WO2012119546A2

WO2012119546A2 - Method for preparing recombinant escherichia coli to produce succinic acid through fermentation

Info

Publication number: WO2012119546A2
Application number: PCT/CN2012/072012
Authority: WO
Inventors: 姜岷; 马江锋; 陈可泉; 郭亭; 韦萍; 欧阳平凯
Original assignee: 南京工业大学
Priority date: 2011-03-09
Filing date: 2012-03-06
Publication date: 2012-09-13
Also published as: WO2012119546A3; CN102174458A

Abstract

The invention relates to a method for preparing recombinant Escherichia coli to produce succinic acid through fermentation, belonging to the technical field of bioengineering. The invention is mainly for increasing the growth rate of the strain under the anaerobic condition and the synthesis rate of succinic acid by overexpressing NAD+ biosynthesis-related genes in Escherichia coli, and adding a certain concentration of nicotinic acid to the anaerobic culture medium as the precursor material of NAD+ biosynthesis,. By this method, the problem of low production rate of the succinic acid during specific anaerobic fermentation of the recombinant Escherichia coli can be solved, at the same time, a means is provided for anaerobic production of an enzyme preparation by using the Escherichia coli.

Description

Method for preparing recombinant succinic acid to produce succinic acid

Technical field

The invention belongs to the field of bioengineering technology, and relates to a method for preparing succinic acid by recombinant Escherichia coli, specifically relates to increasing the growth rate of the strain by increasing the intracellular NAD+ biosynthesis of the strain, thereby improving the production of succinic acid under anaerobic conditions. The method of ability specifically involves the overexpression of one or more genes related to NAD ⁺ biosynthesis in Escherichia coli by molecular biological means, and adding a certain concentration of the precursor substance, and finally realizing the strain Ding II under the specific anaerobic condition. Acid production capacity.

Background technique

Succinic acid is a bulk chemical widely used in the pharmaceutical, pesticide, dye, fragrance, paint, food and plastic industries. It is also used as an excellent C4 platform compound for the synthesis of 1,4-butanediol, tetrahydrofuran, γ. Organic chemicals such as butyrolactone and polybutylene succinate (PBS) biodegradable materials are considered by the US Department of Energy to be one of the 12 most valuable biorefining products in the future.

The use of microbial fermentation to convert renewable resources (glucose, xylose, etc.) to produce succinic acid. Due to the wide range of raw materials and low price, low pollution, environmental friendliness, and absorption of fixed C0 ₂ during fermentation, it can effectively alleviate the greenhouse effect. It has opened up a new way of utilizing greenhouse gas carbon dioxide, which has become a research hotspot in recent years. The production strain of succinic acid mainly includes naerobio spirillum

Actinobacillus Mannheimia

Succiniciproducens . Recombinant C. glutamicum and recombinant E. coli. The use of wild strains to produce succinic acid, although a higher product concentration is obtained, but the culture medium cost is higher, and by-products such as citric acid and acetic acid accumulate more, hindering the industrialization process.

Due to its clear genetic background, easy operation, easy regulation, simple medium requirements and rapid growth, Escherichia coli has been widely used in recent years to obtain excellent strains of succinic acid. As a facultative aerobic bacterium, Escherichia coli can grow under both aerobic and anaerobic conditions, but under aerobic conditions, the strain grows rapidly, and the final density of cells can be increased to a few hundred dry weights with appropriate strategies. And intracellular carbon metabolism takes the tricarboxylic acid cycle; under anaerobic conditions, E. coli grows slowly, and the final cell dry weight is low. The main reason may be that the cells undergo mixed acid fermentation under anaerobic conditions, and there are a large number of inhibitors. Another reason may be that the intracellular electron transport chain does not work under anaerobic conditions, and the coenzyme NAD+ and ATP supply are insufficient.

The fermentation mode for producing succinic acid by using Escherichia coli mainly includes specific anaerobic fermentation and two-stage fermentation. Foreign Vemuri et al. used E. coli AFP111 (PYC) two-stage fermentation, and its anaerobic stage can complete 1.1 gg" ¹ succinic acid yield and 1.3 gL^-h" ¹ succinic acid production intensity (Applied Environmental Microbiology. 2002, 68, 1715~ 1727). However, if the sugar consumed in the aerobic phase is taken into account and the time taken, the yield and production intensity will decrease. In the case of specific anaerobic fermentation, the final concentration and yield of succinic acid were low due to slow growth of the strain and low final cell density. Summary of the invention

The technical problem to be solved by the present invention is to provide a method for improving the growth ability of Escherichia coli under anaerobic conditions, thereby improving the production capacity of succinic acid in a specific anaerobic fermentation process.

