CN104195190A - Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli - Google Patents
Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli Download PDFInfo
- Publication number
- CN104195190A CN104195190A CN201410448698.3A CN201410448698A CN104195190A CN 104195190 A CN104195190 A CN 104195190A CN 201410448698 A CN201410448698 A CN 201410448698A CN 104195190 A CN104195190 A CN 104195190A
- Authority
- CN
- China
- Prior art keywords
- hema
- succd
- bacillus coli
- ala
- recombination bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli. The method comprises the following steps: inoculating the recombinant escherichia coli into an AM1-yeast powder inorganic salt culture medium; and firstly culturing under an aerobic condition for 8-15 hours to grow thalli, and then transforming into anaerobic fermentation, wherein the fermentation time is 72+/-10 hours. According to the method, the 5-aminolevulinic acid can be produced through the anaerobic fermentation without adding an expensive succinic acid precursor, and the produced 5-ALA (Aminolevulinic Acid) is difficult to degrade, so that the process is simplified, and the cost is reduced. Experiments prove that the output of the 5-ALA achieves as high as 1.65 g/l under the condition of the anaerobic fermentation, and the glucose transformation rate of the 5-ALA is 0.32 g/g, so that the 5-ALA is prompted to have very good industrial development and application prospect.
Description
Technical field
The present invention relates to microbial technique and field of fermentation engineering, specifically, relate to a kind of method of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA.
Background technology
5-ALA (5-aminolevulinic acid is called for short 5-ALA) is a kind of non-protein amino acid being extensively present in bacterium, fungi, animal and plant body, and its molecular formula is C
5o
3nH
9, molecular weight is 131.13, fusing point is 118 ℃.Unstable in the aqueous solution, easily there is condensation reaction.5-ALA is the important intermediate in the biosynthesizing of pyridine.So Chang Zuowei vitamin B12, protoheme and chlorophyllous precursor.Medically, it can be used as the various cancers of photodynamics pharmacological agent.In agricultural, 5-ALA, due to crop, animal and human's nontoxicity, can be used as plant-growth regulator, weedicide and sterilant.This is external industrial, and 5-ALA is a kind of important organic synthesis intermediate.
The many biologies of occurring in nature can synthesize 5-ALA, if photosynthetic bacterium is that a class can be synthesized in a large number 5-ALA and be secreted into the microorganism outside born of the same parents.In nature biotechnology body, in the approach of synthetic 5-ALA, C4 approach is to utilize succinyl--CoA and glycine at next step generation of 5-aminolevulinate synthetase (5-ALAS) catalysis 5-ALA; C5 approach is that L-glutamic acid is through Glutamyl-tRNA synthetase (GluRS, by gltX genes encoding), glutamy-tRNA reductase enzyme (GluTR, by hemA genes encoding) and L-glutamic acid-1-semialdehyde-2,1-transaminase (GSA-AM, by hemL genes encoding) three step catalysis generate 5-ALA.In cell, 5-ALA further metabolism forms heme Heme.
The biosynthesizing mode of at present corresponding with biosynthesizing 5-ALA is utilized C4 approach to produce 5-ALA and directly from glucose, is synthesized two kinds of 5-ALA by C5 approach.Utilize C4 approach to produce 5-ALA, by expressing 5-ALA synthetic enzyme bio-transformation succsinic acid and glycine, produce 5-ALA.In this research, by optimizing expression and the fermentation condition of 5-aminolevulinate synthetase hemA gene, can improve the output of 5-ALA.By C5 approach, directly from the synthetic 5-ALA of glucose, by the synthetic 5-ALA of C5 approach, need complicated metabolic engineering to optimize, must build engineering strain.Once construction method of gene engineering strain completes, its biosynthetic process is relatively simple and cheap.Retrieval finds to utilize the research of the synthetic 5-ALA of photosynthetic bacterium also a lot, but in Fermentation by Photosynthetic Bacteria, needs to adopt illumination, thereby has increased cost, and photosynthetic bacterium growth is slow in addition, and fermentation time is long, is not suitable for large-scale industry fermentative production.And under aerobic condition, 5-ALA easily degraded in the fermentation later stage, further metabolism is downstream converted into protoheme (integral part that aerobic repiration electronics transmits), and output obviously declines.Meanwhile, the partial intermediate of protoheme route of synthesis has toxic action to cell, easily causes thalli growth slow.
Under anaerobic condition, 5-ALA is difficult for being converted degraded, is conducive to the production of 5-ALA and output is improved; Meanwhile, anaerobically fermenting has reduced energy expenditure the cost----aeration-agitation cost of maximum in fermentation industry, and culturing process is simple, industrial scale easily expands, and has obvious advantage.But retrieval is found the relevant method of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA and be have not been reported.
Summary of the invention
For the deficiency of existing method and technology, the object of this invention is to provide a kind of method of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA (5-ALA).
Technical scheme of the present invention is the C4 biosynthetic pathway based on 5-ALA, and utilizing recombination bacillus coli under AM1 yeast powder minimal medium condition, to take cheap glucose and glycine is that substrate through anaerobic fermentation is produced 5-ALA (5-ALA).Wherein, described recombination bacillus coli is any bacterial strain that can express 5-aminolevulinate synthetase (ALAS) and succinic thiokinase (SucCD) and under anaerobic produce succsinic acid.
