; after 72h, taking the fermentation culture solution, and performing cell disruption and amylase purification to obtain an enzyme solution to be detected;

(ii) the specific method for measuring the enzyme activity of the amylase comprises the following steps: sucking 20.0mL of soluble starch solution into a test tube, adding 5.0mL of phosphate buffer solution, shaking uniformly, and preheating in a constant-temperature water bath at 60 ℃ for 8 min; adding 1.0mL of diluted enzyme solution to be detected prepared in the step (i), timing immediately, shaking up, and reacting for 5 min; immediately sucking 1.0mL of reaction liquid by using an automatic pipette, adding the reaction liquid into a test tube which is previously filled with 0.5mL of 0.1mol/L hydrochloric acid solution to terminate the reaction, then adding 5.0mL of dilute iodine solution, taking the dilute iodine solution without the reaction liquid as a blank, measuring the absorbance at the wavelength of 660nm, and checking the enzyme liquid concentration corresponding to the absorbance according to a data table.

(iii) enzyme activity calculation formula: x ═ c × n

In the formula: x-enzyme Activity of the sample [ IU/g (IU/mL) ]

c-concentration of sample enzyme solution (IU/mL)

n-dilution factor of sample

Definition of enzyme activity: 1mL of liquid enzyme, and the enzyme amount required for liquefying 1g of soluble starch in 1h at the temperature of 60 ℃ and the pH value of 6.0 is 1 enzyme activity unit (U/mL).

The enzyme activity unit of amylase is converted into U/g by measuring the dry weight.

The preparation method of the fermentation medium comprises the following steps:

A. weighing 2g (accurate to 0.001g) of soluble starch in a beaker, mixing the soluble starch into slurry with a small amount of water, slowly adding the slurry into 40mL of boiling water while stirring, then washing the beaker filled with the starch by water for several times, pouring a washing solution into the beaker, stirring and heating the beaker until the beaker is completely transparent, cooling the beaker, adding 1g of peptone and 2g of yeast powder, stirring the beaker until the volume is 50mL after dissolution, and sterilizing the beaker for later use at 121 ℃ for 20 min.

B. 2.66g of Na were weighed₂HPO₄And 0.66g NaH₂PO₄Dissolving in water, diluting to 50mL, sterilizing at 121 deg.C for 20min, and keeping.

Cooling solution A and solution B, and mixing to obtain fermentation medium.

The preparation method of the soluble starch solution comprises the following steps:

weighing 2.000g (accurate to 0.001g) of soluble starch in a beaker, blending into slurry with a small amount of water, slowly adding 70mL of boiling water while stirring, then washing the beaker containing the starch with water in several times, pouring the washing solution into the beaker, stirring and heating until the solution is completely transparent, cooling and fixing the volume to 100 mL.

The preparation method of the phosphate buffer solution comprises the following steps: 45.23g of disodium hydrogen phosphate and 8.07g of citric acid were weighed, dissolved in water to a volume of 1000mL, and the pH was adjusted to 6.0.

Through calculation, the enzyme activity of the amylase is 4.8 multiplied by 10 after the spo II E inactivated strain is fermented for 72 hours⁵U·g^-1The enzyme activity of the amylase is 0.86 multiplied by 10 after the original strain is fermented for 72 hours⁵U·g^-1The amylase activity of the spo II E inactivated strain is 5.58 times of that of the original strain, and the fermentation activity of the spo II E inactivated strain is effectively improved compared with that of the original strain.