In order to achieve the technical object of the present invention, the present invention uses the following technical solutions:

A method for preparing a recombinant Escherichia coli to produce succinic acid, which comprises the following steps:

(1) overexpressing /S, nadD, one or more of the three genes in a strain derived from Escherichia coli to obtain a recombinant Escherichia coli strain;

(2) adding nicotinic acid to the fermentation anaerobic medium;

(3) Producing succinic acid by the specific anaerobic fermentation of recombinant Escherichia coli obtained in the step (1).

The fermented anaerobic medium of the present invention is understood to be a conventional medium for fermenting succinic acid by any Escherichia coli in the prior art. Specifically, the concentration of nicotinic acid added in the step (2) is 0.1 mmol/L to 1 mmol/L.

The beneficial effects of the present invention are: Figure 1 is a gene related to the biosynthetic pathway of NAD ⁺ ; the present invention by overexpressing the NAD + biosynthesis-related gene, and on the other hand adding niacin as a NAD + organism in the fermented anaerobic medium The synthesized precursor material, which accelerates the growth rate of the strain, can greatly enhance the ability of the specific anaerobic fermentation to produce succinic acid.

DRAWINGS

Figure 1 Biosynthetic pathway of NAD ⁺ .

Figure 2 Effect of different concentrations of niacin on the biomass and succinic acid production after induction

Wherein, A is NZN111 with 0.5 mmol/L nicotinic acid, B is NZNl ll/pTrc99a with 0.5 mmol/L nicotinic acid, C to E is NZNl ll/pTrc99a-/S with 0.1 mmol/L, 0.3 mmol/L, 0.5 Methanol/L and 1 mmol/L niacin.

detailed description

The following examples are illustrative of the invention but are not intended to limit the invention.

The source of Escherichia coli K12 according to the present invention is: purchased from Beijing Institute of Biology, Chinese Academy of Sciences.

The source of pTrc99a for the expression plasmid of the present invention is: purchased from Introvegen.

The source of E.coli NZNl l l according to the present invention is:

(1) Biotechnol Bioeng, 2001, 74: 89-95. The applicant first consulted the source of the above-mentioned documents of the biological material, and contacted the publisher to the University of Chicago, and requested the gift of the biological material, and obtained the biological material free of charge; and the applicant promised from the date of this application Distribute the biological material to the public within 20 years;

(2) The biological material is also disclosed and authorized in the patent documents of the Chinese patent (Application No. 96198547.X, Application Date 1996.10.31, Authorization Date January 1, 2003, Authorization Bulletin No. CN1097632C). The fermentation medium of the present invention is: LB+glucose (20 g/L) + basic magnesium carbonate 0.48 g+Kan (kanamycin 30 g/mL) + Amp (ampicillin 50 g/mL) + Chl (Chloromycin 25 g/mL) + 0.3 mM IPTG. Example 1

This example demonstrates that after overexpression of pncB in E. coli NZN 111, induction by IPTG can effectively increase the concentration of intracellular NADH and NAD ⁺ .

Escherichia coli NZN111 (CGSC7726), when introduced into plasmid pTrc99a-/S, overexpressed niacin phosphoribosyltransferase, restored the ability of NZN111 to metabolize glucose under anaerobic conditions and had high yield of succinic acid accumulation.

The specific operation is:

1. Constructing an expression plasmid overexpressing niacin phosphoribosyltransferase, the process comprising:

(1) synthesizing primers with Nco I and Hind III restriction sites,

Upstream primer: 5'- CATGCCATGGATGACACAATTCGCTTCTCCTG-3'

Downstream primer: 5 ' -CCC AAGCTTCACTTGTCC ACCCGTAAATGG-3 '

( 2 ) PCR amplification of the target gene fragment using E. coli K12 series as template, the reaction conditions are: 94 °C, 5 min; (94 °C 45 s, 55 °C 45 s, 72 °C 1 min, 35 Cycle); 72 °C, 10 min. After purifying the amplified /S gene, the expression plasmid was digested with pTrc99a and digested with Nco I and Hind III, respectively, to obtain the recombinant plasmid pTrc99a-/S.

2. The plasmid pTrc99a-/S was introduced into the competent state of E.coW NZNll, and a recombinant Escherichia coli fermentation strain was obtained. In order to investigate the effect of overexpression of niacin phosphoribosyltransferase on intracellular coenzyme, the specific anaerobic fermentation mode was used to enter the flask from the cryotube by 1% (v/v) inoculum. When the OD culture of the cells was about OD ₆₀₀ to 0.3, niacin was added to a final concentration of 0.5 mmol/L, and anaerobic culture was carried out for 8 h at 30 ° C and 170 rpm.

The determination of intracellular NADH and NAD+ of E.coZ NZNl l and the constructed recombinant strain is shown in Table 1.

Table 1 Effect of overexpression of niacin phosphoribosyltransferase on intracellular coenzyme in E. coli NZN 11 1

NADH NAD+ NAD(H)

Strain

(mmol/g) (mmol/g) (mmol/g)

£.co// NZNl l l 0.264 2.912 3.176

E.coli NZN 11 l/pTrc99a-pwcfi 2.133 8.342 10.475 Example 2

This example illustrates the need to increase the biosynthesis of intracellular NAD+ in strains, in addition to the need to overexpress recombinant expression plasmids such as pncB, and also to add a certain concentration of niacin.

1. In order to investigate the effect of prodrug niacin on intracellular coenzyme after overexpression of niacin phosphoribosyltransferase, The anaerobic fermentation mode was introduced into the flask by a 1% (v/v) inoculum from the cryopreservation tube. When the anaerobic culture bacterium was OD ₆₀₀ to 0.3, IPTG was added to a final concentration of 0.3 mmol/L. The niacin is at a final concentration of 0.1 to 1.0 mmol/L, and anaerobic incubation is carried out at 30 ° C, 170 rpm for 24 h.

2. The determination of intracellular NADH and NAD+ of E.co/ NZNll and the constructed recombinant strain is shown in Figure 2.

Example 3

This example illustrates the effect on glucose consumption and product distribution after biosynthesis of intracellular NAD+ in E. coli.

1. To investigate the effect of overexpression of nicotinic acid phosphoribosyltransferase on intracellular coenzyme and metabolic distribution after NAD+ biosynthesis, using a specific anaerobic fermentation model, 1% (v/v) inoculum from cryopreservation When the tube is connected to the flask, when the anaerobic cultured cells are OD ₆ QQ to 0.3, IPTG is added to a final concentration of 0.3 mmol/L, and the final concentration of niacin is 0.5 mmol/L, 30 ° C, 170 Anaerobic incubation for 48 h at rpm.

2. E. CO/ NZN111 and constructed recombinant strain substrate consumption and product distribution are shown in Table 2.

Table 1 Effect of overexpression of niacin phosphoribosyltransferase on the distribution of E. coli NZN 11 1 product

Time fine monthly dry weight glucose consumption succinic acid pyruvic acid

Strain

(h) (g L) (g/L) (g/L) (g/L)

£.co// NZNl l l 48 1.1 1 0 0.3 12 0.412

E.coli NZN1 1 l/pTrc99a-pwcfi 48 7.03 14 7.056 7.243

Example 4

This example illustrates the method of introducing recombinant plasmids into other recombinant plasmids in addition to the introduction of the /S recombinant expression plasmid according to the method of Example 1, and other examples involving the addition of nicotinic acid and specific anaerobic fermentation are the same as those in Example 2.

1. Overexpression / π^ ) Gene:

Construction of an expression plasmid overexpressing niacin mononucleotide adenyltransferase, the process comprising:

(1) synthesizing primers with Nco I and Hind III restriction sites,

Upstream primer: 5'- CATGCCATGGGGCGGACGTATTTATCGACGGTTGA -3'

Downstream primer: 5 '- CCCAAGCTTCAGATTTTGCGCTTGCTCAATACCG -3 '

( 2 ) PCR amplification of the target gene fragment using E. coli K12 series as template, reaction conditions: 94 °C, 5 min; (94 °C 45 s, 60 °C 45 s, 72 °C 48 s, 35 cycles) ); 72 °C, 10 min. After purifying the amplified gene, the expression plasmid was digested with pTrc99a with Nco I and Hind III, respectively, and ligated to obtain the recombinant plasmid pTrc99a-/%^Z). The plasmid pTrc99a- was introduced into the competent state of E.coW NZN111 to obtain a recombinant Escherichia coli fermentation strain.

2. Overexpression / Gene:

Construction of an expression plasmid overexpressing NAD synthase, the process comprising: (1) synthesizing primers with Nco I and Hind III cleavage sites,

Upstream primer: 5'-CATGCCATGGCGCTTGTCGTTTCAGTAGCAACGGG-3 '

Downstream primer: 5'-CCCAAGCTTCGCCCCGGCGTGAACAAATTACTC-3 '

( 2 ) PCR amplification of the target gene fragment using E. coli K12 series as template, reaction conditions: 94 °C, 5 min; (94 °C 45 s, 64 °C 45 s, 72 °C 57s, 35 cycles) ); 72 °C, 10 min. After purification of the amplified dE gene, the expression plasmid was digested with pTrc99a with Nco I and Hind III, respectively, and ligated to obtain the recombinant plasmid pTrc99a-/%^E.

The plasmid pTrc99a-i E was introduced into the competent state of E. coli NZN111 to obtain a recombinant Escherichia coli fermentation strain.

3. Overexpression / S gene and gene:

Construction of an expression plasmid overexpressing co-expressed nicotinic acid phosphoribosyltransferase and niacin mononucleotide adenyltransferase, the process comprising:

(1) Primers with Hind III restriction sites at both ends of the synthesis,

Upstream primer: 5'- CCCAAGCTTGGCGGACGTATTTATCGACGGTTGA -3 '

Downstream primer: 5 '- CCCAAGCTTCAGATTTTGCGCTTGCTCAATACCG -3 '

(2) PCR amplification of the target gene fragment using E. coli K12 series as template. The reaction conditions were: 94 °C, 5 min; (94 °C 45 s, 60 °C 45 s, 72 °C 48 s, 35 cycles) ); 72 °C, 10 min. Expression plasmid after purification of the amplified gene

(obtained in Example 1) The recombinant plasmid pTrc99a-pncB-nadD was obtained by double digestion with Hind III.

The plasmid pTrc99a-/S- was introduced into the competent state of E.coW NZN111, and the obtained positive transformant was a newly constructed strain, and a recombinant Escherichia coli fermentation strain was obtained.

4. Overexpression/S gene and i E gene: Construction of an expression plasmid overexpressing co-expressed niacin phosphoribosyltransferase and NAD synthase, the process includes: (1) Hind III restriction sites are present at both ends of the synthesis Primer,

Upstream primer: 5 ' -CCC AAGCTTCGCTTGTCGTTTC AGTAGC AACGGG-3 '

Downstream primer: 5'-CCCAAGCTTCGCCCCGGCGTGAACAAATTACTC-3 '

(2) PCR amplification of the target gene fragment using E. coli K12 series as template. The reaction conditions were: 94 °C, 5 min; (94 °C 45 s, 64 °C 45 s, 72 °C 57s, 35 cycles) ); 72 °C, 10 min. Expression plasmid after purification of the amplified gene

(obtained in Example 1) The recombinant plasmid pTrc99a-pwcB- <iE was obtained by double digestion with Hind III. The plasmid pTrc99a-/S- was introduced into the competent state of E. coli NZN111 to obtain a recombinant Escherichia coli fermentation strain.

5. Overexpression of the gene and the iE gene: Construction of an expression plasmid overexpressing the co-expressed niacin mononucleotide adenylyltransferase and NAD synthase, the process comprising:

(1) Primers with Hind III restriction sites at both ends of the synthesis,

Upstream primer: 5 ' -CCC AAGCTTCGCTTGTCGTTTC AGTAGC AACGGG-3 '

Downstream primer: 5'-CCCAAGCTTCGCCCCGGCGTGAACAAATTACTC-3'

(2) PCR amplification of the target gene fragment using E. coli K12 series as template, reaction conditions: 94 °C, 5 min; (94 °C 45 s, 64 °C 45 s, 72 °C 57s, 35 cycles) ); 72 °C, 10min. After purifying the amplified gene, the expression plasmid pTrc99a- (obtained in item 1 of the present example) was digested with Hind III and ligated to obtain a recombinant plasmid TpTrc99a-adD-adE.

The plasmid pTrc99a- -iE was introduced into the competent state of E.coWNZNlll to obtain a recombinant Escherichia coli fermentation strain.

7. Overexpression/S gene, gene and iE gene: Construction of an expression plasmid overexpressing co-expressed nicotinic acid phosphoribosyltransferase, nicotinic acid single nucleotide adenylyltransferase and NAD synthetase, the process comprising:

(1) Primers with Hind III restriction sites at both ends of the synthesis,

Upstream primer: 5 ' -CCC AAGCTTCGCTTGTCGTTTC AGTAGC AACGGG-3 '

Downstream primer: 5'-CCCAAGCTTCGCCCCGGCGTGAACAAATTACTC-3'

(2) PCR amplification of the target gene fragment using E. coli K12 series as template, reaction conditions: 94 °C, 5 min; (94 °C 45 s, 64 °C 45 s, 72 °C 57s, 35 cycles) ); 72 °C, 10min. After purification of the amplified gene, the expression plasmid pTrc99a-/S- (obtained in item 3 of the present example) was digested with Hind U1 and ligated to obtain recombinant plasmid p rc99a-pncB-nadD-nadE.

The plasmid pTrc99a-/S--iE was introduced into the competent state of E. coli NZN111 to obtain recombinant Escherichia coli fermenting bacteria.

Claims

Rights request

A method for preparing a recombinant Escherichia coli to produce succinic acid, which comprises the steps of:

(1) overexpressing /S, nadD, one or more of the three genes in a strain producing succinic acid-producing Escherichia coli to obtain a recombinant Escherichia coli strain;

(2) adding nicotinic acid to the fermentation anaerobic medium;

The method according to claim 1, characterized in that the concentration of nicotinic acid added in the step (2) is 0.1 mmol/L to 1 mmol/L.