CN112646760B

CN112646760B - Engineering bacterium for producing inositol and construction method and application thereof

Info

Publication number: CN112646760B
Application number: CN201910957229.7A
Authority: CN
Inventors: 袁其朋; 孙新晓; 唐二菊
Original assignee: Beijing University of Chemical Technology
Current assignee: Beijing University of Chemical Technology
Priority date: 2019-10-10
Filing date: 2019-10-10
Publication date: 2023-02-14
Anticipated expiration: 2039-10-10
Also published as: CN112646760A

Abstract

The invention provides an engineering bacterium for producing inositol, which comprises a host bacterium and a plasmid vector transferred into the host bacterium, wherein a gene for coding inositol-1-phosphate synthase is introduced into the plasmid vector, or a gene for coding the inositol-1-phosphate synthase and a gene for over-expressing coding phytase are introduced into the plasmid vector. The invention also provides a construction method and application of the engineering bacteria for producing inositol. The engineering bacteria overexpress endogenous enzymes while utilizing the exogenous enzymes, and combine RED recombination to perform gene regulation and control, so that the yield of inositol and the yield of carbon sources are gradually improved, and the rapid growth of a host and the efficient production of the inositol are realized by taking simple carbon sources such as sucrose, glucose, glycerol and the like as sources and coordinating the production and the growth mutually.

Description

Engineering bacterium for producing inositol and construction method and application thereof

Technical Field

The invention relates to the technical field of biological engineering, in particular to an engineering bacterium for producing inositol and a construction method and application thereof.

Background

Inositol (inositol), also known as inositol, etc., is mainly present in animals and plants, is a growth factor of animals and microorganisms, and is also one of water-soluble vitamin B groups. The inositol has wide application, and is mainly applied to the industries of feed, food, medicine, cosmetics and the like. In the feed industry, inositol as a feed additive has great demand in the aspects of animal husbandry, aquaculture industry, poultry raising industry and the like, the addition amount of the inositol is generally 0.2-0.5 percent of the feed, and especially the consumption amount of the inositol of only animals in Japan is more than 100t every year; experiments show that higher animals lack inositol to cause symptoms such as alopecia and growth retardation, and the addition of inositol can prevent alopecia and promote growth. In the food industry, inositol is used as a nutrition enhancer in the food industry and fermentation, and is used for promoting the growth of saccharomyces cerevisiae, the culture of various strains and the like; in recent years, inositol is added into infant food and nutritional food in countries such as europe, the united states, japan, and the like to endow the food with certain nutritional and health-care functions, particularly in vitamin functional beverages containing inositol as a main component; because inositol can act with carnitine to achieve the effect of reducing blood fat, the health food for reducing weight and blood fat, which takes inositol as the main component, is widely popularized in the international market. In the pharmaceutical industry, inositol is a water-soluble vitamin, and can treat various vitamin deficiencies; inositol can be used for treating diabetes, depression, liver cirrhosis, obesity, etc.; inositol and its derivatives have anticancer, and melancholia treating effects. In the cosmetic industry, inositol is utilized to have the effects of promoting cell growth, preventing aging and resisting oxidation, the inositol is added into the cosmetics to inhibit the generation of melanin, prevent freckles and delay aging, and various high-grade cosmetics developed by taking the inositol as a main component have become the leading force of the international cosmetic market.

In recent years, the demand of inositol has been increasing every year due to its wide use, and the world has seen a situation of short supply and short demand as the largest inositol-supplying and producing countries in China.

The traditional production method of inositol is a pressure hydrolysis method, and the production method has high production cost and strict requirements on equipment; the operating pressure can only be controlled within a certain range, so that the improvement of the utilization rate of raw materials is limited; the refining process of the crude product is complex, and the recovery rate loss is high; the generated phosphorus can not be recycled, and the pollution to water sources is serious, and the like. In order to reduce energy consumption, a normal pressure hydrolysis method is developed, and the reaction is carried out under normal pressure, so that strict requirements on equipment are avoided, but more problems exist. At present, the production method of inositol is mainly a chemical synthesis method, but the chemical synthesis process is complex, the cost is high, the pollution is serious, the inositol cannot compete with natural inositol, and an industrial test cannot be carried out all the time. In recent years, the enzymolysis method becomes a research hotspot, is novel and efficient, has normal temperature and normal pressure, has no pollution, but has difficult enzyme purification, high preparation or purchase cost and lower yield. Hydrolysis, chemical synthesis and enzymatic hydrolysis all have the problems of high cost, high pollution, low yield and the like in different degrees. Therefore, although inositol has been widely used, it has not been widely used due to its high cost and supply problems, and therefore, it is urgent to develop a novel method for producing inositol at a low cost, without pollution, and in a high yield.