The method of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA of the present invention, it is characterized in that: the fermentation condition that utilizes recombination bacillus coli anaerobism to produce 5-ALA is: with volume percent, count 2%～5% inoculum size recombination bacillus coli is inoculated in AM1-yeast powder minimal medium, first under aerobic condition, cultivate 8～15h growing mycelia, then turn anaerobically fermenting, fermentation time is 72 ± 10h; Wherein, it is 37 ± 1 ℃ that temperature is all controlled, and it is 6.5 ± 0.5 that pH all controls, and described AM1-yeast powder minimal medium formula is: (NH
4)
2hPO
4, 2.6306g/l; NH
4h
2pO
4, 0.8709g/l; KCl, 0.1491g/l; 3-morpholine propanesulfonic acid (MOPS), 20.9270g/l; Yeast powder, 2g/l; Use Na
2cO
3adjust pH to 7.0, surplus is water; During use, add 0.15mM MgSO
47H
2o and volume ratio are 1 ‰ trace element solution; Wherein trace element 1000 * mother liquor formula is: FeCl
36H
2o, 2.4003g/l; CoCl
26H
2o, 0.2998g/l; ZnCl
2, 0.2999g/l; Na
2moO
42H
2o, 0.3000g/l; H
3bO
4, 0.0748g/l, MnCl
24H
2o, 0.4948g/l; CuCl
22H
2o, 0.1500g/l; With 120mM HCl, dissolve; Wherein, described recombination bacillus coli is any bacterial strain that can express 5-aminolevulinate synthetase (ALAS) and succinic thiokinase (SucCD) and under anaerobic produce succsinic acid.
Above-mentioned utilization in the method that recombination bacillus coli anaerobically fermenting produces 5-ALA: described recombination bacillus coli is preferably cultivated 12h under aerobic condition, and rotating speed is 250 ± 10rpm.
Further, the above-mentioned method concrete steps of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA are:
(1) with transfering loop, from the glycerine pipe of the intestinal bacteria recombinant bacterial strain of preservation, dip after bacterium liquid, at the flat lining out of LB that contains 100 μ g/ml penbritins, and the LB flat board of line is placed in to 37 ℃ of cultivation 12 ± 1h.
(2) mono-clonal on LB flat board is inoculated in the 300ml shaking flask containing 50ml LB substratum, and to be placed on rotating speed be 250rpm, temperature is, in the shaking table of 37 ℃, to cultivate 12 ± 1h, obtains seed culture fluid.
(3) get 2ml seed liquor and be inoculated in the 300ml shaking flask containing 100ml AM1-yeast powder inorganic salt fermention medium, and to be placed on rotating speed be 250rpm, temperature is to ferment in the shaking table of 37 ℃, and induces with IPTG.K
2cO
3adjust pH to 6.5.The initial 2g/l glycine that adds of fermentation.
(4) fermented liquid after cultivation 12h is proceeded in the anaerobism bottle containing 130ml AM1-yeast powder inorganic salt fermention medium and seals anaerobically fermenting, condition: 37 ℃, 210rpm, pH6.5.Respectively at 12h, 22h, 28h respectively adds 2g/l glycine, and 72h finishes fermentation.Every 6h gets a sample and detects 5-ALA output.
Above-mentioned 5-ALA detection method is: the centrifugal fermented liquid 2min of 12000rpm, proceeds to supernatant in new centrifuge tube.Dilute by a certain percentage.Get diluent 400 μ l, add respectively the sodium acetate buffer of 200 μ l and the methyl ethyl diketone of 100 μ l, boil reaction 15min.Be cooled to room temperature, add Modified Ehrlich ' s reagent reagent react 10min, then utilize the cuvette of 1cm under wavelength 554nm, to utilize spectrophotometer to detect.
Above-mentioned utilization in the method that recombination bacillus coli anaerobically fermenting produces 5-ALA: described recombination bacillus coli makes by the following method: build the expression vector pTrc99a-hemA containing hemA gene, build again on this basis the expression vector pTrc99a-hemA-sucCD containing sucCD gene, by in constructed recombinant vectors pTrc99a-hemA-sucCD cotransformation recombination bacillus coli, obtain the recombination bacillus coli of energy while overexpression hemA and sucCD; Wherein, described hemA is the hemA gene that derives from the red bacillus of class ball, and described sucCD gene source is in intestinal bacteria.
Above-mentioned utilization in the method that recombination bacillus coli anaerobically fermenting produces 5-ALA: described recombination bacillus coli is intestinal bacteria YL106-hemA-sucCD preferably, intestinal bacteria W3110-hemA-sucCD, or intestinal bacteria W3110GAB-hemA-sucCD.
Wherein: above-mentioned recombination bacillus coli is intestinal bacteria YL106-hemA-sucCD preferably further, its genotype is MG1655 (ptsG poxB pta iclR sdhA arcA adhE ldhA pckA*ldhA::trc-rbs-glf)/pTrc99a-hemA-sucCD, make by the following method: build the expression vector pTrc99a-hemA containing hemA gene, build again on this basis the expression vector pTrc99a-hemA-sucCD containing sucCD gene, by in constructed recombinant vectors pTrc99a-hemA-sucCD cotransformation recombination bacillus coli YL106, obtain the recombination bacillus coli of energy while overexpression hemA and sucCD, be intestinal bacteria YL106-hemA-sucCD, wherein, described hemA is the hemA gene that derives from the red bacillus of class ball, and described sucCD gene source is in intestinal bacteria, described recombination bacillus coli YL106 has been deposited in that " Chinese Typical Representative culture collection " center ", deposit number is CCTCC NO:M 2013149, its genotype is MG1655 Δ ptsG Δ poxB Δ pta Δ iclR Δ sdhA Δ arcA Δ ldhA Δ adhE pckA*glf on April 17th, 2013
zM.
Unstable while the present invention is directed to the aerobic production of 5-ALA, the restriction being very easily degraded, and the high shortcoming of aerobic fermentation cost, provide a kind of anaerobically fermenting to produce the method for 5-ALA.The inventive method is by the effect of succinyl CoA synthase and 5-ALA synthetic enzyme hemA, adds glycine simultaneously and produces 5-ALA.The method is without adding expensive succsinic acid precursor, and the 5-ALA of production is difficult for being degraded; Meanwhile, adopt cheap minimal medium, simplified zymotechnique, reduced production cost.Under anaerobic fermentation conditions, the output of 5-ALA is up to 1.65g/l, and 5-ALA/ inversion rate of glucose is 0.32g/g.Transformation efficiency has clear superiority, and prompting has good commercial exploitation and application prospect.