SEQUENCE LISTING

<110> university of Qilu Industrial science

Application of <120> sporulation related gene spo II E in influencing growth of bacterial strain and producing enzyme

<160>3

<170>PatentIn version 3.5

<210>1

<211>793

<212>DNA

<213>Bacillus clausii

<400>1

ccttaaaagc ggagccaaaa cggtgcttta tgattggggc atattcattg ccattcttgg 60

ttttctgcta ggaagggcta tgattttatc agagttgacg ccatttatct tgccattctt 120

ggcggccgtg ttcttgttaa gacgctctca atcactcatt gctgcagctt cattattagc 180

aggtgctgtg ttcagtttcc atggtcagtt gatttttgcg attgcaggga tcgggttttt 240

tcttattctg tacaaatgta tgaaaatgtt catgaagtac cctgctaaat cgctccctta 300

tcttgtgttt tcagctagta tcgccacgag gctgtcactc gtatttttga cagaaggtgg 360

attaagccaa tatgcgatga tgatggctac agtcgaagcg gcgcttagct ttatcctgac 420

aatgatcttt atccaaagca taccgcttgt gacaggaaaa agaggcggac aagcactccg 480

gaatgaagaa attatttgtt taattatttt gcttgcctct gtaatgacag gaacagtcgg 540

ttggacgata aatgaagctg tgcttcagca tagctttgca agttatctcg ttttagtgtt 600

tgcttttgtt ggcggggctgcaataggctc gactgtcgga gtggtgacag gcttgatttt 660

aagcttggcc agtttagcaa gtctttatca gatgagtctg cttgcctttg caggcttgtt 720

aggagggttg ttaaaggaag ggaaacggat cggcgtgtca cttggcttac ttgtaggaac 780

gctttttgct ggc 793

<210>2

<211>1259

<212>DNA

<213> Artificial sequence

<400>2

cttgtaggaa cgctttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 60

attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa 120

cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcatgctta 180

agttattggt atgactggtt ttaagcgcaa aaaaagttgc tttttcgtac ctattaatgt 240

atcgttttag aaaaccgact gtaaaaagta cagtcggcat tatctcatat tataaaagcc 300

agtcattagg cctatctgac aattcctgaa tagagttcat aaacaatcct gcatgataac 360

catcacaaac agaatgatgt acctgtaaag atagcggtaa atatattgaa ttacctttat 420

taatgaattt tcctgctgta ataatgggta gaaggtaatt actattatta ttgatattta 480

agttaaaccc agtaaatgaa gtccatggaa taatagaaag agaaaaagca ttttcaggta 540

taggtgtttt gggaaacaat ttccccgaac cattatattt ctctacatca gaaaggtata 600

aatcataaaa ctctttgaag tcattcttta caggagtcca aataccagag aatgttttag 660

atacaccatc aaaaattgta taaagtggct ctaacttatc ccaataacct aactctccgt 720

cgctattgta accagttcta aaagctgtatttgagtttat cacccttgtc actaagaaaa 780

taaatgcagg gtaaaattta tatccttctt gttttatgtt tcggtataaa acactaatat 840

caatttctgt ggttatacta aaagtcgttt gttggttcaa ataatgatta aatatctctt 900

ttctcttcca attgtctaaa tcaattttat taaagttcat ttgatatgcc tcctaaattt 960

ttatctaaag tgaatttagg aggcttactt gtctgctttc ttcattagaa tcaatccttt 1020

tttaaaagtc aatattactg taacataaat atatatttta aaaatatccc actttatcca 1080

attttcgttt gttgaactaa tgggtgcttt agttgaagaa taaaagacca cattaaaaaa 1140

tgtggtcttt tgtgtttttt taaaggattt gagcgtagcg aaaaatcctt ttctttctta 1200

tcttgataat aagggtaact attgccgatc gtccattccg acagcatcgc cagtcacta 1259

<210>3

<211>2028

<212>DNA

<213> Artificial sequence

<400>3

ccttaaaagc ggagccaaaa cggtgcttta tgattggggc atattcattg ccattcttgg 60

ttttctgcta ggaagggcta tgattttatc agagttgacg ccatttatct tgccattctt 120

ggcggccgtg ttcttgttaa gacgctctca atcactcatt gctgcagctt cattattagc 180

aggtgctgtg ttcagtttcc atggtcagtt gatttttgcg attgcaggga tcgggttttt 240

tcttattctg tacaaatgta tgaaaatgtt catgaagtac cctgctaaat cgctccctta 300

tcttgtgttt tcagctagta tcgccacgag gctgtcactc gtatttttga cagaaggtgg 360

