CN103820487A - Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma - Google Patents
Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma Download PDFInfo
- Publication number
- CN103820487A CN103820487A CN201310611921.7A CN201310611921A CN103820487A CN 103820487 A CN103820487 A CN 103820487A CN 201310611921 A CN201310611921 A CN 201310611921A CN 103820487 A CN103820487 A CN 103820487A
- Authority
- CN
- China
- Prior art keywords
- wood
- agrobacterium
- trichoderma
- mould
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to application of a G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma. The resistance of G418 is used as a selection marker of the resistance of trichoderma. An agrobacterium tumefacien-mediated genetic transformation method of trichoderma comprises the following steps: connecting a G418 resistant gene with a carrier p1300 subjected to enzyme digestion and dephosphorylation to form a carrier p1300-neo; activating agrobacterium strains and cultivating until the OD600 value is 0.3-0.6, and using 15-25 mmol/L of CaC12 to perform resuspension on bacterial cells to prepare agrobacterium competent cells; uniformly mixing the carrier p1300-neo with the agrobacterium competent cells, keeping the temperature of 35-40 DEG C for at least 3 min, using an LB (Luria-Bertani) culture medium for cultivation at the temperature of 25-35 DEG C, and then using a YEB culture medium containing kanamycin and rifampicin for cultivation and screening out recombinant agrobacterium tumefacien; uniformly mixing an activated recombinant agrobacterium tumefacien solution in a logarithmic phase, of which the OD660 value is 0.6-0.8 with a trichoderma viride conidial suspension and performing induction cultivation, and then using an M-100 culture medium containing G418 for cultivation at the temperature of 25-30 DEG C and screening out trichoderma resisting G418. The invention provides a novel resistance selection marker for trichoderma viride and brings considerable convenience to research of the gene function of trichoderma, and the cost is low.
Description
Technical field
The invention belongs to field of genetic engineering, relate in particular to the application of a kind of G418 resistance marker in the mould genetic transformation of agriculture bacillus mediated wood.
Background technology
Trichoderma is extensively present in edatope, is the important monoid of soil microorganisms, also sees in plant residue and animal excrement, encloses, also exists in a large number in the ecotope such as seed and bulb at plant rhizosphere, leaf.Since the thirties in last century, this class beneficial microorganism has been widely used in biological control, the production of cellulase, the biological restoration function of Plant diseases.Mould prussiate, agricultural chemicals, formaldehyde, diesel oil, phenols and the Adsorption of Heavy Metals etc. of can degrading of wood.
The genetic improvement that agriculture bacillus mediated genetic transformation method is Trichoderma and functional gene research provide effective means.In the genetic conversion system of Trichoderma, the most frequently used selectable marker gene is hygromycin gene.Can screen and obtain wooden mould mutants which had by hygromycin resistance mark, further carry out the research of Trichoderma gene function, the mould application in biological control, environment remediation and Industrial products are produced of performance wood better.But in research when wooden mould gene function, often need to carry out gene knockout experiment to wild wood is mould, carry out functional complementation confirmatory experiment to knocking out mutant on this basis.Now, only there is a kind of resistance selective marker often can not meet the demands, must have new resistance selective marker just can carry out the screening of genetic transformation.For a long time, only there is hygromycin B resistant marker for the selected marker of Trichoderma genetic transformation, lack other effective resistance selective marker.Therefore, the dominant selection markers of expansion Trichoderma has very important significance.
Summary of the invention
First object of the present invention is to provide the application method of a kind of G418 in the mould genetic transformation of agriculture bacillus mediated wood, and this application method is that resistance take G418 is as wooden mould resistance screening mark, to solve the problem of selected marker deficiency of Trichoderma genetic transformation.
Second object of the present invention is to provide a kind of new mould genetic transforming method of agriculture bacillus mediated wood, to solve the protoplast transformation conventionally mediating by PEG, the problem that step is more loaded down with trivial details.