Accompanying drawing explanation
Fig. 1. recombination bacillus coli glucose fermentation is produced the approach of 5-ALA.
Fig. 2. build plasmid expression vector collection of illustrative plates.
Fig. 3. the outer 5-ALA concentration of recombination bacillus coli YL106-hemA-sucCD anaerobic fermentation conditions lower eyelid, glucose, cell density (OD
600), the relation curve of succsinic acid and fermentation time.
Embodiment
The related enzyme of general explanation: embodiment is all purchased from TaKaRa company, and plasmid extraction kit is purchased from Tian Gen company, and sepharose reclaims DNA fragmentation test kit purchased from Shen Neng betting office, and operation is carried out according to respective description book completely.In plasmid construction, gene sequencing is completed by Hua Da genome company.5-ALA standard model and other reagent are all purchased from Sigma company.DH5 α competent cell is purchased from Quan Shijin Bioisystech Co., Ltd.
LB liquid culture based formulas: yeast powder 5g/l, peptone 10g/l, NaCl 10g/l, pH 7.0.
LB-ammonia benzyl culture medium prescription: yeast powder 5g/l, peptone 10g/l, NaCl 10g/l, penbritin 100 μ g/ml
5-ALA detection method is: the centrifugal fermented liquid 1ml of 12000rpm, proceeds to supernatant in new centrifuge tube.Dilute by a certain percentage.Get diluent 400 μ l, add respectively the sodium acetate buffer of 200 μ l and the methyl ethyl diketone of 100 μ l, boil reaction 15min.Be cooled to room temperature, add Modified Ehrlich ' s reagent 700 μ l, reagent react 10min, then utilizes the cuvette of 1cm under wavelength 554nm, to utilize spectrophotometer to detect.
Acetate buffer consists of (1 liter of distilled water): 57ml glacial acetic acid, 82g sodium acetate, anhydrous.
Improvement Ehrlich ' s reagent: in the graduated cylinder of 50ml, add the glacial acetic acid of 30ml, the p-dimethylaminobenzoic acid of 1g, 8ml70% perchloric acid, is then settled to 50ml.
AM1-yeast powder minimal medium formula: (NH
4)
2hPO
4, 2.6306g/l; NH
4h
2pO
4, 0.8709g/l; KCl, 0.1491g/l; 3-morpholine propanesulfonic acid (MOPS), 20.9270g/l; Yeast powder, 2g/l; Use Na
2cO
3adjust pH to 7.0, surplus is water; 121 ℃ of sterilizing 20min.During use, add 0.15mM MgSO
47H
2o and 1 ‰ (v/v) trace element solution.
Trace element solution (1000 * mother liquor) formula: FeCl
36H
2o, 2.4003g/l; CoCl
26H
2o, 0.2998g/l; ZnCl
2, 0.2999g/l; Na
2moO
42H
2o, 0.3000g/l; H
3bO
4, 0.0748g/l, MnCl
24H
2o, 0.4948g/l; CuCl
22H
2o, 0.1500g/l; With 120mM HCl, dissolve.121 ℃ of sterilizing 20min.
50% glucose solution (w/v), sterilizing separately.
Recombination bacillus coli (Escherichia coli) YL106, belongs to Gram-negative bacteria.This bacterium is shaft-like, and size is 0.4～0.6 micron * 1～3 micron, has ordinary pilus and sex fimbria, and without gemma, growth temperature range is between 15～46 ℃, and optimum growth temperature is 37 ℃.This bacterium has been deposited in that " Chinese Typical Representative culture collection " center ", deposit number is CCTCC NO:M2013149 on April 17th, 2013 by applicant.The related application of this bacterium number is: 201310203945.9, and the applying date is: 2013-05-28.The starting strain of this strain construction is e. coli k-12 series MG1655, and its genome sequence number is NC_000913.2.
Recombination bacillus coli W3110 (deriving from U.S. typical case DSMZ, preserving number ATCC27325).
The structure of the expression vector of embodiment 1,5-aminolevulinate synthetase (hemA) gene
The red bacillus gene group of the class ball sequence of announcing according to NCBI, utilize primer hemA-F:5 '-GCTCTAGAAGGAGAACAGCTATGGACTACAATCTGGCACTC-3 ' and hemA-R:5 '-CCCAAGCTTCGAAAGAAGTAGCACAGGGC-3', the plasmid PUI1014 that contains hemA gene of take carries out PCR as template, clones hemA gene.Clone's hemA fragment is utilized respectively to endonuclease Xbal and PstI digestion process, plasmid vector pTrc99a is also utilized respectively to endonuclease XbaI and PstI digestion process simultaneously.Utilize sepharose test kit to reclaim the hemA fragment of digestion process and pTrc99a plasmid vector, then utilize T4 ligase enzyme to connect.
Linked system is:
HemA fragment: 6 μ l
PTrc99a carrier: 2 μ l
10×Buffer：1μl
Τ 4 ligase enzymes: l μ l
25 ℃ connect after 1h, and the connecting fluid of 10 μ l is transformed to intestinal bacteria YL106 competent cell.
Conversion process is: the connecting fluid of 10 μ l is added in competent cell, mix.Ice bath 30min, 42 ℃ of thermal shock 90s, ice bath 2min, adds the LB substratum of 900 μ l, and 37 ℃, 180rpm, hatching lh, coating amicillin resistance is dull and stereotyped, cultivates 16h, and picking transformant extracts plasmid checking.Then enter the correct of ー step sequence verification hemA gene.Thereby obtain recombinant plasmid pTrc99a-hemA.
