CN110157691B

CN110157691B - 5-amino-acetopropionic acid synthetase mutant and host cell and application thereof

Info

Publication number: CN110157691B
Application number: CN201910425976.6A
Authority: CN
Inventors: 孙际宾; 陈久洲; 郑平; 朱成超; 郭轩; 周文娟; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2019-05-21
Filing date: 2019-05-21
Publication date: 2020-06-26
Anticipated expiration: 2039-05-21
Also published as: CN110157691A

Abstract

The invention provides a 5-aminoacetylalanine synthetase (ALA synthetase), wherein the amino acid residue of the ALA synthetase at the 11 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is Ile, Ser, Met, Cys and Val. The invention also provides a method for preparing the enzyme, an expression vector containing the enzyme, a host cell, application of the enzyme in ALA production and a method for improving the activity of ALA synthetase by modifying the ALA synthetase.

Description

5-amino-acetopropionic acid synthetase mutant and host cell and application thereof

Technical Field

The invention relates to the field of biotechnology. In particular, the invention relates to mutants of 5-aminoacetylpropionic acid synthetase, host cells and applications thereof.

Background

5-aminolevulinic acid (ALA) is a precursor for synthesizing tetrapyrrole compounds such as heme, chlorophyll, VB12 and the like by organisms and is widely present in animals, plants and microorganisms. ALA is widely applied in the fields of medicine, agriculture, feed, health food and the like, and is a high-added-value bio-based chemical with great development value. In recent years, the production of ALA by fermentation via the C4 pathway using microorganisms has been used industrially.

5-aminolevulinic acid synthase (ALA synthetase) is a key enzyme and a rate-limiting enzyme for synthesizing ALA and tetrapyrrole compounds through a C4 pathway, and the enzymatic properties of the 5-aminolevulinic acid synthase directly influence the efficiency of ALA synthesis. In recent years, a large number of ALA synthetases of various origins, including Agrobacterium radiobacter (CN 1322132C), Rhodobacter acidophilus (CN 1974758B), Rhodococcus sphaeroides (CN 103146694B), Rhodopseudomonas palustris (CN 103981203B), and the like, have been cloned and identified and used for the construction of ALA highly producing strains. However, the above ALA synthetases are all naturally occurring sources in various organisms, and these enzymes themselves have low activity (Meng et al. Biotechnology Letters,2015,37(11): 2247-.

In recent years, with rapid development of enzyme engineering and protein engineering techniques, it has been widely used to improve properties such as catalytic activity of enzymes by rational design. However, studies on rational design and modification of ALA synthase are not many, and there are reports related mainly to ALA synthase derived from eukaryotes, Turbeville et al, which can improve catalytic efficiency of two mouse-derived ALA synthases after fusion expression (Turbeville et al, animals of Biochemistry & Biochemistry, 2011,511(1): 107-. Although the studies described above obtained ALA synthetase with improved enzyme activity, ALA synthetase derived from eukaryotes has low expression activity in bacteria, but is not used for ALA biosynthesis.

In addition, as a key enzyme in the ALA synthesis process, the improvement of the ALA synthetase activity can accelerate the catalytic efficiency of ALA synthesis of engineering bacteria, reduce the energy loss in the processes of self protein synthesis and degradation, further improve the stability and the production performance of the engineering bacteria, reduce the ALA production cost, and has important value in promoting the application of ALA in the fields of agriculture and animal husbandry and the like.

Therefore, there is an urgent need in the art to develop highly active ALA synthetases to achieve low cost biological production of ALA.

Disclosure of Invention

The object of the present invention is to provide an ALA synthase with improved activity, a method for improving ALA synthase activity, and a method for producing ALA using the ALA synthase obtained.

In a first aspect, the present invention provides an ALA synthetase or an active fragment thereof, characterized in that:

a) the amino acid residue of the amino acid sequence of the ALA synthetase at the 11 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is replaced by Ile, Ser, Met, Cys and Val; or

b) ALA synthetase derived from a) having the sequence defined in a), but being formed by substitution, deletion or addition of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, other than the above-mentioned positions, and having substantially the ALA synthetase function defined in a); or

c) A ALA synthetase derived from a) having the sequence defined under a), a sequence formed by deletion or addition, preferably addition, of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue at either end of the sequence defined under a), and having substantially the ALA synthetase function defined under a).

In a preferred embodiment, the ALA synthetase is derived from rhodopseudomonas palustris (rhodopseudomonas palustris).

In a further preferred embodiment, the amino acid sequence of the ALA synthetase has more than 80%, preferably more than 85%, more preferably more than 90%, more preferably more than 95%, more preferably 96%, 97%, 98%, 99% homology with the amino acid sequence shown in SEQ ID No. 1.

In a preferred embodiment, the amino acid sequence of the ALA synthetase is shown as SEQ ID NO 1, and

a) the amino acid residue at position 11 is one selected from the group consisting of: ile, Ser, Met, Cys, Val; or

In a second aspect, the present invention provides a nucleic acid sequence encoding the ALA synthetase of the first aspect or an active fragment thereof.

In a third aspect, the present invention provides an expression vector comprising a nucleic acid sequence encoding the ALA synthetase of the first aspect or an active fragment thereof.

In a fourth aspect, the present invention provides a host cell comprising the ALA synthetase of the first aspect or an active fragment thereof.

In a preferred embodiment, the host cell comprises the expression vector of the third aspect or has integrated in its genome the coding nucleic acid sequence of the second aspect.

In a preferred embodiment, the host cell is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Rhodobacter sphaeroides (Rhodobacter sphaeroides), Rhodobacter capsulatus (Rhodobacter capsulatus), Rhodopseudomonas palustris (Rhodopseudomonas palustris); more preferably Escherichia coli or Corynebacterium glutamicum.

In a fifth aspect, the present invention provides the use of an ALA synthetase or an active fragment thereof as described in the first aspect, or an encoding nucleic acid sequence as described in the second aspect, or an expression vector as described in the third aspect, or a host cell as described in the fourth aspect, for the production of ALA.

In a sixth aspect, the present invention provides a method of preparing ALA, the method comprising the steps of:

a. culturing the host cell of the fourth aspect such that ALA is produced; and

b. optionally separating the ALA produced in step a from the culture broth.

In a seventh aspect, the present invention provides a process for the preparation of ALA, the process comprising the steps of:

a. catalyzing the synthesis of ALA from succinyl-CoA and glycine using the ALA synthetase of claim 1 or an active fragment thereof; and

b. optionally, ALA is isolated from the above reaction system.

In an eighth aspect, the present invention provides a method of producing ALA synthetase as defined in the first aspect, the method comprising the steps of:

a. obtaining a coding sequence for the ALA synthetase of the first aspect;

b. transfecting the coding sequence obtained from a directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;

d. isolating ALA synthase produced by said host cells from the culture system obtained in step c.

In a preferred embodiment, the method further comprises determining the activity of the ALA synthetase obtained and the ALA production of the strain.

In a ninth aspect, the present invention provides a method of engineering an ALA synthetase to increase its activity, the method comprising the steps of:

a. relative to the amino acid sequence of the ALA synthetase before modification, the 11 th amino acid residue of the amino acid sequence of the ALA synthetase to be modified is replaced by Ile, Ser, Met, Cys and Val;

or

Comparing the amino acid sequence of the ALA synthetase to be modified with the amino acid sequence shown in SEQ ID NO. 1, and modifying the coding sequence of the ALA synthetase to be modified, so that the 11 th amino acid residue in the coded amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO. 1 is replaced by Ile, Ser, Met, Cys and Val;

c. culturing the host cell obtained in step b; and

d. optionally isolating ALA synthetase produced by said host cell from the culture system obtained in step c.