Disclosure of Invention

In view of the above, the present invention provides an engineering bacterium for producing inositol, and a construction method and applications thereof, so as to solve the above problems.

To this end, the present invention provides an engineered bacterium for producing inositol comprising a host bacterium and a plasmid vector transformed into said host bacterium, wherein the plasmid vector has introduced therein a gene encoding inositol-1-phosphate synthase (ino 1), or has introduced therein both a gene encoding inositol-1-phosphate synthase (ino 1) and a gene encoding inositol monophosphatase (suhB) overexpressed.

Wherein the host bacterium is a bacterium, a yeast or a fungus, wherein the bacterium or the fungus is original or modified. Preferably, the host bacterium is escherichia coli, bacillus subtilis, corynebacterium glutamicum, saccharomyces cerevisiae or aspergillus niger.

Based on the above, the host bacterium is deleted at least one of zwf encoding glucose-6-phosphate dehydrogenase gene and pgi encoding glucose phosphate isomerase gene, galU encoding glucose-1-phosphate uridyltransferase gene, glgC encoding glucose-1-phosphate adenylyltransferase gene, gldA encoding glycerol dehydrogenase gene, pykA encoding pyruvate kinase gene and pykF.

Based on the above, galU encoding glucose-1-phosphate uridyltransferase gene and glgC encoding glucose-1-phosphate adenylyltransferase gene were also deleted from the host strain.

Based on the above, the host bacterium also knocks out gldA encoding glycerol dehydrogenase gene, genes pykA and pykF encoding pyruvate kinase.

Based on the above, the gene glpK coding for glycerol kinase was also knocked out including in the host bacterium.

Based on the above, the plasmid vector also has an overexpression of glpK, a gene encoding glycerol kinase, introduced therein.

The invention also provides a construction method of the engineering bacteria for producing the inositol, which comprises the following steps:

the recombinant expression plasmid is used for connecting a gene coding the inositol-1-phosphate synthetase (ino 1) to an expression plasmid for recombination, or connecting genes coding the inositol-1-phosphate synthetase (ino 1) and inositol monophosphatase (suhB) to the expression plasmid for recombination to obtain a plasmid vector;

and (3) constructing engineering bacteria, and transforming the plasmid vector into the host bacteria to obtain the engineering bacteria for producing the inositol.

Wherein, the expression plasmid may be pCS27. The host bacterium is used for knocking out zwf of a gene coding glucose-6-phosphate dehydrogenase and pgi of a gene coding glucose phosphate isomerase by a Red homologous recombination method, and knocking out at least one gene of galU of a gene coding glucose-1-phosphate uridyltransferase, glgC of a gene coding glucose-1-phosphate adenylyltransferase, gldA of a gene coding glycerol dehydrogenase and genes pykA and pykF of a gene coding pyruvate kinase. The step of recombining the expression plasmid further comprises the step of simultaneously connecting the gene glpK for overexpressing and coding the glycerol kinase to the expression plasmid for recombining to obtain the plasmid vector; meanwhile, the host bacterium knocks out a gene glpK encoding glycerol kinase by a Red homologous recombination method.

Based on the above, in the step of the recombinant expression plasmid, at least one of the gene encoding inositol-1-phosphate synthase (ino 1), the gene encoding inositol monophosphatase (suhB), and the gene glpK of glycerol kinase is subjected to PCR amplification treatment using a constitutive promoter having a gene sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, or SEQ ID No. 5.

The invention also provides an application of the engineering bacteria for producing the inositol, wherein the engineering bacteria for producing the inositol is inoculated into a culture medium according to the inoculation amount of 1-5% of the volume ratio, and the inositol is prepared by fermentation treatment under the conditions of 20-37 ℃ and pH of 5-8; the carbon source in the culture medium is sucrose, glucose, or a combination of at least two selected from the group consisting of glycerol, sucrose and glucose.