The structure of embodiment 2, succinic thiokinase (sucCD) expression vector
The genome of E.coli sequence of announcing according to NCBI, utilize primer HindIII-sucCD-F:5 '-CCCAAGCTTAGAAGGAGAACAGCTATGAACTTACATGAATATCAGGCA-3 ' and HindIII-sucCD-R:5 '-CCCAAGCTTTTATTTCAGAACAGTTTTCAGTGC-3 ', the intestinal bacteria MG1655 genome of take is template, pcr amplification sucCD gene.Clone's sucCD fragment is utilized to endonuclease HindIII digestion process, simultaneously by plasmid vector pTrc99A-hemA also endonuclease HindIII digestion process.Utilize sepharose test kit to reclaim the sucCD fragment of digestion process and pTrc99A-hemA plasmid vector, then utilize T4 ligase enzyme to connect.
Linked system is 10 μ l:
SucCD fragment: 6 μ l
PTrc99A-hemA carrier: 2 μ l
10×Buffer：1μl
T4 ligase enzyme: 0.5 μ l
25 ℃ connect after 1h, and the connecting fluid of 10 μ l is transformed to intestinal bacteria YL106 competent cell.
Conversion process is: the connecting fluid of 10 μ l is added in the YL106 competent cell of 100 μ l, mix.Ice bath 30min, 42 ℃ of thermal shock 90s, ice bath 2min, adds the LB substratum of 900 μ l, and 37 ℃, 180rpm, hatching lh, coating ammonia benzyl resistant panel, cultivates 12h, and picking transformant, extracts plasmid checking.Then further sequence verification sucCD gene is correct.Thereby obtain the recombinant plasmid pTrc99A-hemA-sucCD of overexpression hemA and sucCD.
Embodiment 3, utilize engineering bacteria W3110-hemA-sucCD anaerobically fermenting to produce ALA
Step (1) transforms recombination bacillus coli W3110 by constructed recombinant vectors pTrc99a-hemA-sucCD with ordinary method and (derives from U.S. typical case DSMZ, preserving number ATCC27325), obtain the recombination bacillus coli of energy while overexpression hemA and sucCD, called after intestinal bacteria W3110-hemA-sucCD.
Step (2) dips after bacterium liquid from the glycerine pipe of the W3110-hemA-sucCD of preservation with transfering loop, at the flat lining out of LB that contains 100 μ g/ml penbritins, and the LB flat board of line is placed in to 37 ℃ of cultivation 12h.
Step (3) is inoculated in the mono-clonal on LB flat board in the 300ml shaking flask containing 50ml LB substratum, and to be placed on rotating speed be 250rpm, and temperature is, in the shaking table of 37 ℃, to cultivate 12h, obtains seed culture fluid.
Step (4) is got 2ml seed liquor and is inoculated in containing 100ml AM1-yeast powder inorganic salt and sends out in the 300ml shaking flask of fermention medium, and to be placed on rotating speed be 250rpm, and temperature is to ferment in the shaking table of 37 ℃, and induces with IPTG.K
2cO
3adjust pH6.5.The initial 2g/l glycine that adds of fermentation.Initial glucose concentration is 20g/l.
Step (5) proceeds to the fermented liquid after fermentation culture 12h in the anaerobism bottle containing 130ml AM1-yeast powder inorganic salt fermention medium, and 37 ℃, 210rpm, anaerobically fermenting.Respectively at 12h, 22h, 28h respectively adds 2g/l glycine, and 72h finishes fermentation.Every 6h gets a sample and detects ALA output.
Fermentation results shows, this recombination bacillus coli process 72h anaerobically fermenting, and ALA output reaches 84mg/l.
The structure of embodiment 4, product succsinic acid recombinant bacterial strain W3110GAB
(1) knocking out of .plfB gene:
Bacterial classification: intestinal bacteria W3110
Described LB substratum is: peptone 10g/l, yeast powder 5g/l, NaCl 10g/l, penbritin, 100mg/l, paraxin 50mg/l.
Described ammonia benzyl mycin resistant panel is the penbritin that contains 100mg/l, the LB solid medium of 1.5% agar powder.
The dull and stereotyped paraxin for containing 50mg/l of described chlorampenicol resistant, the LB solid medium of 1.5% agar powder.
Described SOC substratum is: peptone 2g/l, yeast powder 0.5g/l, NaCl 0.0585g/l, KCl 0.0186g/l, MgCl
20.203g, MgSO
40.246g/l, glucose 20mmol/l.
The clone of a homologous recombination segment
Utilize Red recombination system to knock out goal gene.
The plfB gene order design primer of announcing according to Genbank:
pflB_F：5'-
TCGGCAACATTATCGGTGGTGGTTTGTTGGTTGGGTTGACGTGTAGGCTGGAGCTGCTT-3'
pflB_R：5'-
ATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTATGGGAATTAGCCATGGTC-3'
With pKD4, by PCR (polymerase chain reaction) amplification in vitro, obtain the restructuring segment with kalamycin resistance.PCR reaction conditions: 97 ℃ of denaturation 5min, 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 2min, 30 rear 72 ℃ of extension 10min of circulation, 4 ℃ of preservations.After the digestion of DpnI restriction endonuclease, reclaim the concentrated homologous recombination segment of purifying.
The preparation of b Electroporation-competent cells
(I) picking, with the intestinal bacteria W3110 of pKD46 plasmid, proceeds in LB substratum, adds 0.2% pectinose simultaneously, cultivates OD
600to 0.5;
(II) ice bath 15min, centrifugal thalline, then utilizes 10% glycerine washing three times;
(III) adds 10% glycerine, is concentrated into 50 times, packing competence.
C electricity transforms, screening recon
(I) draws the homologous recombination segment of 1mg, adds in the competent cell of 100 μ l, mixes.Regulate electroporation apparatus, 2.5Kv, electric shock;
(II) adds the SOC substratum of 900 μ l, and 37 ℃, 150rpm, cultivates 1h;
(III) coating chlorampenicol resistant is dull and stereotyped, transfers recon and utilizes primer
pflB-F:5'-ACTGATAACCTGATTCCGGTTACGA-3'
pflB-R:5'-ATGGGAATTAGCCATGGTCCATATG-3'
Carry out PCR detection, by the further confirmation of PCR product order-checking pflB gene, by kalamycin resistance gene, replaced.