attaagccaa tatgcgatga tgatggctac agtcgaagcg gcgcttagct ttatcctgac 420

aatgatcttt atccaaagca taccgcttgt gacaggaaaa agaggcggac aagcactccg 480

gaatgaagaa attatttgtt taattatttt gcttgcctct gtaatgacag gaacagtcgg 540

ttggacgata aatgaagctg tgcttcagca tagctttgca agttatctcg ttttagtgtt 600

tgcttttgtt ggcggggctg caataggctc gactgtcgga gtggtgacag gcttgatttt 660

aagcttggcc agtttagcaa gtctttatca gatgagtctg cttgcctttg caggcttgtt 720

aggagggttg ttaaaggaag ggaaacggat cggcgtgtca cttggcttac ttgtaggaac 780

gctttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat 840

aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc 900

agcgagtcag tgagcgagga agcggaagag cgcccaatac gcatgcttaa gttattggta 960

tgactggttt taagcgcaaa aaaagttgct ttttcgtacc tattaatgta tcgttttaga 1020

aaaccgactg taaaaagtac agtcggcatt atctcatatt ataaaagcca gtcattaggc 1080

ctatctgaca attcctgaat agagttcata aacaatcctg catgataacc atcacaaaca 1140

gaatgatgta cctgtaaaga tagcggtaaa tatattgaat tacctttatt aatgaatttt 1200

cctgctgtaa taatgggtag aaggtaatta ctattattat tgatatttaa gttaaaccca 1260

gtaaatgaag tccatggaat aatagaaaga gaaaaagcat tttcaggtat aggtgttttg 1320

ggaaacaatt tccccgaacc attatatttc tctacatcag aaaggtataa atcataaaac 1380

tctttgaagt cattctttac aggagtccaa ataccagaga atgttttaga tacaccatca 1440

aaaattgtat aaagtggctc taacttatcc caataaccta actctccgtc gctattgtaa 1500

ccagttctaa aagctgtatt tgagtttatc acccttgtca ctaagaaaat aaatgcaggg 1560

taaaatttat atccttcttg ttttatgttt cggtataaaa cactaatatc aatttctgtg 1620

gttatactaa aagtcgtttg ttggttcaaa taatgattaa atatctcttt tctcttccaa 1680

ttgtctaaat caattttatt aaagttcatt tgatatgcct cctaaatttt tatctaaagt 1740

gaatttagga ggcttacttg tctgctttct tcattagaat caatcctttt ttaaaagtca 1800

atattactgt aacataaata tatattttaa aaatatccca ctttatccaa ttttcgtttg 1860

ttgaactaat gggtgcttta gttgaagaat aaaagaccac attaaaaaat gtggtctttt 1920

gtgttttttt aaaggatttg agcgtagcga aaaatccttt tctttcttat cttgataata 1980

agggtaacta ttgccgatcg tccattccga cagcatcgcc agtcacta 2028

Claims (8)

1. The application of spoIIAE related to sporulation in influencing the growth and enzyme production of strains is characterized by comprising the following steps:

(1) extracting genome DNA of the Bacillus clausii, and performing PCR amplification by using the genome DNA as a template to obtain a spo II E related to sporulation of the Bacillus clausii, wherein the nucleotide sequence of the spo II E is shown as SEQ ID NO. 1;

(2) PCR amplification is carried out by taking pHT01 plasmid as a template, and Cm is obtained by amplification^rFragment, Cm^rThe nucleotide sequence of the fragment is shown as SEQID NO. 2;

(3) the spo II E gene prepared in the step (1) and the Cm gene prepared in the step (2) are mixed^rThe fragments are fused by adopting overlapping PCR to obtain a fusion gene spo II E-Cm^r；

(4) Fusing the fusion gene spo II E-Cm in the step (3)^rAfter enzyme digestion, concentrating, then transforming bacillus clausii, and screening to obtain a positive strain which can be applied to thallus growth and enzyme production; the concentrated fusion gene spo II E-Cm^rThe concentration of (a) is 300-500 ng/muL;

the enzyme production is amylase, and the enzyme activity of the amylase is 5-6 times of that of the original strain.

2. The use of claim 1, wherein in step (1), the nucleotide sequences of the primers amplified by PCR are as follows:

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；

spo ⅡE-R：GCCAGCAAAAAGCGTTCCTACAAGTAAGCC；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, primer spo II E-F2.5 μ L, primer spo II E-R2.5 μ L, Bacillus clausii genomic DNA 2.5 μ L, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 53 ℃ for 30s, and extension at 72 ℃ for 1min for 45s for 30 cycles; extension was continued for 10min at 72 ℃.

3. The use of claim 1, wherein in step (2), the nucleotide sequences of the primers amplified by PCR are as follows:

Cm^r-F：CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC；

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG；

the PCR amplification system was as follows, with a total volume of 50. mu.L:

2 × HiFi-PCR Master 25 μ L, primer Cm^r2.5. mu.L of-F, primer Cm^r2.5. mu.L of R, 2.5. mu.L of pHT01 plasmid, ddH₂O 17.5μL；

The PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 40s for 30 cycles; extension was continued for 10min at 72 ℃.

4. The use of claim 1, wherein in step (3), the nucleotide sequences of the amplification primers of the overlapping PCR are as follows:

spo ⅡE-F：CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；

Cm^r-R：CGCGGATCCTAGTGACTGGCGATGCTG；

the first round of overlap PCR amplification system was as follows, with a total volume of 25. mu.L:

2 × HiFi-PCR Master 12.5 μ L, gel recovery product spoII E fragment 2 μ L, gel recovery product Cm^rFragment 2. mu.L, ddH₂O 8.5μL；

The first round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min for 40s, 5 cycles; continuing to extend for 10min at 72 ℃;

the second round of overlapping PCR amplification system is characterized in that the following reagents are added on the basis of the first round of PCR amplification system:

2 × HiFi-PCR Master 12.5 μ L, primer spoII E-F1 μ L, primer Cm^r-R 1μL，ddH₂O 10.5μL；

The second round of overlap PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min for 25s for 30 cycles; extension was continued for 10min at 72 ℃.

5. The use of claim 1, wherein in step (4), the reaction system of the enzyme digestion is as follows, and the total volume is 40 μ L:

overlapping PCR products 20. mu.L, 10 XK Buffer 4. mu.L, BamHI endonuclease 2. mu.L, ddH₂O 14μL；

The enzyme digestion conditions are as follows: 37 ℃ for 1.5 h.

6. The use of claim 1, wherein in step (4), the transformation of Bacillus clausii is performed by the following steps:

electrically converting the concentrated enzyme digestion product into bacillus clausii competent cells for 4-5 ms under the condition of 1500-1800V, and then culturing in a liquid recovery culture medium for 3-4 h at 37 ℃ to obtain the bacillus clausii;

the liquid recovery culture medium comprises the following components in percentage by weight:

peptone 1%, yeast extract powder 0.5%, sodium chloride 1%, sorbitol 9%, mannitol 7%, and water in balance, wherein the pH value is 7.0-7.4.

7. The use of claim 6, wherein said susceptible cells of Bacillus clausii are prepared by the steps of:

selecting fresh Bacillus clausii single colony, and culturing to thallus concentration OD₆₀₀Putting the bacillus clausii strain;

the components of the electrotransfer buffer solution are as follows:

sorbitol with the mass percent of 9.1 percent, mannitol with the mass percent of 9.1 percent, glycerol with the volume percent of 10 percent and the balance of water.

8. The use of claim 1, wherein in step (4), the screening step is as follows:

coating the transformed Bacillus clausii on an LB (Luo-Beauveria-Bertoni) flat plate containing chloramphenicol, culturing at 37 ℃ for 12-24 h, selecting a positive strain, and identifying to obtain the bacillus clausii;

wherein the LB plate containing chloramphenicol is LB solid medium with chloramphenicol concentration of 25. mu. mol/mL.

Images