The technical scheme that realizes above-mentioned second goal of the invention is: the mould genetic transforming method of described agriculture bacillus mediated wood comprises
(1) the G418 resistant gene reclaiming and process enzyme are cut to also dephosphorylized carrier p1300 and be connected from pSM334 plasmid, be built into p1300-neo carrier;
(2) agrobacterium strains activates and is cultured to OD with LB substratum
600value is 0.3～0.6, collects thalline, and with 15～25mmol/L CaCl
2resuspended thalline, preparation Agrobacterium competent cell;
(3) middle to p1300-neo carrier in (1) and (2) Agrobacterium competent cell is mixed, 35～40 ℃ are incubated at least 3min, with LB substratum 25～35 ℃ of cultivations, then by the YEB culture medium culturing containing kantlex and Rifampin and filter out restructuring Agrobacterium and confirms to contain G418 resistant gene by PCR;
(4) will be in logarithmic phase and OD
660value is the restructuring Agrobacterium bacterium liquid of 0.6～0.8 activation and trichoderma conidium suspension mixes and inducing culture, more mould at 25～30 ℃ of wood of cultivating and filtering out anti-G418 with the M-100 substratum that contains G418.
The difference of the mould genetic transforming method of this agriculture bacillus mediated wood and the existing agriculture bacillus mediated mould genetic transforming method of wood is that resistance take G418 is as selection markers.
Wherein,
While building p1300-neo carrier, use Xba I digested plasmid pSM334 and carrier p1300.
Trichoderma conidium suspension is by being inoculated in trichoderma strain PDA substratum, and 24～30 ℃ of illumination cultivation Trichodermas, wash lower trichoderma conidium by stroke-physiological saline solution and obtain.
Activation restructuring Agrobacterium bacterium liquid by agrobacterium strains is inoculated in LB liquid nutrient medium and is cultivated, then with inducing culture cultivate Agrobacterium to OD
660reaching 0.6～0.8 obtains.Wherein, in LB liquid nutrient medium, can contain kantlex and Streptomycin sulphate; In inducing culture, contain Syringylethanone and glucose.
In LB substratum in step (2), can also contain welfare flat; In step (4), in M-100 substratum, can contain cephamycin.
Above-mentioned wood is mould is the dark green trichoderma of wild-type.
The 3rd object of the present invention is to provide the mould genetic conversion system of a kind of agriculture bacillus mediated wood, and the difference of this system and the mould genetic conversion system of existing wood is: take the G418 resistant gene reclaiming from pSM334 plasmid and the p1300-neo that process enzyme is cut and dephosphorylized carrier p1300 connects into as carrier.
The invention has the advantages that: Trichoderma has very important biotechnology and is worth, and is used widely in industry, agricultural and environment remediation field.In the time of the mould gene function of research wood, often need to carry out gene knockout experiment to wild wood is mould, carry out functional complementation confirmatory experiment to knocking out mutant on this basis.Now, only there is a kind of resistance selective marker not satisfy the demand, must there is new resistance selective marker just can carry out the screening of genetic transformation, but in wood is mould, except hygromycin resistance selective marker, not find other suitable antibiotics resistance selective markers always.The present invention is first using G418 as the mould resistance selective marker of wood, and passed through strict experimental demonstration, and for Trichoderma has increased a kind of new resistance selective marker, this has brought huge convenience for the mould gene functional research of wood.The structure of p1300-neo carrier, change that G418 in the past never succeeds in Trichoderma as dominant selection markers and the situation of widespread use, for the genetic manipulations such as the screening of Trichoderma mutant and the research of gene function provide an economy more efficient instrument again.This carrier also can be widely used in going in the genetic researches of other filamentous funguss.
In addition, Totomycin is expensive, every gram of price is approximately 5000 yuan, and the price of G418 is approximately only 1/10th of Totomycin, when the present invention also shows using G418 as resistance screening mark, its working concentration in PDA substratum is about 25 μ g/mL, far below the working concentration of the common 250 μ g/mL of Totomycin.Therefore can be greatly cost-saving as the mould resistance screening mark of wood using G418.
Accompanying drawing explanation
The sensitivity tests result of the dark green trichoderma T23 of Fig. 1 to G418, on in figure, arrange from left to right G418 concentration and be followed successively by and be respectively 0 μ g/mL, 5 μ g/mL, 10 μ g/mL, lower row from left to right G418 concentration is followed successively by and is respectively 15 μ g/mL, 20 μ g/mL, 25 μ g/mL.
The enzyme of Fig. 2 p1300-neo plasmid is cut proof diagram, and wherein M is DNA Marker; 1 is p1300-neo; 2 cut p1300 for Xba I enzyme; 3 cut p1300-neo for EcoR I enzyme; 4 cut p1300-neo for Xba I enzyme.
Fig. 3 G418 Resistance gene analysis figure
Embodiment
Below in conjunction with accompanying drawing and accompanying drawing interpretation the specific embodiment of the present invention
The main raw relating in embodiment and reagent source
Wood is mould: the dark green trichoderma T23 of wild-type, derives from Fuyang Teachers College's school of life and health sciences.
Plasmid p1300: hygromycin gene fragment enzyme in plasmid pCAMBIA1300 is cut except transforming and formed, derive from Fuyang Teachers College's school of life and health sciences.
Agrobacterium: agrobacterium tumefaciens AGL-1, derives from Life Sci-Tech institute of Shanghai Communications University.
Plasmid pSM334: derive from the Chinese Academy of Agricultural Sciences.
Restriction enzyme Xba I and EcoR I: derive from Fermentas biotech firm.
G418: derive from German MERCK company.
The main agents relating in embodiment, the compound method of substratum
Inducing culture: 1 × MM Salts, 10mmol/L glucose, 0.5% glycerine, moist heat sterilization, is cooled to, after 50 ℃, add 40mmol/L4-morpholino b acid.
Wherein 1 × MM Salts: take KH
2pO
43.625g, K
2hPO
45.125g, NaCl0.375g, MgSO
4 .7H
2o1.250g, CaCl
2 .2H
2o0.165g, FeSO
4 .7H
2o0.0062g, (NH
4)
2sO
41.250g, adds water and is settled to 1000mL, dilutes 2.5 times.
M-100 substratum: glucose 10g, saltpetre (KNO
3) 3g, M-100 salts solution (Salt Solution) 62.5mL, agar powder 1.5g, redistilled water constant volume is to 1000mL, and moist heat sterilization is cooled to 50 ℃ of left and right to add the cephamycin of respective volume and Totomycin mother liquor to reach required final concentration.
Wherein M-100 salts solution (Salt Solution): take potassium primary phosphate (KH
2pO
4) 16g, sodium sulfate (Na
2sO
4) 4g, Repone K (KCl) 8g, bitter salt (MgSO
4 .7H
2o) 2g, calcium chloride (CaCl
2) 1g, M-100 trace salts solution (Trace Element Solution) 8mL, redistilled water constant volume is to 1000mL.Wherein, M-100 trace salts solution (Trace Element Solution): take phosphorous acid (H
3pO
3) 30mg, four hydration Manganous chloride tetrahydrate (MnCl
2 .4H
2o) 70mg, zinc chloride (ZnCl
2) 200mg, Sodium orthomolybdate (Na
2moO
4 .2H
2o) 20mg, ferric chloride hexahydrate (FeCl
3 .6H
2o) 50mg, cupric sulfate pentahydrate (CuSO
4 .5H
2o) 200mg, redistilled water constant volume is to 500mL.
Embodiment mono-
The application of 1.G418 microbiotic in the mould genetic transformation of agriculture bacillus mediated wood
Because G418 resistance Select gene is to use first on wood is mould, must carry out sensitivity tests and determine that whether responsive wood mould to G418, and the suitable working concentration of G418 in screening culture medium.Result shows: along with the rising of G418 concentration in PDA substratum, the inhibition that the mould growth of wild wood is subject to obviously strengthens, be on the PDA flat board of 25 μ g/mL in G418 concentration, the dark green trichoderma T23 of wild-type strain culturing 90h has no obvious growth sign, and growth is suppressed completely.Showing that the G418 concentration of 25 μ g/mL can suppress the growth of the dark green trichoderma T23 of wild-type effectively, can the antibiotic resistance of G418 be therefore wooden mould resistance screening mark.For effectively carrying out the genetic transformation screening of dark green trichoderma, select the G418 concentration of 25 μ g/mL as the screening concentration of genetic transformation.
2. the mould genetic transforming method of agriculture bacillus mediated wood
(1) build p1300-neo carrier
With Xba I digested plasmid pSM334, reclaim the G418 resistant gene fragment that size is about 2.1kb, cut with process Xba I enzyme, and carry out dephosphorylized carrier p1300 connection, be built into p1300-neo carrier.The p1300-neo carrier being built into is cut by EcoR I and Xba I enzyme, respectively compared with control plasmid p1300, find that two DNA fragmentation sizes after enzyme is cut differ in 2kb left and right (Fig. 2), consistent with theory expectation, show that the G418 resistant gene fragment that size is about 2.1kb has been connected on p1300 plasmid.
(2) prepare Agrobacterium competent cell
Agrobacterium tumefaciens bacterial strain is activated on LB flat board, the agrobacterium tumefaciens bacterium liquid of activation is inoculated into the LB liquid nutrient medium flat containing welfare, 29 ℃ are cultured to OD
600value is 0.6, and after precooling, centrifugal collection thalline, abandons supernatant, then uses the 15mmol/L CaCl of precooling
2resuspended precipitation.
(3) p1300-neo carrier transforms Agrobacterium
P1300-neo carrier is added in the agrobacterium tumefaciens competent cell dissolving, mixes; Mixing liquid successively ice bath 30min, liquid nitrogen flash freezer 2min, 37 ℃ insulation 3min, ice bath 2min after, add LB liquid nutrient medium to cultivate after 6h at 28 ℃, getting bacterium liquid coats on the YEB selection flat board containing kantlex and Rifampin, be inverted for 28 ℃ and cultivate, select restructuring Agrobacterium and confirm containing G418 resistant gene by PCR.
(4) activation culture of restructuring Agrobacterium
Restructuring agrobacterium strains is inoculated in the liquid nutrient medium containing the LB of kantlex and Streptomycin sulphate, 29 ℃ of cultivations, then be cultured to OD with 29 ℃ of inducing cultures that contain Syringylethanone and glucose
660reach 0.6.
(5) prepare dark green trichoderma conidium suspension
The dark green trichoderma T23 of wild-type is inoculated in potato glucose sugar nutrient agar (PDA substratum), and 28 ℃ of illumination cultivation 5 days are washed lower conidium by stroke-physiological saline solution, blood counting chamber counting, and adjusting conidium concentration is 10
7individual/mL.
(6) agriculture bacillus mediated dark green trichoderma genetic transformation
First glassine paper is covered on the inducing culture containing Syringylethanone and glucose, mix again the restructuring Agrobacterium and the dark green trichoderma conidium suspension of wild-type that have activated, then mixing liquid is applied on glassine paper, 25 ℃ of dark culturing 2 days, glassine paper is transferred on the M-100 flat board containing G418 and cephamycin, cultivate 3 days for 28 ℃, filter out the dark green trichoderma transformant of wild-type of anti-G418.
3. the mould genetic conversion system of agriculture bacillus mediated wood
Filter out after the dark green trichoderma transformant of wild-type of anti-G418, gone to again on the PDA of the G418 that contains 25 μ g/mL and carried out postsearch screening, then on PDA, after 7 generations of succeeding transfer culture, can be still stable transformant confirming as containing the transformant of normal growth on the PDA of 25 μ g/mL G418.
To p1/p2, further identify whether be transformant, wherein primer pair p1/p2 be respectively by pcr amplification according to G418 resistant gene primers,
p1:ATGATTGAACAAGATGGATTGCACGC
p2:TCAGAAGAACTCGTCAAGAAGGCG
The transformant obtaining by ATMT still can grown containing in the resistant panel of G418 after the subculture of continuous multi-generation.Detect through PCR, transformant all can amplify G418 resistant gene fragment (as shown in Figure 3), is indicated as positive transformant.
Therefore can set up a kind of new mould genetic conversion system of agriculture bacillus mediated wood, the difference of this genetic conversion system and the mould genetic conversion system of existing wood is take the antibiotic resistance of G418 as selection markers.
Embodiment bis-
Except following technical characterictic, other technical characterictic is all identical with embodiment 1.
(2) in, the Agrobacterium bacterium liquid of activation is inoculated into the LB liquid nutrient medium flat containing welfare, and 29 ℃ are cultured to OD
600value is 0.3, and after precooling, centrifugal collection thalline, abandons supernatant, then uses the 20mmol/L CaCl of precooling
2resuspended precipitation.
(3) 35 ℃ of insulation 4min of p1300-neo carrier and Agrobacterium competent cell mixing liquid in; After adding in LB liquid nutrient medium, cultivate after 4h at 25 ℃, get bacterium liquid and coat on the YEB selection flat board containing kantlex and Rifampin.
(4) in, restructuring agrobacterium strains is inoculated in LB liquid nutrient medium, is cultured to OD with inducing culture
660reach 0.8.
(6) in, glassine paper is transferred on the M-100 flat board containing G418 and cephamycin, cultivates 7 days for 25 ℃, and filters out the dark green trichoderma transformant of wild-type of anti-G418.
Except following technical characterictic, other technical characterictic is all identical with embodiment 1.
(2) in, the agrobacterium tumefaciens bacterium liquid of activation is inoculated into the LB liquid nutrient medium flat containing welfare, and 29 ℃ are cultured to OD
600value is 0.5, and after precooling, centrifugal collection thalline, abandons supernatant, then uses the 25mmol/L CaCl of precooling
2resuspended precipitation.
(3) 40 ℃ of insulation 5min of p1300-neo carrier and Agrobacterium competent cell mixing liquid in; After adding in LB liquid nutrient medium, cultivate after 5h at 35 ℃, get bacterium liquid and coat on the YEB selection flat board containing G418.
(4) in, restructuring agrobacterium strains is inoculated in LB liquid nutrient medium, is cultured to OD with inducing culture
660reach 0.7.
(6) in, glassine paper is transferred on the M-100 flat board containing G418 and cephamycin, cultivates 7 days for 30 ℃, and filters out the dark green trichoderma transformant of wild-type of anti-G418.
Claims (7)
1. the application of G418 in the mould genetic transformation of agriculture bacillus mediated wood, is characterized in that: take the resistance of G418 as wooden mould resistance screening mark.
2. the mould genetic transforming method of agriculture bacillus mediated wood, comprises
(1) selection markers gene and process enzyme are cut to also dephosphorylized carrier p1300 and be connected, be built into p1300-neo carrier;
(2) Agrobacterium is activated and is cultured to OD with LB substratum
600value is 0.3～0.6, collects thalline, and with 15～25mmol/L CaCl
2resuspended described thalline, preparation Agrobacterium competent cell;
(3) p1300-neo carrier described in step (1) and the described Agrobacterium competent cell of step (2) are mixed, be incubated at least 3min at 35～40 ℃, use again LB substratum after 25～35 ℃ of cultivations, then with containing the YEB culture medium culturing of kantlex and Rifampin and filtering out restructuring Agrobacterium and determine containing selection markers gene by PCR;
(4) will be in logarithmic phase and OD
660value is that the mould conidium suspension of described restructuring Agrobacterium bacterium liquid and the wood of 0.6～0.8 activation mixes and inducing culture, then cultivate and filter out with the wood of selection markers gene at 25～30 ℃ with M-100 substratum mould,
It is characterized in that: described selection markers is G418 resistance, described selection markers gene is the G418 resistant gene reclaiming from pSM334 plasmid.
3. the mould genetic transforming method of agriculture bacillus mediated wood as claimed in claim 2, it is characterized in that: described trichoderma conidium suspension is by by the mould wood PDA of being inoculated into substratum, 24～30 ℃ of illumination cultivation Trichodermas, then wash lower trichoderma conidium by stroke-physiological saline solution and obtain.
4. the mould genetic transforming method of agriculture bacillus mediated wood as claimed in claim 2, it is characterized in that: the restructuring Agrobacterium bacterium liquid of described activation is that described object agrobacterium strains is inoculated in LB liquid nutrient medium, 29 ℃ of cultivations, then be cultured to OD with 29 ℃ of inducing cultures
660reaching 0.6～0.8 obtains.
5. the mould genetic transforming method of agriculture bacillus mediated wood as claimed in claim 4, is characterized in that: in described inducing culture, contain in Syringylethanone and glucose and/or described LB liquid nutrient medium containing kantlex and Streptomycin sulphate.
6. the mould genetic transforming method of agriculture bacillus mediated wood as claimed in claim 2, is characterized in that: in the LB substratum in described step (2), contain in the flat and/or described step (4) of welfare in M-100 substratum containing cephamycin.
7. the mould genetic conversion system of agriculture bacillus mediated wood, is characterized in that: take the G418 resistant gene reclaiming from pSM334 plasmid and the p1300-neo that process enzyme is cut and dephosphorylized carrier p1300 connects into as carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310611921.7A CN103820487A (en) | 2013-11-26 | 2013-11-26 | Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310611921.7A CN103820487A (en) | 2013-11-26 | 2013-11-26 | Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103820487A true CN103820487A (en) | 2014-05-28 |
Family
ID=50755776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310611921.7A Pending CN103820487A (en) | 2013-11-26 | 2013-11-26 | Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103820487A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172187A (en) * | 2020-03-18 | 2020-05-19 | 四川省农业科学院经济作物育种栽培研究所 | Efficient genetic transformation method for trichoderma viride |
| CN113355347A (en) * | 2021-06-09 | 2021-09-07 | 安徽大学 | Method for establishing G418 genetic transformation screening system in Arthrobotrys oligospora |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1778886A (en) * | 2004-11-17 | 2006-05-31 | 杨谦 | Production of insect-proof sick wooden mold and its use |
| CN102304540A (en) * | 2011-08-26 | 2012-01-04 | 华东理工大学 | Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment |
-
2013
- 2013-11-26 CN CN201310611921.7A patent/CN103820487A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1778886A (en) * | 2004-11-17 | 2006-05-31 | 杨谦 | Production of insect-proof sick wooden mold and its use |
| CN102304540A (en) * | 2011-08-26 | 2012-01-04 | 华东理工大学 | Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment |
Non-Patent Citations (3)
| Title |
|---|
| SABINE GRUBER，ET AL: "Generation of Trichoderma atroviride mutants with constitutively activated G protein signaling by using geneticin resistance as selection marker", 《BMC RESEARCH NOTES》, vol. 5, 17 November 2012 (2012-11-17), pages 1 - 8 * |
| 刘刚， 等: "根癌农杆菌介导里氏木霉转化体系的建立和条件优化", 《生物技术》, vol. 21, no. 4, 15 August 2011 (2011-08-15), pages 44 - 48 * |
| 罗雯，等: "根癌农杆菌转化条件优化的研究", 《生物技术》, vol. 16, no. 1, 28 February 2006 (2006-02-28), pages 41 - 43 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172187A (en) * | 2020-03-18 | 2020-05-19 | 四川省农业科学院经济作物育种栽培研究所 | Efficient genetic transformation method for trichoderma viride |
| CN113355347A (en) * | 2021-06-09 | 2021-09-07 | 安徽大学 | Method for establishing G418 genetic transformation screening system in Arthrobotrys oligospora |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020375167B2 (en) | Strains and processes for single cell protein or biomass production | |
| CN105734002B (en) | A kind of recombination glutamate producing bacterium strain and the preparation method and application thereof | |
| ZHAO et al. | Isolation and characterization of Penicillium oxalicum ZHJ6 for biodegradation of methamidophos | |
| CN106916765B (en) | A method of heavy metal in waste water zinc is adsorbed using penicillium janthinellum | |
| CN104232722A (en) | Method for producing 9-alpha-hydroxyandrostenedione by microbial fermentation | |
| KR101910275B1 (en) | Novel Streptomyces griseus KNU-05 strain and uses thereof | |
| CN107641622A (en) | Hydrolyzable para-Phthalonitrile prepares the nitrilase of paracyanobenzoic acid | |
| Saxena et al. | Phosphate solubilization by a few fungal strains belonging to the genera Aspergillus and Penicillium | |
| CN105368767A (en) | Recombinant bacillus subtilis for expressing cellobiose-2-epimerase based on D-alanine defective screening, and construction method of recombinant bacillus subtilis | |
| WO2014091718A1 (en) | Culture method and culture system for microalgae | |
| CN108026546A (en) | Microbacterium bacterial strain is used for the purposes for producing antiseptic | |
| CN105368866A (en) | Application of improved ATMT (Agrobacterium Tumefaciens-Mediated Transformation) to construction of trichoderma atroviride T23 deltaCrel | |
| CN107574173A (en) | A kind of recombinant plasmid and its method for building High-productive Monascus Pigment Strain | |
| US9689017B2 (en) | Method of semi-solid state fermentation for producing surfactin from a mutant strain of Bacillus subtilis subsp | |
| CN103820487A (en) | Application of G418 resistance marker in agrobacterium tumefacien-mediated genetic transformation of trichoderma | |
| CN117701486A (en) | Recombinant bacterium for producing PHA and construction method and application thereof | |
| CN110218736B (en) | Transformation method for improving AcdS production capacity of PGPR | |
| CN110713964B (en) | Saccharopolyspora whiskers engineering strain with cspA gene doubled and application thereof | |
| CN102925419B (en) | Organic phosphorus pesticide degrading enzyme mutant and preparation method thereof | |
| CN107151674A (en) | Novel antimicrobial peptide DLP4 preparation method | |
| CN111763650A (en) | Nitrogen-fixing methylobacterium strain and application thereof | |
| CN103820506B (en) | A kind of method of gene recombination bacterium fermentation preparation of cozymase Q 10 | |
| CN108239612B (en) | Neisseri (Nesterenkonia) strain X35 and application thereof | |
| CN116024092A (en) | Chlorella pyrenoidosa improved variety resource with high protein yield and high genetic transformation efficiency and application thereof | |
| US9580738B2 (en) | Method for producing extracellular proteins from genus Tepidimonas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140528 |