The restructuring of (IV) FRT site-specific
PCP20 is proceeded to chlorampenicol resistant clone, cultivates 8h for 30 ℃, after be increased to 42 ℃ of incubated overnight 12h, thermal induction FLP recombinase is expressed, plasmid is also lost gradually.Utilize transfering loop to dip bacterium liquid and rule on non-resistant substratum, the mono-clonal growing is proceeded on the dull and stereotyped and chlorampenicol resistant flat board of non-resistant simultaneously and cultivated, on non-resistant flat board, grow and being deleted by FLP recombinase of not growing on chlorampenicol resistant flat board.Utilize detection primer pflB-F and pflB-R further to identify.
(V) obtains engineering strain W3110 (Δ pflB).
(2) knocking out of .ptsG gene:
Bacterial classification: intestinal bacteria W3110 (Δ pflB)
Described LB substratum is: peptone 10g/l, yeast powder 5g/l, NaCl 10g/l, penbritin, 100mg/l, paraxin 50mg/l.
Described ammonia benzyl mycin resistant panel is the penbritin that contains 100mg/l, the LB solid medium of 1.5% agar powder.
The dull and stereotyped paraxin for containing 50mg/l of described chlorampenicol resistant, the LB solid medium of 1.5% agar powder.
Described SOC substratum is: peptone 2g/l, yeast powder 0.5g/l, NaCl 0.0585g/l, KCl 0.0186g/l, MgCl
20.203g, MgSO
40.246g/l, glucose 20mmol/l.
The clone of a homologous recombination segment
Utilize Red recombination system to knock out goal gene.
The ptsG gene order design primer of announcing according to Genbank:
pKD-ptsG?F:
5'-ACGTAAAAAAAGCACCCATACTCAGGAGCACTCTCAATTGTGTAGGCTGGAGCTGCTTC-3'
pKD-ptsG?R:
5'-AGCCATCTGGCTGCCTTAGTCTCCCCAACGTCTTACGGAATGGGAATTAGCCATGGTCC-3'
With pKD3, by PCR (polymerase chain reaction) amplification in vitro, obtain the restructuring segment with chlorampenicol resistant.PCR reaction conditions: 97 ℃ of denaturation 5min, 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 90s, 30 rear 72 ℃ of extension 10min of circulation, 4 ℃ of preservations.After the digestion of DpnI restriction endonuclease, reclaim the concentrated homologous recombination segment of purifying.
The preparation of b Electroporation-competent cells
(I) picking, with the intestinal bacteria W3110 (Δ pflB) of pKD46 plasmid, proceeds in LB substratum, adds 0.2% pectinose simultaneously, cultivates OD
600to 0.5;
(II) ice bath 15min, centrifugal thalline, then utilizes 10% glycerine washing three times;
(III) adds 10% glycerine, is concentrated into 50 times, packing competence.
C electricity transforms, screening recon
(I) draws the homologous recombination segment of 1mg, adds in the competent cell of 100 μ l, mixes.Regulate electroporation apparatus, 2.5Kv, electric shock;
(II) adds the SOC substratum of 900 μ l, and 37 ℃, 150rpm, cultivates 1h;
(III) coating chlorampenicol resistant is dull and stereotyped, transfers recon utilization
ptsG?test?F:5'-CCTGTACACGGCGAGGCTCT-3'
ptsG?test?R:5'-AATAACACCTGTAAAAAAGGCAGCC-3'
Carry out PCR detection, by the further confirmation of PCR product order-checking ptsG gene, by chloramphenicol resistance gene, replaced.
The restructuring of (IV) FRT site-specific
PCP20 is proceeded to chlorampenicol resistant clone, cultivates 8h for 30 ℃, after be increased to 42 ℃ of 12h that spend the night, thermal induction FLP recombinase is expressed, plasmid is also lost gradually.Utilize transfering loop to dip bacterium liquid and rule on non-resistant substratum, the mono-clonal growing is proceeded on the dull and stereotyped and chlorampenicol resistant flat board of non-resistant simultaneously and cultivated, on non-resistant flat board, grow and being deleted by FLP recombinase of not growing on chlorampenicol resistant flat board.Utilize detection primer ptsG test F and ptsG test R further to identify.
(V) obtains engineering strain W3110 (Δ pflB Δ ptsG).
(3) ldhA gene knocks out
Bacterial strain: W3110 (Δ pflB Δ ptsG)
The LB substratum using is: 1% peptone, 1%NaCl, 0.5% yeast powder.
The ammonia benzyl mycin resistant panel of using is the LB solid medium that contains 100mg/l ammonia benzyl mycin and 1.5% agar powder.
The dull and stereotyped LB solid medium for containing 50mg/l kantlex and 1.5% agar powder of kalamycin resistance using.
A. the clone of homologous recombination fragment
Utilize Red homologous recombination system to knock out goal gene.The ldhA gene order of announcing according to Genbank is designing primer apart from the about 250bp of its upstream and downstream place:
ldhA-F：5’-CAGCGTCAACGGCACAAGAAT-3’
ldhA-R：5’-GCTGATTTCTGGCGGATTTTT-3’
The MG1655 (Δ ldhA::kan) of take is template, by PCR (polymerase chain reaction) amplification, obtains the recombinant fragment with kalamycin resistance.PCR reaction system is as follows:
10 * damping fluid, 5 μ l; 10mmol/L dNTP mixed solution 4 μ l; The ldhA-F primer 1 μ l of 20 μ mol/l; The ldhA-R primer 1 μ l of 20 μ mol/l; Taq archaeal dna polymerase 0.5 μ l; Template DNA 1 μ l, adds water and mends to 50 μ l;
PCR reaction conditions: 95 ℃ of denaturation 5min, 94 ℃ of sex change 30s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 rear 72 ℃ of whole extension 10min of circulation, 4 ℃ of preservations.Reclaim the concentrated homologous recombination segment of purifying standby.