Based on the above, the culture medium comprises: 10-40 g of 8729and L825454 ¹ 1-5 g of the carbon source 8729and L8254 ¹ Yeast powder 5-8 g of 8729and L of 825454 ¹ NaHPO ₄ ，0.3～2 g∙L‾ ¹ NaCl，2～5 g∙L‾ ¹ KH ₂ PO ₄ ，1～5 g∙L‾ ¹ NH ₄ Cl，240～250 mg∙L‾ ¹ MgSO ₄ ，14～15.5 mg∙L‾ ¹ CaCl ₂ . Preferably, the carbon source is a combination of glucose and glycerol, such as a ratio of glucose to glycerol of (1-3): 1, more preferably a ratio of glucose to glycerol of 2.

As shown in figure 1, in the above engineering bacteria for producing inositol provided by the present invention, sucrose or Glucose is metabolized and converted into Glucose-6-phosphate (Glucose-6-phosphate), and the Glucose-6-phosphate is catalyzed by inositol-1-phosphate synthetase (ino 1) and inositol monophosphatase (suhB) to synthesize inositol, thereby realizing efficient biosynthesis of inositol from simple carbon sources such as sucrose, glucose and glycerol.

The engineering bacteria for producing inositol, provided by the invention, introduces a gene regulation strategy, utilizes Red homologous recombination for knockout, knocks out zwf of a gene coding glucose-6-phosphate dehydrogenase in a pentose phosphate pathway and pgi of a gene coding glucose phosphate isomerase in a glycolysis pathway, selectively knocks out galU of a gene coding glucose-1-phosphate uridyltransferase capable of catalyzing glucose-6-phosphate and glgC of a gene coding glucose-1-phosphate adenylyltransferase, and increases the supply of precursor glucose-6-phosphate; the method has the advantages that the pykA of the gene coding pyruvate kinase II and the pykF of the gene coding pyruvate kinase I are knocked out, the consumption of phosphoenolpyruvate PEP is reduced, the gldA of the gene coding glycerol dehydrogenase is knocked out, the generation of the phosphoenolpyruvate PEP is increased, the transport efficiency of glucose is improved, and the generation of inositol is increased.

Furthermore, the engineering bacteria for producing inositol provided by the invention also knock out the gene glpK of the coding glycerol kinase gene in the host bacteria, and introduce the gene glpK of the overexpression coding glycerol kinase gene into a plasmid vector, so that the growth and the production are thoroughly coupled, and the strain cannot grow if the plasmid is lost, therefore, the engineering bacteria are beneficial to monitoring the inositol synthesis end point in industrial production; meanwhile, the overexpression of the gene glpK of the coding glycerol kinase gene can accelerate the utilization of glycerol and realize the rapid growth of a host.

Furthermore, the constitutive promoter is introduced into the engineering bacteria for producing the inositol, the constitutive promoter can be directly expressed without adding an inducer, the strength is stronger than that of a lac promoter, the transformation efficiency is higher, the lac promoter needs to be added with the inducer, the inducer is toxic, and the growth of a strain can be delayed; therefore, the invention introduces a constitutive promoter to replace the original lac promoter, and is beneficial to the high-efficiency biosynthesis of inositol.

Therefore, the engineering bacteria for producing the inositol provided by the invention can realize the rapid growth of a host and the high-efficiency production of the inositol by taking simple carbon sources such as sucrose, glucose, glycerol and the like as sources and coordinating the production and the growth.

Drawings

FIG. 1 is a scheme for the biosynthesis of myo-inositol provided by the present invention.

FIG. 2 is a graph showing the results of fermentation of engineered bacteria TEJ-11 and TEJ-12 to produce inositol, according to example 1 of the present invention.

FIG. 3 is a graph showing the results of fermentation of the engineered bacterium TEJ-21 of the present invention to produce inositol.

FIG. 4 is a bar graph of the yield of myo-inositol produced by the engineered bacteria TEJ-21 provided in example 2 of the present invention and TEJ-22, TEJ-23, TEJ-24, TEJ-25 and TEJ-26 provided in example 3 of the present invention after 96h of fermentation.

FIG. 5 is a graph showing the results of fermentation of the engineered bacterium TEJ-31 provided in example 4 of the present invention to produce inositol.

In the sequence listing:

SEQ ID NO1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, and SEQ ID NO 5 each represent a DNA sequence of a constitutive promoter.

Detailed Description

The technical solution of the present invention is further described in detail by the following embodiments.

The engineering bacteria for producing the inositol provided by the invention introduce a way for efficiently producing the inositol into an original strain or a modified strain, select the inositol-1-phosphate synthase ino1 derived from bacteria, fungi or animal and plant cells, efficiently express the inositol-1-phosphate synthase ino1 in a host, over-express endogenous inositol monophosphate enzyme suhB, and realize the de novo synthesis of the inositol by utilizing simple carbon sources such as sucrose, glucose, glycerol and the like.

In the present invention, there is no special requirement for the type of expression plasmid, and it is considered that the construction method for expressing the target gene in escherichia coli can adopt various methods commonly used in the art, for example, the target gene is connected to a vector after enzyme digestion treatment, and details are not repeated.

In the examples below, the E.coli strains JCL16, SXL197, trans5 α (from TransGen), trans10 and BL21 (DE 3) are all commonly available E.coli strains, with trans5 α or trans10 for vector construction, BL21 (DE 3) for protein expression and BW25113 (from CGSC) as the fermentation strain. The plasmids and hosts used in the examples are shown in Table 1 below.

Example 1

De novo synthesis of inositol from simple carbon sources such as sucrose, glucose and glycerol

Inositol is obtained by two-step catalysis of inositol-1-phosphate synthase (INO 1) and inositol monophosphatase (suhB) from bacterial, fungal or protein engineering through NCBI (https:// blast. NCBI. Nlm. Nih. Gov) sequence alignment analysis and comparison according to enzyme activities reported in the literature. Firstly, obtaining gene fragments of inositol-1-phosphate synthase (INO 1) and inositol monophosphatase (suhB) by using a PCR amplification technology, carrying out gel recovery on target genes after gel electrophoresis, carrying out enzyme digestion on the target genes and a plasmid vector simultaneously by using double enzyme digestion, connecting the vector and the fragments at 22 ℃ for 1h after the gel recovery, transferring the gel into escherichia coli Trans5 alpha or Trans10, recovering for 45min-1h at 30-37 ℃, coating, carrying out overnight culture, after the strains grow up, selecting 3 parallel strains, adding the strains into an LB test tube with 4mL of kanamycin resistance for culture, preserving the strains after the strains grow up, extracting plasmids, and finally obtaining plasmids pCS-INO1 and pCS-INO1-suhB (Table 1).

And then respectively electrically transferring the successfully constructed plasmids pCS-INO1 and pCS-INO1-suhB into host bacteria for fermentation experiments, firstly preparing competent cells of escherichia coli BW25113 (the original escherichia coli is knocked out of araBADAH33, lacZWJ16, rhaBADLD78 and hsdR 514), washing twice with 10% glycerol, 6000-rotating and centrifuging the sediment, adding a proper amount of 10% glycerol heavy suspension cells according to the concentration of thalli, sucking 90 microliter of the competent cells into a 1.5 mL centrifuge tube, simultaneously adding 5 microliter of the successfully constructed plasmids, fully and uniformly mixing the plasmids, placing the plasmids on ice for 10 min, then adding a mixed bacterial liquid of the plasmids and the competent cells into a precooled electric shock cup, electrically transferring the plasmids into the competent cells by using an electric transfer instrument, sucking 600 microliter of LB culture medium into the electric shock cup and uniformly mixing the mixed bacterial liquid into the 1.5 mL centrifuge tube, and recovering the mixed bacterial liquid in the centrifuge tube at the temperature of 30-37 ℃ for 45-60 min. After recovery, centrifuging recovery bacterium liquid at 5000-8000 rpm for 2 min, sucking out part of supernatant according to the concentration of the recovery bacterium liquid, sucking and uniformly mixing the rest bacterium liquid, adding the mixture to a Carna-resistant plate, coating the plate with a coating rod prepared in advance, carrying out overnight inversion culture at 30-37 ℃, picking strains growing on the Carna-resistant plate into LB test tubes with Carna resistance, and successfully constructing engineering strains TEJ-11 (BW/pCS-INO 1) and TEJ-12 (BW/pCS-INO 1-suhB) capable of producing inositol from head (Table 1).

Three parallel single colonies were picked from the plates of the above engineering bacteria TEJ-11 and TEJ-12, respectively, and inoculated into 4mL of liquid LB with Carna resistance, cultured for 12 hours at 37 ℃ in a shaker, and then 1 m was inoculated in an amount of 2% by volumeInoculating the L bacterial liquid into 50 mL M9 culture medium with kanamycin resistance, adding 1 mM IPTG while inoculating, and inducing under the conditions of pH 6.5 and the rotating speed of about 300 rpm, wherein the M9 culture medium: 10 g 8729and L8254 ¹ Glucose, 5 g 8729, L8254 ¹ 5 g of glycerol 8729and L8254 ¹ Yeast powder 6g 8729and L8254 ¹ NaHPO ₄ ，0.5 g∙L‾ ¹ NaCl，3 g∙L‾ ¹ KH ₂ PO ₄ ，2 g∙L‾ ¹ NH ₄ Cl，246.5 mg∙L‾ ¹ MgSO ₄ ，14.7 mg∙L‾ ¹ CaCl ₂ And adding corresponding antibiotics according to actual conditions. Samples were taken every 24 h for 96h and inositol concentration was determined by differential detector high performance liquid chromatography. As shown in FIG. 2, strains TEJ-11 and TEJ-12 were found to produce inositol at 0.46 g/L and 0.6 g/L, respectively, at 96 h. Herein, the determination conditions of the inositol concentration are as follows: sugar column, flow rate 0.4mL/min, column temperature 70 ℃ mobile phase is ultrapure water.

Example 2

Method for improving inositol yield by using RED homologous recombination gene regulation strategy

As shown in FIG. 1, in the pathway of inositol production, glucose-6-phosphate is an efficient precursor for the synthesis of inositol, and inositol-1-phosphate synthase (INO 1) converts glucose-6-phosphate into inositol-1-phosphate, which is in turn converted into inositol by inositol monophosphatase (suhB). In order to increase the supply of precursor glucose-6-phosphate, zwf of the gene coding for glucose-6-phosphate dehydrogenase in the pentose phosphate pathway, pgi of the gene coding for glucose-phosphate isomerase in the glycolytic pathway, galU of the gene coding for glucose-1-phosphate uridyltransferase and glgC of the gene coding for glucose-1-phosphate adenylyltransferase are knocked out on the basis of host bacteria BW25113, and the genes pykA and pykF coding for pyruvate kinase and the gene gldA coding for glycerol dehydrogenase in the host genome are knocked out due to the fact that the intermediate phosphoenolpyruvate (PEP) is converted into pyruvate (pyr) in a large amount and enter the tricarboxylic acid cycle (TCA cycle), so that the PEP is effectively prevented from being converted into pyruvate (pyr) in a large amount, and a large amount of precursors are provided for the biosynthesis of inositol.

Specific gene regulation strategies may be as follows:

(1) Knocking out the zwf coding glucose-6-phosphate dehydrogenase gene in competent cells of E.coli BW25113 by RED homologous recombination technology, obtaining the pgi coding glucose phosphate isomerase gene in glycolysis pathway, obtaining the strain BW zwf pgi, respectively electrically transferring the successfully constructed plasmids pCS-ino1 and pCS-ino1-SuhB into the host bacteria BW zwf pgi for fermentation, obtaining the engineering strains TEJ-13 (BW zwf Δ/pCS-ino 1) and TEJ-14 (BW zwf pgi/pCS-ino 1-SuhB).

Three single colonies were picked from the plates of the engineered strains TEJ-13 and TEJ-14, and inoculated into 4mL of a kanamycin-resistant liquid LB, cultured in a shaker at 37 ℃ for 12 hours, and then 1 mL of the bacterial suspension was inoculated into 50 mL of a kanamycin-resistant M9 medium, which was the same as the M9 medium of example 1, in an amount of 2% by volume, and induced by the addition of 1 mM IPTG. Sampling is carried out every 24 hours for 96 hours, and the concentration of inositol is measured by a differential detector of high performance liquid chromatography, so that the strains TEJ-13 and TEJ-14 respectively produce 0.98 g/L and 3.28 g/L of inositol in 96 hours.

(2) Using RED homologous recombination technology, further knock out the genes pykA and pykF encoding pyruvate kinase and the gene gldA encoding glycerol dehydrogenase on the basis of the strain BW zwf pgi, obtaining a strain BW zwf Δ pykA, a plasmid pCS-ino1-SuhB which is successfully constructed is respectively transferred to the host BW Δ zf Δ pykA, a fermentation experiment is carried out, and an engineering strain TEJ-15 for synthesizing inositol from the head is obtained (the strain Wbzwf Δ pykA, pCS-ino 1-SuhB).

Three single colonies were picked from the plate of the above engineered strain TEJ-15, and inoculated into 4mL of liquid LB with Carna resistance, cultured at 37 ℃ for 12 hours in a shaker, and then 1 mL of the inoculum size of 2% by volume was inoculated into 50 mL of M9 medium with Carna resistance, which was the same as M9 medium in example 1, and induced by addition of 1 mM IPTG. Sampling is carried out every 24 h for 96h, and the concentration of the inositol is measured by a differential detector of high performance liquid chromatography, so that the strain TEJ-15 produces 9.53 g/L of the inositol in 96 h.

(3) Using RED homologous recombination technology, further knock out the galU coding the glucose-1-phosphate acyltransferase gene and the glgC coding the glucose-1-phosphate acyltransferase gene on the basis of the strain BW zw Δ pykF gldA, obtain the strain BW zw Δ galU Δ galC Δ pykA Δ gldA, electrically transfer the constructed plasmid pCS-INO1-SuhB into the host strain BW Δ zf Δ galU Δ glgA Δ gldA, carry out fermentation experiments on the constructed plasmid pCS-INO1-SuhB, obtain the strain for producing inositol from the head (BW zw Δ C Δ C Δ kA Δ gldA A Δ C- Δ C).

Three single colonies were picked from the plate of the engineered strain TEJ-21, inoculated into 4mL of liquid LB with Carna resistance, cultured at 37 ℃ for 12 hours in a shaker, and then 1 mL of the inoculum size of 2% by volume was inoculated into 50 mL of the M9 medium with Carna resistance, and 1 mM IPTG was added simultaneously with the inoculation, and induction was carried out at pH 6.5 and at a rotation speed of about 300 rpm, wherein the M9 medium was the same as the M9 medium in example 1. Samples were taken every 24 h for 96h and inositol concentration was determined by differential detector high performance liquid chromatography. As shown in FIG. 3, it was found that the use of the engineered bacterium TEJ-21 produced 10.69 g/L of inositol at 96h, achieving 100% conversion of glucose to inositol.

To test the production of strain TEJ-21, the concentration of glucose in the carbon source was increased to 25 g/L and the concentration of glycerol was increased to 12.5 g/L, while the other components and amounts in the M9 medium were unchanged, resulting in the production of 12.23 g/L inositol.

Example 3

Replacement of lac promoter for constitutive promoter to increase yield

Five different constitutive Promoters were selected and engineered by sequence alignment analysis of Promoters (http:// parts.item.org.), and the gene sequences of the constitutive Promoters are as follows:

SEQ ID NO:1 ttgacaattaatcatcggctcgtataatgt；

SEQ ID NO:2 tttacggctagctcagtcctaggtacaatgctagc；

SEQ ID NO:3 tttacagctagctcagtcctaggtattatgctagc；

SEQ ID NO:4 ttgacggctagctcagtcctaggtacagtgctagc；

SEQ ID NO:5 tttatggctagctcagtcctaggtacaatgctagc。

firstly, obtaining gene fragments containing different promoters by using a PCR amplification technology, carrying out gel recovery on a target gene after gel electrophoresis, carrying out enzyme digestion on the target gene containing the promoters and a plasmid vector simultaneously by using double enzyme digestion, connecting the vector and the fragments at 22 ℃ for 1h after the gel recovery, transferring the fragments into escherichia coli Trans5 alpha or Trans10, recovering the strains at 30-37 ℃ for 45-60 min, coating the strains, carrying out overnight culture until the strains grow up, selecting 3 parallel strains, adding the strains into an LB test tube with 4mL of kanamycin resistance, culturing the strains after the strains grow up, preserving the strains, and extracting the plasmids to obtain plasmids pCS-tac-INO1-suhB, pCS-J23100-INO1-suhB, pCS-J23101-INO1-suhB, pCS-J23110-INO1-suhB and pCS-J23114-INO1-suhB (Table 1).

Three parallel single colonies are picked up on the plates of the engineering bacteria TEJ-22, TEJ-23, TEJ-24, TEJ-25 and TEJ-26 respectively, and are inoculated into 4mL of liquid LB with Carna resistance, and are cultured for 12h in a shaking table at 30-37 ℃, then 1 mL of bacterial liquid is inoculated into 50 mL of M9 culture medium with Carna resistance according to the inoculum size of 2% of the volume ratio respectively, and the reaction is carried out under the conditions that the pH is 6.5 and the rotating speed is about 300 rpm without adding an inducer, wherein other components and contents of the M9 culture medium are unchanged, the concentration of glucose is 25 g/L and the concentration of glycerol is 12.5 g/L. Sampling is carried out at intervals of 24 h for 96h, and the concentration of inositol is determined by a differential detector of high performance liquid chromatography. As shown in FIG. 4, the strains TEJ-22, TEJ-23, TEJ-24, TEJ-25, TEJ-26 were found to produce inositol at 13.78g/L, 16.56g/L, 18.13g/L, 11.97g/L, and 15.39g/L, respectively, at 96 h. Thus, this example shows that the conversion rate was 100% and the myo-inositol production was increased by further enhancing the promoter expression and replacing the lac promoter with a constitutive promoter.

Example 4

Overexpression of key enzymes of the upstream glycerol pathway to improve yield

Glycerol is converted to glyceraldehyde-3-phosphate by screening glycerol kinase (glpK) derived from bacteria, fungi or protein engineering by NCBI (https:// blast. NCBI. Nlm. Nih. Gov) sequence alignment analysis and comparison according to enzyme activities reported in the literature. Firstly, obtaining a gene sequence containing glycerol kinase (glpK) and a constitutive promoter SEQ ID NO: the gene fragment of 3, the target gene after gel electrophoresis is recovered by the gel, the plasmid vector is digested by double restriction, the vector and the plasmid vector are ligated at 22 ℃ for 1h, the E.coli Trans 5. Alpha. Or Trans 10. C37. C is recovered for 45-60 min, the strains are spread over night and cultured, 3 parallel strains are picked up and cultured in LB test tube with 4mL of kanamycin resistance, the plasmid is kept after the growth, finally, the quality pCS-J23100-INO1-SuhB-glpK (Table 1) is obtained, the host strain BW zwf. GalU is used, the strain is expressed by the RED recombination technology, the strain is expressed by the RED source recombination technology coding the glycerol gene, the strain is expressed by the RED source recombination technology, the strain is expressed by the glc. The strain is expressed by the glc. The strain.

Next, the successfully constructed plasmid pCS-J23110-INO1-suhB-glpK is transferred into the host strain BW zwf Δ galU Δ glgC Δ pykA pykF Δ gldA for fermentation, and the engineering strain TEJ-31 for synthesizing inositol from the head is obtained (BW zwf Δ galU Δ glgC Δ pykA Δ pykF Δ glpKglpKglpKdS/pCS-J23110-INO 1-suhB-glpK) (Table 1).

Three single colonies in parallel were picked up from the engineered strain TEJ-31 plate, and inoculated into 4mL of liquid LB with Carna resistance, cultured for 12 hours in a shaker at 30-37 ℃, and then 1 mL of the inoculum size of 2% by volume was inoculated into 40-50 mL of M9 medium with Carna resistance, which was the same as the M9 medium used in example 3, without addition of inducer, and reacted at pH 6.5 and at about 300 rpm. Samples were taken every 24 h for 96h and inositol concentration was determined by differential detector high performance liquid chromatography. As shown in FIG. 5, it was determined that strain TEJ-31 produced 26.37g/L of inositol at 96h, achieving 100% conversion of glucose to inositol. Therefore, this example can achieve 100% conversion rate and increase myo-inositol production by further overexpressing glpK encoding glycerol kinase gene.

TABLE 1 List of hosts and plasmids used in the examples of the present invention

Therefore, the engineering bacteria for producing the inositol provided by the embodiment of the invention can realize the efficient biosynthesis of the inositol by taking simple carbon sources such as sucrose, glucose, glycerol and the like as sources by combining metabolic engineering in synthetic biology. The inositol-producing engineering bacteria provided by the embodiment of the invention can improve the yield of inositol by the following method:

firstly, a gene regulation strategy is introduced, and through knockout by using Red homologous recombination, zwf of a gene coding for glucose-6-phosphate dehydrogenase, pgi of a gene coding for glucose phosphate isomerase, galU of a gene coding for glucose-1-phosphate uridyltransferase, glgC of a gene coding for glucose-1-phosphate adenylyltransferase, glpK of a gene coding for glycerol kinase, gldA of a gene coding for glycerol dehydrogenase, and pykA and pykF of a gene coding for pyruvate kinase in a host genome are knocked out; secondly, overexpression of a gene glpK for coding glycerol kinase accelerates glycerol utilization; thirdly, a constitutive promoter for highly efficient biosynthesis of inositol was introduced, replacing the lac promoter with a constitutive promoter.

In short, the embodiment of the invention firstly constructs an artificial pathway for synthesizing inositol biologically through inositol-1-phosphate synthase (INO 1) and simultaneously overexpresses endogenous enzyme inositol monophosphate suhB, then introduces a gene regulation strategy to obtain a host bacterium with high yield of inositol, overexpresses an upstream pathway, replaces a constitutive promoter, avoids the use of an inducer, and gradually improves the yield of the inositol and the yield of a carbon source, thereby realizing the high-efficiency synthesis of the inositol.

Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention and not to limit it; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art will understand that: modifications to the specific embodiments of the invention or equivalent substitutions for parts of the technical features may be made; without departing from the spirit of the present invention, it is intended to cover all aspects of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> Beijing university of chemical industry

<120> engineering bacterium for producing inositol, construction method and application thereof

<130> 2019

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence

<400> 1

ttgacaattaatcatcggctcgtataatgt

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<400> 2

tttacggctagctcagtcctaggtacaatgctagc

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence

<400> 3

tttacagctagctcagtcctaggtattatgctagc

<210> 4

<211> 35

<212> DNA

<213> Artificial sequence

<400> 4

ttgacggctagctcagtcctaggtacagtgctagc

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence

<400> 5

tttatggctagctcagtcctaggtacaatgctagc

Claims

1. An engineering bacterium for producing inositol, which takes glycerol and glucose as carbon sources of a fermentation culture medium, and is characterized in that: the recombinant expression vector comprises a host bacterium and a plasmid vector transferred into the host bacterium, wherein a gene glpK for coding glycerol kinase is knocked out from the host bacterium; the plasmid vector is introduced with genes coding inositol-1-phosphate synthetase and inositol monophosphatase and genes glpK for over-expressing and coding glycerol kinase; in the host bacterium, while zwf coding for a glucose-6-phosphate dehydrogenase gene and pgi coding for a glucose phosphate isomerase gene are knocked out, galU coding for a glucose-1-phosphate uridyltransferase gene, glgC coding for a glucose-1-phosphate adenylyltransferase gene, gldA coding for a glycerol dehydrogenase gene, pykA and pykF coding for a pyruvate kinase gene, galU coding for a glucose-1-phosphate uridyltransferase gene and glgC coding for a glucose-1-phosphate adenylyltransferase gene are knocked out.

2. A method for constructing an engineered inositol-producing bacterium according to claim 1, comprising the steps of:

a recombinant expression plasmid, genes coding inositol-1-phosphate synthetase and inositol monophosphatase and a gene glpK for over-expressing and coding glycerol kinase are connected to the expression plasmid for recombination, and the plasmid vector is obtained;

constructing an engineering bacterium, and transforming the plasmid vector into the host bacterium to obtain an engineering bacterium for producing inositol, wherein the host bacterium is knocked out of a gene glpK coding for glycerol kinase, a gene zwf coding for glucose-6-phosphate dehydrogenase, a gene pgi coding for glucose phosphate isomerase, a gene galU coding for glucose-1-phosphate uridyltransferase, a gene glgC coding for glucose-1-phosphate adenylyltransferase, a gene gldA coding for glycerol dehydrogenase, genes pykA and pykF coding for pyruvate kinase, a gene galU coding for glucose-1-phosphate uridyltransferase and a gene glgC coding for glucose-1-phosphate adenylyltransferase.

3. The method for constructing an engineered inositol-producing bacterium according to claim 2, wherein: in the step of the recombinant expression plasmid, the gene encoding inositol-1-phosphate synthase, the gene encoding inositol monophosphatase and the gene glpK of glycerol kinase are subjected to PCR amplification treatment by using a constitutive promoter, and the gene sequence of the constitutive promoter is SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5.

4. The application of an engineering bacterium for producing inositol is characterized in that: inoculating the engineering bacteria for producing inositol according to claim 1 into the fermentation culture medium according to the inoculation amount of 1-5% by volume, adding an inducer, and performing fermentation treatment at 20-37 ℃ and pH of 5-8 to obtain the inositol.

5. The use of the engineered myo-inositol producing bacteria of claim 4, wherein: the fermentation medium comprises 10-40 g of 8729and L of 825480 ¹ 1-5 g of the carbon source 8729and L8254 ¹ Yeast powder 5-8 g of 8729and L of 825454 ¹ NaHPO ₄ ，0.3～2 g∙L‾ ¹ NaCl，2～5 g∙L‾ ¹ KH ₂ PO ₄ ，1～5 g∙L‾ ¹ NH ₄ Cl，240～250 mg∙L‾ ¹ MgSO ₄ ，14～15.5 mg∙L‾ ¹ CaCl ₂ 。