In a preferred embodiment, the method further comprises determining the activity of the ALA synthetase obtained and the ALA production of the engineered strain comprising said ALA synthetase.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Detailed Description

The inventor unexpectedly finds that the 11 th amino acid residue of the amino acid sequence shown in SEQ ID NO. 1 is mutated into Ile, Ser, Met, Cys and Val through extensive and intensive research, and the obtained ALA synthetase not only improves the enzyme activity, but also improves the yield of ALA, thereby improving the application value of the ALA synthetase in ALA production. The present invention has been completed based on this finding.

The term "native state" as used herein refers to an activity of a polypeptide in a microorganism in an unmodified state, i.e., an activity in the native state.

The expression "maintaining the original function" means that a mutant of a gene or protein has a function (e.g., activity or property) corresponding to the function of the original gene or protein. The expression "maintaining the original function" as used for a gene means that a mutant of the gene encodes a protein that maintains the original function. That is, the expression "retains an original function" of an ALA synthase mutant gene means that the mutant of the gene encodes a protein having ALA synthase activity, and the expression "retains an original function" of an ALA synthase mutant means that the mutant protein has ALA synthase activity. The activity of ALA synthetase means that the protein has the activity of catalyzing the synthesis of ALA from succinyl CoA and glycine.

"ALA synthetase"

The terms "ALA synthetase" and "polypeptide of the invention" are used interchangeably herein and have the meaning commonly understood by those of ordinary skill in the art and are meant to have the activity of catalyzing the synthesis of ALA from succinyl-CoA and glycine.

In connection with the present invention, ALA synthase may or may not be a protein corresponding to the amino acid sequence shown in SEQ ID NO. 1 (MNYEAYFRRQLDGLHREGRYRVFADLERHAGSFPRATHHRPEGAGDVTVWCSNDYLGMGQHPAVLTAMHEALDSCGAGAGGTRNIAGTNHYHVLLEQELAALHGKESALLFTSGYVSNWASLSTLASRMPGCVILSDELNHASMIEGIRHSRSETRIFAHNDPRDLERKLADLDPHAPKLVAFESVYSMDGDIAPIAEICDVADAHNAMTYLDEVHGVGLYGPNGGGIADREGISHRLTIIEGTLAKAFGVVGGYIAGSSAVCDFVRSFASGFIFSTSPPPAVAAGALASIRHLRASSAERERHQDRVARLRARLDQAGVAHMPNPSHIVPVMVGDAALCKQISDELISRYGIYVQPINYPTVPRGTERLRITPSPQHTDADIEHLVQALSEIWTRVGLAKAA); in other words, the ALA synthase of the present invention may have a high homology or a low homology with the amino acid sequence shown in SEQ ID NO. 1.ALA synthase of the present invention may be derived from various species, including but not limited to Agrobacterium radiobacter (Agrobacterium radiobacter), Rhodobacter acidophilus (Rhodoblastus acidophilus), Rhodobacter sphaeroides (Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodopseudomonas palustris (Rhodopseudomonas capsulatus), and Rhodopseudomonas palustris (Rhodopseudomonas palustris), provided that it has ALA synthase activity and its corresponding mutation of the 11 th amino acid residue to Ile, Ser, Met, Cys, Val, which is improved as compared to the natural state activity, is also included in the scope of the present invention.

Specifically, the 11 th amino acid residue of the amino acid sequence of ALA synthetase of the present invention is Ile, Ser, Met, Cys, Val; or the amino acid residue of the amino acid sequence of the ALA synthetase at the 11 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is Ile, Ser, Met, Cys and Val. In a preferred embodiment, the amino acid sequence of the ALA synthase is substituted with Ile at the amino acid residue corresponding to position 11 of the sequence shown in SEQ ID NO 1.

It is known to those skilled in the art that it is more important to mutate the wild-type polypeptide in order to increase its activity to find a site that achieves the desired purpose. Thus, based on the teachings of the present invention, a person skilled in the art would mutate the corresponding amino acid residue in position 11 of the ALA synthetase to be engineered and test the mutants for the relevant activity.

Furthermore, it will be understood by those of ordinary skill in The art that altering a few amino acid residues in certain regions of a polypeptide does not substantially alter The biological activity, e.g., that The sequence resulting from appropriate substitution of certain amino acids does not affect its activity (see Watson et al, Molecular Biology of The Gene, fourth edition, 1987, The Benjamin/Cummingspub. Co. P224). Thus, one of ordinary skill in the art would be able to perform such substitutions (including substitutions, deletions, insertions, additions of residues) and ensure that the resulting polypeptide retains its original function.

For example, it is well known to those skilled in the art that the addition or subtraction of several amino acid residues at either end of the polypeptide, e.g.preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, does not affect the function of the resulting mutant, e.g.for ease of purification, the skilled person will often have a 6 × His-tag at either end of the resulting protein, which has the same function as a protein without a 6 × His-tag.

The present invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The ALA synthase gene may be a probe prepared under stringent conditions with the amino acid sequence shown in SEQ ID NO. 1, for example, DMA which hybridizes to a sequence complementary to a part or the entire of the amino acid sequence shown in SEQ ID NO. 1, as long as its original function is maintained. The "stringent conditions" refer to conditions under which so-called specific hybridization can be formed and non-specific hybridization is not formed. For example, the conditions for hybridization of DNAs having high homology, for example, DNAs having homology of 80% or more, and DNAs having homology of less than 80% do not hybridize with each other, or the washing conditions for ordinary Southern hybridization, that is, the conditions for washing 1 time, preferably 2 to 3 times at a salt concentration and temperature equivalent to 60 ℃,1 XSSC, 0.1% SDS, preferably 60 ℃, 0.1 XSSC, 0.1% SDS, more preferably 68 ℃, 0.1 XSSC, 0.1% SDS.

Furthermore, since the degeneracy of the codons varies from host to host, any codon in the ALA synthetase gene may be replaced with a corresponding equivalent codon, i.e. the ALA synthetase gene may be a mutation of any of the ALA synthetase genes described above, e.g. due to the degeneracy of the genetic code. For example, the ALA synthetase gene may be a gene modified such that it has optimal codons according to the codon frequency in the host to be used.

Thus, as used herein, "comprising," "having," or "including" includes "comprising," "consisting essentially of … …," "consisting essentially of … …," and "consisting of … …"; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

The term "active fragment" as used herein is the same or similar in meaning as conventionally understood by those skilled in the art, and means that the amino acid sequence of the fragment is a portion of the amino acid sequence of the complete protein or polypeptide, but that the fragment has the same or similar function or activity as the complete protein or polypeptide. Specifically, in the present invention, the "active fragment" means any amino acid sequence having ALA synthetase activity.

Based on the teachings of the present invention and the ALA synthetase specifically obtained by the present invention, it is not difficult for a person skilled in the art to obtain active fragments having the same or similar activity or function, and such active fragments should of course fall within the scope of the present invention.

"corresponds to"

Thus, for example, with respect to "amino acid residue corresponding to position 11 of the amino acid sequence set forth in SEQ ID NO: 1", if a 6 × His tag is added to one end of the amino acid sequence set forth in SEQ ID NO:1, position 11 of the resulting mutant corresponding to the amino acid sequence set forth in SEQ ID NO:1 may be position 17.

In a specific embodiment, the homology or sequence identity may be 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% homology. Thus, ALA synthetases having more than 90%, preferably more than 95%, more preferably 96%, 97%, 98%, 99% sequence identity or homology to a particular ALA synthetase of the invention and having said amino acid residue mutations at the above positions are also within the scope of the invention.

The corresponding positions of any amino acid sequence to the amino acid sequence shown in SEQ ID NO. 1 can be determined by alignment between the amino acid sequences. Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), Lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic Projects (Biocomputing: information and genome Projects), Smith, d.w. eds, academic press, new york, 1993; computer Analysis of Sequence Data (Computer Analysis of Sequence Data), first part, Griffin, a.m. and Griffin, h.g. eds, Humana Press, new jersey, 1994; sequence Analysis in molecular Biology (Sequence Analysis in molecular Biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis Primer), Gribskov, m. and Devereux, j. eds M Stockton Press, New York, 1991 and Carillo, h. and Lipman, d.s., SIAM j.applied Math., 48:1073 (1988). The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). BLASTX programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md.20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Host cell

The term "host cell" as used herein is a host cell having the meaning commonly understood by a person of ordinary skill in the art, i.e. capable of producing the ALA synthetase of the invention. In other words, the present invention may utilize any host cell as long as the ALA synthetase of the present invention can be expressed in the host cell.

For example, host cells suitable for use in the present invention are derived from, but not limited to, Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Rhodobacter sphaeroides (Rhodobacter sphaeroides), Rhodopseudomonas palustris (Rhodopseudomonas palustris); more preferably Escherichia coli or Corynebacterium glutamicum.

Immobilized enzyme

The term "immobilized enzyme" as used herein has the meaning conventionally understood by a person of ordinary skill in the art. Specifically, the term means that a water-soluble enzyme is physically or chemically treated to bind the enzyme to a water-insoluble macromolecular carrier or entrap the enzyme therein, so that the enzyme forms microcapsules of a soluble gel or semi-permeable membrane in water to cause a decrease in fluidity.

The immobilized enzyme still has enzymatic activity and acts on the substrate in a solid phase in the catalytic reaction. After being immobilized, the enzyme has increased stability, is easy to separate from the reaction system, is easy to control and can be used repeatedly. Is convenient for transportation and storage and is beneficial to automatic production. The immobilized enzyme is an enzyme application technology developed in more than ten years, and has attractive application prospects in the aspects of industrial production, chemical analysis, medicine and the like.

One of ordinary skill in the art, in view of the teachings herein, will readily process the ALA synthetase of the present invention into an immobilized enzyme or in a whole-cell catalyzed form for catalyzing the production of ALA from glycine and succinyl-CoA.

Applications and advantages of the invention

1. The ALA synthetase can improve the yield of ALA, reduce the production cost and has wide industrial application prospect;

2. the invention provides point mutation sites for modifying ALA synthetase, and mutation of the sites can effectively improve the enzyme activity of the ALA synthetase to be modified.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations.

Materials and methods

The DNA polymerase used in the examples of the present invention was purchased from Pyrobest, Dalianbao Bio Inc.; restriction enzymes, DNA ligases and the like were purchased from Fermentas;

yeast powder and peptone were purchased from Oxoid, England; glycine and IPTG were purchased from Promega; ALA and p-dimethylaminobenzaldehyde and the like were purchased from Sigma; hemin, agar powder and antibiotics were purchased from Beijing soja; glucose, glacial acetic acid, perchloric acid, trichloroacetic acid, acetylacetonatochloroform and other common chemical reagents are all purchased from national medicine.

The plasmid extraction kit and the agarose gel electrophoresis recovery kit are purchased from Shanghai workers, and related operations are executed strictly according to the instructions;

plasmid construction sequencing verification is completed by Jinzhi;

coil DH5 α competent cells were purchased from holo-gold, Beijing.

LB medium composition: 5g/L of yeast powder, 10g/L of peptone and 10g/L of NaCl, and 2% of agar powder is added into a solid culture medium.

M9 medium composition: na (Na)₂HPO₄·12H₂O 17.1g/L，KH₂PO₄3.0g/L，NaCl 0.5g/L，NH₄Cl1.0g/L，MgSO₄2mM，CaCl₂0.1mM, 20g/L glucose and 2g/L yeast powder.

The antibiotic concentrations were: ampicillin 100. mu.g/mL, kanamycin 50. mu.g/mL.

The detection method of ALA comprises the following steps: 200 mu L of diluted fermentation liquor or a sample after the enzyme activity determination reaction is ended is added with 100 mu L of sodium acetate buffer solution with pH4.6, then 5 mu L of acetylacetone is added, water bath incubation at 100 ℃ is carried out for 15min, after cooling to room temperature, Ehrlish's reagent (42mL of glacial acetic acid, 8mL of 70% perchloric acid, 1g of dimethylaminobenzaldehyde) with the same volume is added and mixed evenly, and after developing for 10min, the absorbance under the wavelength of 553nm is measured.

The crude enzyme activity was determined as follows:

(1) the cells (OD) were collected by centrifugation and stored at-80 ℃₆₀₀25) was resuspended in 1mL Tris-HCl buffer (ph7.5, containing 100mM NaCl);

(2) MP disruption of cells: crushing 7 times at 30S/6M/S;

(3) and (4) centrifuging the cell disruption solution obtained in the last step, and collecting a supernatant.

(4) Protein concentration determination was performed using BCA protein quantification kit from Thermo Scientific with reference to the instructions.

And (3) enzyme activity determination: the measurement reaction was carried out in a total volume of 200. mu.L of 50mM Tris-HCl buffer solution (pH7.5, containing 100mM NaCl) and the components of the enzyme reaction system are shown in Table 1. 10 mu L of cell disruption supernatant is added, and after shaking reaction for 6min at 37 ℃ in a metal bath, 100 mu L of 10% trichloroacetic acid solution is added into the system to stop the reaction.

TABLE 1 determination of ALA synthetase Activity the concentrations of the components in the reaction System

Components	Volume of addition
		Glycine (1M)	40μL
Succinyl coenzyme A (10mM)	5μL
		Pyridoxal phosphate (10mM)	2μL
ALA synthetase (150. mu.g/mL)	10μL
		Tris-HCl (50mM, pH7.5, containing 100mM NaCl)	143μL

Example 1 construction of ALA synthetase mutation vector

Using Stratagene series

XL-II site-directed mutagenesis kit, 19 pairs of primers (shown in Table 2) are designed, pEC-XK99E-hemA wild type plasmid is used as a template (the construction process refers to the construction and fermentation optimization of a pathway for synthesizing 5-aminolevulinic acid by corynebacterium glutamicum [ J]Biotechnology report, 2017,33(01):148-

10 μ L of Fast Pfu Fly Buffer, 32 μ L of sterilized double distilled water,

FastPfu FlyDNA Polymerase 1. mu.L, the PCR product was purified and recovered with gel recovery kit, transformed into E.coli DH5 α competent cells, plated with LB plate containing kanamycin, cultured overnight at 37 ℃, and verified by sequencing of transformants, the correct expression vectors were designated p11A, p11R, p11N, p11C, p11I, p11M, p11S, p11T, p11V, respectively.

TABLE 2 primer sequences

Primer name	Primer sequence (5 '-3')	SEQ ID NO:
			11R-F	CCGTCAACGCGACGGCCTCCATCGTGAAGGCCGG	2
11R-R	GGCCGTCGCGTTGACGGCGGAAATAGGCTTCG	3
			11C-F	CCGTCAATGCGACGGCCTCCATCGTGAAGGCCGG	4
11C-R	GGCCGTCGCATTGACGGCGGAAATAGGCTTCG	5
			11I-F	CCGTCAAATCGACGGCCTCCATCGTGAAGGCCGG	6
11I-R	GGCCGTCGATTTGACGGCGGAAATAGGCTTCG	7
			11M-F	CCGTCAAATGGACGGCCTCCATCGTGAAGGCCGG	8
11M-R	GGCCGTCCATTTGACGGCGGAAATAGGCTTCG	9
			11S-F	CCGTCAAAGCGACGGCCTCCATCGTGAAGGCCGG	10
11S-R	GGCCGTCGCTTTGACGGCGGAAATAGGCTTCG	11
			11T-F	CCGTCAAACTGACGGCCTCCATCGTGAAGGCCGG	12
11T-R	GGCCGTCAGTTTGACGGCGGAAATAGGCTTCG	13
			11V-F	CCGTCAAGTTGACGGCCTCCATCGTGAAGGCCGG	14
11V-R	GGCCGTCAACTTGACGGCGGAAATAGGCTTCG	15

Example 2 recombinant Strain construction and fermentation validation

Transforming the expression vector with the correct ALA synthetase mutation into a C.glutamicum ATCC13032 strain to obtain an engineering strain, performing 24-well ALA fermentation on an ALA synthetase mutant engineering strain, culturing the mutant engineering strain in a 24-well plate containing an M9 culture medium containing yeast powder for 16h as a seed solution, and culturing according to an initial OD₆₀₀Transferring the strain to a 24-hole plate containing an M9 culture medium for fermentation verification in the range of 0.5, culturing for 3h, adding an inducer IPTG to the final concentration of 100uM, finishing fermentation for 24h, and measuring the enzyme activity of ALA synthetase crude enzyme and ALA yield. The methods for detecting the enzyme activity of crude enzyme, detecting ALA and analyzing glucose are described in the section of materials and methods. Through detection, compared with the wild type strain, the crude enzyme activity of each mutant is improved, certain difference exists in ALA yield of each recombinant strain, and as shown in Table 3, the ALA yield of the wild type strain is set to be 1.

The result shows that compared with the wild type, after the ALA synthetase 11 site mutant is Ile, Ser, Met, Cys and Val, the ALA yield is higher than that of a control strain, the promotion amplitude is 2-40%, and no obvious effect or great yield reduction is caused when the mutant is mutated into other amino acids.

TABLE 3.24 Orifice plate fermentation validation of the Effect of ALA synthetase mutants on ALA Synthesis

Example 3.5L fermenter validation

The most effective mutant (p11I) expression strain was selected and verified in a 5L fermentor, and the fermentation medium had the following composition: (NH)₄)₂SO₄5g/L，KH₂PO₄5g/L, 2g/L of corn steep liquor dry powder and MgSO₄7H₂O2 g/L, thiamine hydrochloride 1mg/L, and the temperature is controlled at 30 ℃ in the fermentation process, the pH value is 6.5, and the dissolved oxygen is not lower than 30%. The results show that the ALA yield of the strains respectively reaches 20g/L and is increased by 16.2 percent compared with a control strain (17.2g/L), and the engineering strains of the expression mutants can also effectively increase the ALA yield of the products at the fermentation tank level.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> 5-aminolevulinic acid synthase mutant, host cell and application thereof

<130>P2019-0814

<160>15

<170>SIPOSequenceListing 1.0

<210>1

<211>403

<212>PRT

<213> Rhodopseudomonas palustris (Rhodopseudomonas palustris)

<400>1

Met Asn Tyr Glu Ala Tyr Phe Arg Arg Gln Leu Asp Gly Leu His Arg

1 5 10 15

Glu Gly Arg Tyr Arg Val Phe Ala Asp Leu Glu Arg His Ala Gly Ser

20 25 30

Phe Pro Arg Ala Thr His His Arg Pro Glu Gly Ala Gly Asp Val Thr

35 40 45

Val Trp Cys Ser Asn Asp Tyr Leu Gly Met Gly Gln His Pro Ala Val

50 55 60

Leu Thr Ala Met His Glu Ala Leu Asp Ser Cys Gly Ala Gly Ala Gly

65 70 75 80

Gly Thr Arg Asn Ile Ala Gly Thr Asn His Tyr His Val Leu Leu Glu

85 90 95

Gln Glu Leu Ala Ala Leu His Gly Lys Glu Ser Ala Leu Leu Phe Thr

100 105 110

Ser Gly Tyr Val Ser Asn Trp Ala Ser Leu Ser Thr Leu Ala Ser Arg

115 120 125

Met Pro Gly Cys Val Ile Leu Ser Asp Glu Leu Asn His Ala Ser Met

130 135 140

Ile Glu Gly Ile Arg His Ser Arg Ser Glu Thr Arg Ile Phe Ala His

145 150 155 160

Asn Asp Pro Arg Asp Leu Glu Arg Lys Leu Ala Asp Leu Asp Pro His

165 170 175

Ala Pro Lys Leu Val Ala Phe Glu Ser Val Tyr Ser Met Asp Gly Asp

180 185 190

Ile Ala Pro Ile Ala Glu Ile Cys Asp Val Ala Asp Ala His Asn Ala

195 200 205

Met Thr Tyr Leu Asp Glu Val His Gly Val Gly Leu Tyr Gly Pro Asn

210 215 220

Gly Gly Gly Ile Ala Asp Arg Glu Gly Ile Ser His Arg Leu Thr Ile

225 230 235 240

Ile Glu Gly Thr Leu Ala Lys Ala Phe Gly Val Val Gly Gly Tyr Ile

245 250 255

Ala Gly Ser Ser Ala Val Cys Asp Phe Val Arg Ser Phe Ala Ser Gly

260 265 270

Phe Ile Phe Ser Thr Ser Pro Pro Pro Ala Val Ala Ala Gly Ala Leu

275 280 285

Ala Ser Ile Arg His Leu Arg Ala Ser Ser Ala Glu Arg Glu Arg His

290295 300

Gln Asp Arg Val Ala Arg Leu Arg Ala Arg Leu Asp Gln Ala Gly Val

305 310 315 320

Ala His Met Pro Asn Pro Ser His Ile Val Pro Val Met Val Gly Asp

325 330 335

Ala Ala Leu Cys Lys Gln Ile Ser Asp Glu Leu Ile Ser Arg Tyr Gly

340 345 350

Ile Tyr Val Gln Pro Ile Asn Tyr Pro Thr Val Pro Arg Gly Thr Glu

355 360 365

Arg Leu Arg Ile Thr Pro Ser Pro Gln His Thr Asp Ala Asp Ile Glu

370 375 380

His Leu Val Gln Ala Leu Ser Glu Ile Trp Thr Arg Val Gly Leu Ala

385 390 395 400

Lys Ala Ala

<210>2

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccgtcaacgc gacggcctcc atcgtgaagg ccgg 34

<210>3

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggccgtcgcg ttgacggcgg aaataggctt cg 32

<210>4

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgtcaatgc gacggcctcc atcgtgaagg ccgg 34

<210>5

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggccgtcgca ttgacggcgg aaataggctt cg 32

<210>6

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccgtcaaatc gacggcctcc atcgtgaagg ccgg 34

<210>7

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ggccgtcgat ttgacggcgg aaataggctt cg 32

<210>8

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccgtcaaatg gacggcctcc atcgtgaaggccgg 34

<210>9

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ggccgtccat ttgacggcgg aaataggctt cg 32

<210>10

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccgtcaaagc gacggcctcc atcgtgaagg ccgg 34

<210>11

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggccgtcgct ttgacggcgg aaataggctt cg 32

<210>12

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ccgtcaaact gacggcctcc atcgtgaagg ccgg 34

<210>13

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ggccgtcagt ttgacggcgg aaataggctt cg 32

<210>14

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ccgtcaagtt gacggcctcc atcgtgaagg ccgg 34

<210>15

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ggccgtcaac ttgacggcgg aaataggctt cg 32

Claims

1.A 5-aminolevulinic acid (ALA) synthase, characterized in that:

the amino acid sequence of the ALA synthetase is shown as SEQ ID NO. 1, but the amino acid residue at the 11 th site is replaced by Ile.

2. The nucleic acid sequence encoding ALA synthetase of claim 1.

3. An expression vector comprising a nucleic acid sequence encoding the ALA synthetase of claim 1.

4. A host cell comprising the ALA synthetase of claim 1.

5. Use of the ALA synthetase of claim 1, or the encoding nucleic acid sequence of claim 2, or the expression vector of claim 3, or the host cell of claim 4 for the production of ALA.

6. A process for preparing ALA, the process comprising the steps of:

a. culturing the host cell of claim 4 to produce ALA; and

b. optionally separating the ALA produced in step a from the culture broth.

7. A process for preparing ALA, the process comprising the steps of:

a. catalyzing the synthesis of ALA from succinyl-CoA and glycine using the ALA synthetase of claim 1; and

b. optionally, ALA is isolated from the above reaction system.

8. A process for the preparation of ALA synthetase as claimed in claim 1, the process comprising the steps of:

a. obtaining a coding sequence for the ALA synthetase of claim 1;

b. introducing the coding sequence obtained in the step a into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;