B. the preparation of Electroporation-competent cells
1) picking, with the intestinal bacteria W3110 (Δ pflB Δ ptsG) of pKD46 plasmid, is inoculated in LB substratum, adds 1ml10% pectinose simultaneously, cultivates OD
600to 0.6;
2) ice bath 10min, collects and to utilize 10% glycerine washing after thalline three～five times;
3) with the resuspended Electroporation-competent cells that obtains of 10% glycerine of 100 μ l, be placed in standby on ice.
C. electricity transforms, screening recon
1) get the recombinant fragment that 1mg purifying is good, join in 100 μ l Electroporation-competent cells, mix also ice and put after 2min, 2.5Kv electric shock.
2) add rapidly 900 μ l LB substratum, 37 ℃, 150rpm replys and cultivates 1h.
3) thalline is coated on kalamycin resistance flat board, chosen after recon line, utilize and detect primer
ldhA?test?F:5’-TGCAATACGTGTCCCGAG-3’
ldhA?test?R:5’-CAGTTTGCCTTCACCGCT-3’
Carry out PCR detection.
D. the removal of resistance screening mark
Plasmid pCP20 is proceeded to recon, and 30 ℃ of 220rpm cultivate 6h, are then transferred to 42 ℃ of 220rpm overnight incubation 12h.With transfering loop, dip bacterium liquid at the flat lining out of non-resistant, the mono-clonal growing is transferred on non-resistant flat board and kalamycin resistance flat board, can on non-resistant flat board, grow and can not on kalamycin resistance flat board, grow be the recon that resistance has been removed, then utilize the further PCR of ldhA test F and ldhA test R to detect and determine whether to remove successfully.
E. remove the successful recombinant escherichia coli strain called after of resistance and produce succsinic acid recombination bacillus coli W3110GAB (genotype W3110 Δ pflB Δ ptsG Δ ldhA).
Embodiment 4, utilize engineering bacteria W3110GAB-hemA-sucCD anaerobically fermenting to produce ALA
Step (1) be take ordinary method by constructed recombinant vectors pTrc99a-hemA-sucCD and transform to be produced succsinic acid recombination bacillus coli W3110GAB (genotype is W3110 Δ pflB Δ ptsG Δ ldhA), obtain the recombination bacillus coli of energy while overexpression hemA and sucCD, called after intestinal bacteria W3110GAB-hemA-sucCD.
Step (2) dips after bacterium liquid from the glycerine pipe of the W3110GAB-hemA-sucCD of preservation with transfering loop, at the flat lining out of LB that contains 100 μ g/ml penbritins and kantlex, and the LB flat board of line is placed in to 37 ℃ of incubated overnight 12h.
Step (3) is inoculated in the mono-clonal on LB flat board in the 300ml shaking flask containing 50ml LB substratum, and to be placed on rotating speed be 250rpm, and temperature is that in the shaking table of 37 ℃, incubated overnight 12h, obtains seed culture fluid.
Step (4) is got 2ml seed liquor and is inoculated in containing 100ml AM1-yeast powder inorganic salt and sends out in the 300ml shaking flask of fermention medium, and to be placed on rotating speed be 250rpm, and temperature is to ferment in the shaking table of 37 ℃, and induces with IPTG.K
2cO
3adjust pH6.5.The initial 2g/l glycine that adds of fermentation.Initial glucose concentration is 20g/l.
Step (5) proceeds to the fermented liquid of cultivating after 12h in the anaerobism bottle containing 130ml AM1-yeast powder inorganic salt fermention medium, and 37 ℃, 210rpm, anaerobically fermenting.Respectively at 12h, 22h, 28h respectively adds 2g/l glycine, and 72h finishes fermentation.Every 6h gets a sample and detects ALA output.
Shown in fermentation results, this recombination bacillus coli is through 72h anaerobically fermenting, and ALA output reaches 240mg/l.
Embodiment 5, recombination bacillus coli engineering bacteria YL106-hemA-sucCD anaerobically fermenting are produced 5-ALA
Step (1) transforms constructed recombinant plasmid pTrc99a-hemA-sucCD to produce in succsinic acid recombination bacillus coli YL106 with ordinary method, obtains the recombination bacillus coli YL106-hemA-sucCD of while overexpression hemA and sucCD.Above-mentioned product succsinic acid recombination bacillus coli YL106 has been deposited in that " Chinese Typical Representative culture collection " center "; deposit number is CCTCC NO:M 2013149, its genotype is MG1655 Δ ptsG Δ poxB Δ pta Δ iclR Δ sdhA Δ arcA Δ ldhA Δ adhE pckA*glfZM on April 17th, 2013.
Step (2) dips after bacterium liquid from the glycerine pipe of the YL106-hemA-sucCD of preservation with transfering loop, at the flat lining out of LB that contains 100 μ g/ml penbritins, and the LB flat board of line is placed in to 37 ℃ of incubated overnight 12h.
Step (3) is inoculated in the mono-clonal on LB flat board in the 300ml shaking flask containing 50ml LB substratum, and to be placed on rotating speed be 250rpm, and temperature is that in the shaking table of 37 ℃, incubated overnight 12h, obtains seed culture fluid.
Step (4) is got 2ml seed liquor and is inoculated in containing 100ml AM1-yeast powder inorganic salt and sends out in the 300ml shaking flask of fermention medium, and to be placed on rotating speed be 250rpm, and temperature is to ferment in the shaking table of 37 ℃, and induces with IPTG.K
2cO
3adjust pH6.5.The initial 2g/l glycine that adds of fermentation.Initial glucose concentration is 20g/l.
Step (5) proceeds to the fermented liquid of cultivating after 12h in the anaerobism bottle containing 130ml AM1-yeast powder inorganic salt fermention medium, and 37 ℃, 210rpm, anaerobically fermenting.Respectively at 12h, 22h, 28h respectively adds 2g/l glycine, and 72h finishes fermentation.Every 6h gets a sample and detects 5-ALA output.
As shown in Figure 3, this recombination bacillus coli is through 72h anaerobically fermenting for fermentation results, and 5-ALA output reaches 1.65g/l, and 5-ALA/ inversion rate of glucose is 0.32g/g.
Claims (5)
1. a method of utilizing recombination bacillus coli anaerobically fermenting to produce 5-ALA, it is characterized in that: the fermentation condition that utilizes recombination bacillus coli anaerobism to produce 5-ALA is: with volume percent, count 2%～5% inoculum size recombination bacillus coli is inoculated in AM1-yeast powder minimal medium, first under aerobic condition, cultivate 8～15h growing mycelia, then turn anaerobically fermenting, fermentation time is 72 ± 10h; Wherein, it is 37 ± 1 ℃ that temperature is all controlled, and it is 6.5 ± 0.5 that pH all controls, and described AM1-yeast powder minimal medium formula is: (NH
4)
2hPO
4, 2.6306g/l; NH
4h
2pO
4, 0.8709g/l; KCl, 0.1491g/l; 3-morpholine propanesulfonic acid, 20.9270g/l; Yeast powder, 2g/l; Use Na
2cO
3adjust pH to 7.0, surplus is water; During use, add 0.15mM MgSO
47H
2o and volume ratio are 1 ‰ trace element solution; Wherein trace element 1000 * mother liquor formula is: FeCl
36H
2o, 2.4003g/l; CoCl
26H
2o, 0.2998g/l; ZnCl
2, 0.2999g/l; Na
2moO
42H
2o, 0.3000g/l; H
3bO
4, 0.0748g/l, MnCl
24H
2o, 0.4948g/l; CuCl
22H
2o, 0.1500g/l; With 120mM HCl, dissolve; Wherein, described recombination bacillus coli is any bacterial strain that can express 5-aminolevulinate synthetase and succinic thiokinase and under anaerobic produce succsinic acid.
2. utilize according to claim 1 recombination bacillus coli anaerobically fermenting to produce the method for 5-ALA, it is characterized in that: described recombination bacillus coli is cultivated 12h under aerobic condition, rotating speed is 250 ± 10rpm.
3. according to utilizing recombination bacillus coli anaerobically fermenting to produce the method for 5-ALA described in claim 1 or 2, it is characterized in that: described recombination bacillus coli makes by the following method: build the expression vector pTrc99a-hemA containing hemA gene, build again on this basis the expression vector pTrc99a-hemA-sucCD containing sucCD gene, by in constructed recombinant vectors pTrc99a-hemA-sucCD cotransformation recombination bacillus coli, obtain the recombination bacillus coli of energy while overexpression hemA and sucCD; Wherein, described hemA is the hemA gene that derives from the red bacillus of class ball, and described sucCD gene source is in intestinal bacteria.
4. utilize according to claim 3 recombination bacillus coli anaerobically fermenting to produce the method for 5-ALA, it is characterized in that: described recombination bacillus coli is intestinal bacteria YL106-hemA-sucCD, intestinal bacteria W3110-hemA-sucCD, or intestinal bacteria W3110GAB-hemA-sucCD.
5. utilize according to claim 4 recombination bacillus coli anaerobically fermenting to produce the method for 5-ALA, it is characterized in that: described recombination bacillus coli is intestinal bacteria YL106-hemA-sucCD, its genotype is MG1655 Δ ptsG Δ poxB Δ pta Δ iclR Δ sdhA Δ arcA Δ ldhA Δ adhE pckA*glf
zM/ pTrc99a-hemA-sucCD, make by the following method: build the expression vector pTrc99a-hemA containing hemA gene, build again on this basis the expression vector pTrc99a-hemA-sucCD containing sucCD gene, by in constructed recombinant vectors pTrc99a-hemA-sucCD cotransformation recombination bacillus coli YL106, the recombination bacillus coli that obtains energy while overexpression hemA and sucCD, is intestinal bacteria YL106-hemA-sucCD; Wherein, described hemA is the hemA gene that derives from the red bacillus of class ball, and described sucCD gene source is in intestinal bacteria; Described recombination bacillus coli YL106 has been deposited in that " Chinese Typical Representative culture collection " center "; deposit number is CCTCC NO:M 2013149, its genotype is MG1655 Δ ptsG Δ poxB Δ pta Δ iclR Δ sdhA Δ arcA Δ ldhA Δ adhE pckA*glfZM on April 17th, 2013.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410448698.3A CN104195190B (en) | 2014-09-04 | 2014-09-04 | Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410448698.3A CN104195190B (en) | 2014-09-04 | 2014-09-04 | Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195190A true CN104195190A (en) | 2014-12-10 |
| CN104195190B CN104195190B (en) | 2017-04-26 |
Family
ID=52080556
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410448698.3A Active CN104195190B (en) | 2014-09-04 | 2014-09-04 | Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195190B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106967627A (en) * | 2017-04-11 | 2017-07-21 | 济南大学 | A kind of fermenting and producing ALA recombinant bacterial strain and preparation method thereof |
| CN108841852A (en) * | 2018-05-31 | 2018-11-20 | 河南邑鸿善成生物技术有限公司 | A kind of high yield 5-ALA produces construction method and the application of bacterial strain |
| CN113862314A (en) * | 2021-08-31 | 2021-12-31 | 新泰市佳禾生物科技有限公司 | Method for producing 5-aminolevulinic acid by fermentation |
| CN114381416A (en) * | 2022-03-23 | 2022-04-22 | 北京道合成企业管理有限公司 | Recombinant escherichia coli strain for high yield of 5-aminolevulinic acid and application thereof |
| CN114410564A (en) * | 2022-04-02 | 2022-04-29 | 中国农业大学 | Strain for producing 5-aminolevulinic acid and production method |
| CN115044602A (en) * | 2022-05-23 | 2022-09-13 | 天津大学 | Strain for anaerobic synthesis of corynebacterium 5-aminolevulinic acid glutamate and construction method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003125763A (en) * | 2001-10-26 | 2003-05-07 | Mitsui Chemicals Inc | Method for filling enzyme catalyst |
| CN102747114A (en) * | 2012-01-17 | 2012-10-24 | 浙江大学 | Method for regulating recombinant escherichia coli metabolism by using transient anaerobic fermentation |
| CN103243064A (en) * | 2013-05-28 | 2013-08-14 | 山东大学 | Escherichia coli engineered strain and application in succinic acid production through aerobic-microaerobic-anaerobic full-stage fermentation of Escherichia coli engineered strain |
-
2014
- 2014-09-04 CN CN201410448698.3A patent/CN104195190B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003125763A (en) * | 2001-10-26 | 2003-05-07 | Mitsui Chemicals Inc | Method for filling enzyme catalyst |
| CN102747114A (en) * | 2012-01-17 | 2012-10-24 | 浙江大学 | Method for regulating recombinant escherichia coli metabolism by using transient anaerobic fermentation |
| CN103243064A (en) * | 2013-05-28 | 2013-08-14 | 山东大学 | Escherichia coli engineered strain and application in succinic acid production through aerobic-microaerobic-anaerobic full-stage fermentation of Escherichia coli engineered strain |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106967627A (en) * | 2017-04-11 | 2017-07-21 | 济南大学 | A kind of fermenting and producing ALA recombinant bacterial strain and preparation method thereof |
| CN108841852A (en) * | 2018-05-31 | 2018-11-20 | 河南邑鸿善成生物技术有限公司 | A kind of high yield 5-ALA produces construction method and the application of bacterial strain |
| CN113862314A (en) * | 2021-08-31 | 2021-12-31 | 新泰市佳禾生物科技有限公司 | Method for producing 5-aminolevulinic acid by fermentation |
| CN113862314B (en) * | 2021-08-31 | 2024-03-29 | 新泰市佳禾生物科技有限公司 | Method for producing 5-aminolevulinic acid through fermentation |
| CN114381416A (en) * | 2022-03-23 | 2022-04-22 | 北京道合成企业管理有限公司 | Recombinant escherichia coli strain for high yield of 5-aminolevulinic acid and application thereof |
| CN114381416B (en) * | 2022-03-23 | 2022-06-28 | 北京道合成企业管理有限公司 | Recombinant escherichia coli strain for high yield of 5-aminolevulinic acid and application thereof |
| CN114410564A (en) * | 2022-04-02 | 2022-04-29 | 中国农业大学 | Strain for producing 5-aminolevulinic acid and production method |
| CN114410564B (en) * | 2022-04-02 | 2022-07-19 | 中国农业大学 | Strain for producing 5-aminolevulinic acid and production method |
| CN115044602A (en) * | 2022-05-23 | 2022-09-13 | 天津大学 | Strain for anaerobic synthesis of corynebacterium 5-aminolevulinic acid glutamate and construction method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195190B (en) | 2017-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104195190A (en) | Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli | |
| CN102329765B (en) | XZ-A26 bacterial strain for producing L-alanine with high yield as well as construction method and application of XZ-A26 bacterial strain | |
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| CN104946576B (en) | Recombinant organism and its construction method and the application in pyruvic acid is produced | |
| CN103555779A (en) | Method for producing gamma-aminobutyric acid through fermentation | |
| CN104928226A (en) | Recombined corynebacterium glutamicum and application of corynebacterium glutamicum to 5-aminolevulinic acid production | |
| CN105441497A (en) | Method for coupled production of cadaverine by using microbial fermentation and microbial conversion | |
| CN106434510A (en) | Genetically engineered bacterium for producing L-aspartic acid through fermentation | |
| CN104830748B (en) | A kind of reduction hemB gene expressions improve the method that Escherichia coli synthesize 5 amino-laevulic acids | |
| CN110229774B (en) | Arginine decarboxylase gene engineering bacterium and high-density fermentation culture method thereof | |
| CN108456652A (en) | A kind of Sphingol single-cell genetic engineering bacterium and its construction method and application | |
| CN104131048A (en) | Biological preparation method of R-3-aminobutanol | |
| CN106167772B (en) | The Recombinant organism and its construction method of a kind of high yield pyruvic acid and application | |
| CN100392075C (en) | Glutamine synthetase and its dedicated expression engineered bacteria and uses | |
| CN107201374A (en) | The construction method of the butanediol high-yielding engineering bacterial strains of optical voidness meso 2,3 and application | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN111057672B (en) | Recombinant strain and application thereof | |
| CN104152483A (en) | Application of argJ gene in fermentation production of L-citrulline | |
| WO2022088263A1 (en) | Recombinant escherichia coli for efficient production of succinic acid and construction method for recombinant escherichia coli | |
| CN104109651A (en) | Recombinant Escherichia coli for synthesizing S-1,2-propanediol from L-lactic acid and construction method thereof | |
| CN104561072A (en) | Method for fermentation production of L-proline by utilizing recombinant Escherichia coli | |
| CN108929883A (en) | II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme | |
| CN101348775B (en) | Enterobacteria recombinant strain and use thereof | |
| CN103937733B (en) | Genetic engineering strain utilize sucrose to produce succinic acid from and method for production of succinic acid by fermenting the same | |
| WO2012119546A2 (en) | Method for preparing recombinant escherichia coli to produce succinic acid through fermentation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |