CN112831483B - 5-amino-acetopropionic acid synthetase mutant and host cell and application thereof - Google Patents

Abstract

The present invention provides a 5-aminoacetylalanine synthetase (ALA synthetase), the amino acid sequence of the ALA synthetase is mutated at the 40 th, 365 th, 75 th, 29 th and 44 th amino acid residues corresponding to the amino acid sequence shown in SEQ ID NO. 1. The ALA synthetase provided by the invention not only obviously improves the activity, but also partially eliminates the feedback inhibition of heme. Meanwhile, the invention also provides a method for preparing and modifying the enzyme, an expression vector containing the enzyme, a host cell and application of the enzyme in ALA production.

Description

5-amino-acetopropionic acid synthetase mutant and host cell and application thereof

The application is a divisional application of an invention patent application with the application number of 201810191516.7, and the invention name of the invention is '5-amino aceto-propionic acid synthetase mutant and host cell and application' which are submitted in 2018 on 03-08.h.

Technical Field

The invention relates to the field of biotechnology. In particular, the invention relates to mutants of 5-aminoacetylpropionic acid synthetase, host cells and applications thereof.

Background

5-aminolevulinic acid (ALA) is a precursor for synthesizing tetrapyrrole compounds such as heme, chlorophyll, VB12 and the like by organisms and widely exists in animals, plants and microorganisms. ALA is widely applied in the fields of medicine, agriculture, feed, health food and the like, and is a high-added-value bio-based chemical with great development value. At present, ALA is mainly produced by a chemical synthesis method, the cost of raw materials and the emission of pollutants are high, so that the production cost is high, and the large-scale application of ALA in the fields of agriculture, feed and the like is limited. In recent years, the production of ALA by microbial fermentation has been used industrially. Two biosynthesis pathways of ALA are mainly provided, one pathway is a pathway which synthesizes ALA by taking succinyl CoA and glycine as precursors under the action of ALA synthetase and is called as C4 pathway, and the other pathway is a pathway which synthesizes ALA by taking glutamyl tRNA as a precursor through two steps of reactions and is called as C5 pathway. Since only one-step enzymatic catalytic reaction is involved, the C4 pathway is widely used for constructing ALA high-yield engineering strains at present.

ALA synthetase is a key enzyme and a rate-limiting enzyme for synthesizing ALA and tetrapyrrole compounds by a C4 pathway, and the enzymatic properties of the ALA synthetase directly influence the ALA synthesis efficiency. In recent years, a large number of ALA synthetases of different origins, including Agrobacterium radiobacter (CN 1322132C), rhodococcus acidophilus (Rhodoblastus acidophilus, CN 1974758B), rhodococcus Rhodobacter (Rhodobacter sphaeroides, CN 103146694B), rhodopseudomonas palustris (Rhodopseudomonas palustris, CN 103981203B), etc., were cloned and identified and used for the construction of ALA high-producing strains. However, the ALA synthetases are all naturally occurring enzyme sources in different organisms, and the problems of poor thermal stability (Meng et al. Biotechnology Letters,2015,37 (11): 2247-2253) and end product heme feedback inhibition (Zhang et al. Biotechnology Letters,2013,35 (5): 763-768) exist in the enzymatic properties, and the application of the ALA synthetases in the field of industrial microorganisms is limited. Although ALA synthetase derived from thermophilic bacteria has high thermostability, its specific activity or substrate affinity is much lower than that of the above conventional ALA synthetase (Meng et al. Biotechnology Letters,2015,37 (11): 2247-2253), which is difficult to apply in engineering bacteria.

In recent years, with rapid development of enzyme engineering and protein engineering techniques, it has been widely used to improve properties such as catalytic activity of enzymes by rational design. However, there are few studies on rational design and modification of ALA synthase, and only reports related to ALA synthase derived from eukaryotes, such as Turbeville, et al, which express two mouse-derived ALA synthases in a fusion manner to improve the catalytic efficiency (Turbeville et al, animals of Biochemistry & Biophysics,2011,511 (1): 107-117), and Lendrihas, etc., obtained an ALA synthase mutant with improved enzyme activity by constructing a mutant library of ALA synthase II in mouse erythrocytes and screening (Lendrihas et al, journal of Biological Chemistry,2010,285 (18): 13704). Although the above studies obtained ALA synthetase with improved enzyme activity, the thermostability and anti-heme feedback inhibition ability of the mutant enzyme were not investigated and not used for ALA biosynthesis.

In addition, as key enzymes in the ALA synthesis process, the improvement of the ALA synthetase activity, the thermal stability, the elimination of feedback inhibition of heme and other properties can accelerate the catalytic efficiency of ALA synthesis of engineering bacteria, reduce the energy loss in the processes of self protein synthesis and degradation, further improve the stability and the production performance of the engineering bacteria, reduce the ALA production cost, and have important value in promoting the application of ALA in the fields of agriculture and animal husbandry and the like.

Therefore, there is a need in the art to develop ALA synthetase with high activity, good thermostability and relieved heme feedback inhibition, and to achieve low-cost biological production of ALA.

Disclosure of Invention

The invention aims to provide ALA synthetase with all improved performances and a method for producing ALA by using the ALA synthetase.

In a first aspect, the present invention provides an ALA synthase,

(a) The amino acid residue of the amino acid sequence of the ALA synthetase at the 40 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is non-arginine, and/or the amino acid residue at the 365 th position is non-arginine;

or

(b) The amino acid residue of the amino acid sequence of the ALA synthetase at the 40 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is non-arginine, and the amino acid residue at the 75 th position is non-cysteine;

or

(c) The amino acid residue of the amino acid sequence of the ALA synthetase at the 365 th position corresponding to the amino acid sequence shown in SEQ ID NO 1 is non-arginine, and the amino acid residue at the 29 th position is non-histidine or non-alanine at the 44 th position or non-cysteine at the 75 th position.

In a preferred embodiment, the amino acid sequence of the ALA synthetase has more than 90%, preferably more than 95%, more preferably 96%, 97%, 98%, 99% homology with the amino acid sequence shown in SEQ ID No. 1.

In a preferred embodiment, the ALA synthetase:

a. 1, and the amino acid residue at the 40 th site is non-arginine, and/or the amino acid residue at the 365 th site is non-arginine;

b. ALA synthetase derived from a) having the sequence defined in a) by substitution, deletion or addition of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, and having substantially the ALA synthetase function defined in a); or

c. An ALA synthetase derived from a) having the sequence defined under a), a sequence formed by deletion or addition, preferably addition, of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue at either end of the sequence defined under a), and having substantially the ALA synthetase function defined under a).

In a preferred embodiment, the ALA synthetase:

a. in the amino acid sequence corresponding to SEQ ID NO 1, the amino acid residue at position 40 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and/or

The amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys;

b. in the amino acid sequence corresponding to SEQ ID NO 1, the amino acid residue at position 40 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and

the amino acid residue at position 75 is selected from one of the following amino acids: ala, val, leu, ile; preferably Ala;

c. in the amino acid sequence corresponding to SEQ ID NO 1, the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 29 is selected from one of the following amino acids: arg, lys, gln, asn; preferably Arg;

d. in the amino acid sequence corresponding to SEQ ID NO 1, the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 44 is selected from one of the following amino acids: pro, ala; preferably Pro;

e. in the amino acid sequence corresponding to SEQ ID NO 1, the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 75 is selected from one of the following amino acids: ala, val, leu, ile; ala is preferred.

In a preferred embodiment, the ALA synthetase:

a. has an amino acid sequence shown as SEQ ID NO. 1, and

the amino acid residue at position 40 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and/or

The amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys;

b. has an amino acid sequence shown as SEQ ID NO. 1, and

the amino acid residue at position 40 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and

the amino acid residue at position 75 is selected from one of the following amino acids: ala, val, leu, ile; preferably Ala;

c. has an amino acid sequence shown as SEQ ID NO. 1, and

the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 29 is selected from one of the following amino acids: arg, lys, gln, asn; preferably Arg;

d. has an amino acid sequence shown as SEQ ID NO. 1, and

the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 44 is selected from one of the following amino acids: pro, ala; preferably Pro;

e. has an amino acid sequence shown as SEQ ID NO. 1, and

the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and

the amino acid residue at position 75 is selected from one of the following amino acids: ala, val, leu, ile; preferably Ala;

or

f. A-e derived ALA enzyme comprising a sequence as defined in any of a-e by substitution, deletion or addition of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, and having substantially the ALA synthetase function as defined in any of a-e;

or

g. A sequence as defined in any of a-e, formed by deletion or addition, preferably addition, of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, at either end of the sequence as defined in any of a-e, and an ALA enzyme derived from any of a-e having substantially the ALA synthetase function as defined in any of a-e.

In a preferred embodiment, the amino acid sequence of the ALA synthetase is shown as SEQ ID NO 1, and

a. the amino acid residue at position 40 is Gly; and/or

The amino acid residue at position 365 is Lys;

or

b. The amino acid residue at position 40 is Gly; and

the amino acid residue at position 75 is Ala;

c. the amino acid residue at position 365 is Lys; and

the amino acid residue at position 29 is Arg;

d. the amino acid residue at position 365 is preferably Lys; and

amino acid residue at position 44 is Pro;

e. the amino acid residue at position 365 is Lys; and

the amino acid residue at position 75 is Ala.

In a preferred embodiment, the ALA synthetase has an enhanced ability to tolerate feedback inhibition by heme.

In a second aspect, the present invention provides a nucleic acid sequence encoding an ALA synthetase as described in the first aspect.

In a third aspect, the present invention provides an expression vector comprising an ALA synthetase encoding nucleic acid sequence as described in the first aspect.

In a fourth aspect, the present invention provides a host cell comprising the ALA synthetase of the first aspect.

In a preferred embodiment, the host cell comprises an expression vector according to the third aspect or has integrated into its genome a coding nucleic acid sequence according to the second aspect.

In a further preferred embodiment, the host cell is Escherichia coli (Escherichia coli), corynebacterium glutamicum (Corynebacterium glutamicum), rhodobacter sphaeroides (Rhodobacter sphaeroides), rhodopseudomonas palustris (Rhodopseudomonas palustris); more preferably Escherichia coli or Corynebacterium glutamicum.

In a fifth aspect, the present invention provides the use of an ALA synthetase as defined in the first aspect, or an encoding nucleic acid sequence as defined in the second aspect, or an expression vector as defined in the third aspect, or a host cell as defined in the fourth aspect, for the production of ALA.

In a sixth aspect, the present invention provides a method of preparing ALA, the method comprising the steps of:

a. culturing the host cell of the fourth aspect such that ALA is produced; and

b. optionally separating the ALA produced in step a from the culture broth.

In a seventh aspect, the present invention provides a process for the preparation of ALA, the process comprising the steps of:

a. catalytically synthesizing ALA, e.g. from succinyl-CoA and glycine, using an ALA synthetase as described in the first aspect; and

b. optionally, ALA is isolated from the above reaction system.

In an eighth aspect, the present invention provides a method of producing ALA synthetase as defined in the first aspect, the method comprising the steps of:

a. obtaining a coding sequence for the ALA synthetase of the first aspect;

b. transfecting the coding sequence obtained from a directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;

d. isolating ALA synthase produced by said host cells from the culture system obtained in step c.

In a preferred embodiment, the amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID NO. 1 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and/or the amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys;

in a preferred embodiment, the amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID NO. 1 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and the amino acid residue at position 75 is selected from one of the following amino acids: ala, val, leu, ile; preferably Ala;

in a preferred embodiment, the amino acid residue corresponding to position 365 of the amino acid sequence shown in SEQ ID NO. 1 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys; and is

The amino acid residue at position 29 is selected from one of the following amino acids: arg, lys, gln, asn; preferably Arg; or

The amino acid residue at position 44 is selected from one of the following amino acids: pro, ala; preferably Pro; or

The 75 th amino acid residue is selected from one of the following amino acids: ala, val, leu, ile; ala is preferred.

In a preferred embodiment, the method further comprises measuring the activity of the resulting ALA synthetase and the ability to release heme feedback inhibition.

In a ninth aspect, the present invention provides a method of engineering an ALA synthetase to increase its activity, the method comprising the steps of:

a. comparing the amino acid sequence of ALA synthetase to be modified with the amino acid sequence shown in SEQ ID NO. 1; and

b. modifying the coding sequence of the ALA synthetase to be modified, so that the amino acid residue corresponding to the 40 th position of the amino acid sequence shown in SEQ ID NO. 1 in the coded amino acid sequence is non-arginine, and/or the amino acid residue at the 365 th position is non-arginine;

or

1 is non-arginine at the amino acid residue position 40 and non-cysteine at the amino acid residue position 75;

or

1, and the amino acid residue at position 365 of the amino acid sequence shown in SEQ ID NO is non-arginine, and the amino acid residue at position 29 is non-histidine or non-alanine at position 44 or non-cysteine at position 75;

c. transfecting the coding sequence obtained in the step b directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

d. culturing the resulting host cell; and

e. isolating ALA synthase produced by said host cells from the culture system obtained in step d.

In a preferred embodiment, the amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID NO. 1 is selected from one of the following amino acids: gly, pro, ala, preferably Gly; and/or

The amino acid residue at position 365 is selected from one of the following amino acids: lys, arg, gln, asn; preferably Lys;

the 75 th amino acid residue is selected from one of the following amino acids: ala, val, leu, ile; preferably Ala;

the amino acid residue at position 29 is selected from one of the following amino acids: arg, lys, gln, asn; preferably Arg;

the amino acid residue at position 44 is selected from one of the following amino acids: pro, ala; pro is preferred.

In a preferred embodiment, the method further comprises measuring the activity of the resulting ALA synthetase and the ability to release heme feedback inhibition.

In a preferred embodiment, the modified ALA synthetase has not only an increased activity but also a significantly increased ALA yield resulting from intracellular ALA production.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be repeated herein, depending on the space.

Detailed Description

The inventors have conducted extensive and intensive studies and unexpectedly found that when the amino acid residues at the 40 th, 365 th, 75 th, 29 th or 44 th positions of the amino acid sequence shown in SEQ ID NO. 1 are mutated, the obtained ALA synthetase not only improves the enzyme activity, but also improves the tolerance to heme feedback inhibition, thereby integrally improving the application value of the ALA synthetase in ALA production. The present invention has been completed based on this finding.

ALA synthetase of the present invention

The terms "ALA synthetase of the invention" and "polypeptide of the invention" as used herein are used interchangeably and have the meaning commonly understood by a person of ordinary skill in the art. The ALA synthase of the present invention has an activity of catalyzing the synthesis of ALA from succinyl-CoA and glycine.

The ALA synthetase is obtained by mutating an amino acid sequence shown in SEQ ID NO. 1, and the obtained mutant has excellent activity and can also obviously relieve the feedback inhibition of heme. The ALA synthase of the present invention may be derived from various species, including but not limited to Agrobacterium radiobacter (Agrobacterium radiobacter), rhodobacter acidophilus (Rhodoblast acidophilus), rhodococcus sphaeroides (Rhodobacter sphaeroides), rhodopseudomonas palustris (Rhodopseudomonas palustris); rhodopseudomonas palustris is preferred.

Specifically, the amino acid residue of the amino acid sequence of ALA synthetase of the invention at the 40 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 is non-arginine, and/or the amino acid residue at the 365 th position is non-arginine; or, the amino acid residue at position 40 corresponding to the amino acid sequence shown in SEQ ID NO. 1 is non-arginine and the amino acid residue at position 75 is non-cysteine; or the amino acid residue at position 365 of the amino acid sequence corresponding to SEQ ID NO 1 is non-arginine and the amino acid residue at position 29 is non-histidine or non-alanine at position 44 or non-cysteine at position 75.

It is known to those skilled in the art that it is more important to find a site that can achieve the desired purpose by mutating the wild-type polypeptide in order to increase the activity. Thus, based on the teaching of the present invention, the skilled person will mutate the amino acid residue at position 40, 365, 75, 29 or 44 of the amino acid sequence shown in SEQ ID NO. 1 or the amino acid residue in an amino acid sequence corresponding to position 40, 365, 75, 29 or 44 of the amino acid sequence shown in SEQ ID NO. 1 and test the relevant activity of the mutant. In a specific embodiment, the amino acid residue of the ALA synthetase of the invention at position 40 corresponding to the amino acid sequence shown in SEQ ID No. 1 may be mutated to (but is not limited to): gly, pro or Ala, preferably Gly; the amino acid residue at position 365 can be mutated to (but is not limited to): lys, arg, gln, or Asn; preferably Lys; the amino acid residue at position 75 can be mutated to (but is not limited to): ala, val, leu or Ile; preferably Ala; the amino acid residue at position 29 may be mutated to (but is not limited to): arg, lys, gln, asn; preferably Arg; the amino acid residue at position 44 may be mutated to (but is not limited to): pro or Ala; pro is preferred.

Furthermore, it will be appreciated by those of ordinary skill in The art that altering a few amino acid residues in certain regions of a polypeptide, e.g., non-critical regions, does not substantially alter biological activity, e.g., the sequence resulting from appropriate substitution of certain amino acids does not affect its activity (see Watson et al, molecular Biology of The Gene, fourth edition, 1987, the Benjamin/Cummings pub. Co. P224). Thus, one of ordinary skill in the art would be able to effect such a substitution and ensure that the resulting molecule still possesses the desired biological activity.

Thus, it is apparent that further mutations to the ALA synthetase of the invention result in further mutants still possessing the function and activity of ALA synthetase. For example, it is well known to those skilled in the art that the addition or subtraction of several amino acid residues, e.g., preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, at either end of a polypeptide does not affect the function of the resulting mutant. For example, for ease of purification, the skilled artisan will often have a 6 × His tag on either end of the resulting protein, which has the same function as a protein without the 6 × His tag.

Thus, conservative mutants of the ALA synthetase of the invention are intended to be encompassed by the present invention. These conservative mutants can be generated by amino acid substitution, for example, as shown in the following table.

Initial residue	Representative residue of substitutionsBase (C)	Preferred substituent residues
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The present invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

Thus, as used herein, "comprising," "having," or "including" includes "comprising," "consisting essentially of … …," "consisting essentially of … …," and "consisting of … …"; "consisting essentially of … …", "consisting essentially of … …" and "consisting of … …" belong to the subordinate concepts of "containing", "having" or "including".

"corresponds to"

The term "corresponding to" as used herein has the meaning commonly understood by a person of ordinary skill in the art. Specifically, "corresponding to" means the position of one sequence corresponding to a specified position in the other sequence after alignment of the two sequences by homology or sequence identity. Thus, for example, in the case of "amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID NO: 1", if a 6 XHis tag is added to one end of the amino acid sequence shown in SEQ ID NO:1, position 40 of the resulting mutant corresponding to the amino acid sequence shown in SEQ ID NO:1 may be position 46.

In a particular embodiment, the homology or sequence identity may be 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% homology.

Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic items (Biocomputing: information and Genome Projects), smith, D.W. eds, academic Press, new York, 1993; computer Analysis of Sequence Data (Computer Analysis of Sequence Data), first part, griffin, a.m. and Griffin, h.g. eds, humana Press, new jersey, 1994; sequence Analysis in Molecular Biology (Sequence Analysis in Molecular Biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis Primer), gribskov, m. and deveux, j. eds M Stockton Press, new york, 1991 and carllo, h. and Lipman, d., SIAM j applied math, 48. The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. Et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. Et al, 1990). BLASTX programs are publicly available from NCBI and other sources (BLAST Manual, altschul, S. Et al, NCBI NLM NIH Bethesda, md.20894; altschul, S. Et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Host cell

The term "host cell" as used herein is a host cell having the meaning generally understood by a person of ordinary skill in the art, i.e. capable of producing the ALA synthetase of the invention. In other words, the present invention may utilize any host cell as long as the ALA synthetase of the present invention can be expressed in the host cell.

For example, suitable host cells for use in the present invention are derived from, but not limited to, escherichia coli (Escherichia coli), corynebacterium glutamicum (Corynebacterium glutamicum), rhodobacter sphaeroides (Rhodobacter sphaeroides), rhodopseudomonas palustris (Rhodopseudomonas palustris); more preferably Escherichia coli or Corynebacterium glutamicum.

Relieving heme feedback inhibition

It will be understood by those skilled in the art that the term "deregulation" as used herein refers to an enzyme that is originally feedback-inhibited by heme and that has been engineered to have a reduced degree of heme inhibition. This reduction was obtained by comparing the degree of inhibition of both enzymes at the same heme concentration. "release of heme feedback inhibition" encompasses partial to complete release of feedback inhibition. The degree of inhibition is the proportion of ALA synthetase activity that is lost (i.e. inhibited) in the presence of a certain concentration of heme compared to the absence of heme.

In a specific embodiment, the ALA synthetase retains at least 80% of its relative enzymatic activity in the presence of 2.5 μ M heme.

Immobilized enzyme

The term "immobilized enzyme" as used herein has the meaning conventionally understood by a person of ordinary skill in the art. Specifically, the term means that a water-soluble enzyme is physically or chemically treated to bind the enzyme to a water-insoluble macromolecular carrier or entrap the enzyme therein, so that the enzyme forms microcapsules of a soluble gel or semi-permeable membrane in water to cause a decrease in fluidity.

The immobilized enzyme still has enzymatic activity and acts on the substrate in a solid phase in the catalytic reaction. After being immobilized, the enzyme has increased stability, is easy to separate from the reaction system, is easy to control and can be used repeatedly. Is convenient for transportation and storage and is beneficial to automatic production. The immobilized enzyme is an enzyme application technology developed in more than ten years, and has attractive application prospects in the aspects of industrial production, chemical analysis, medicines and the like.

One of ordinary skill in the art, in view of the teachings herein, will readily process the ALA synthetase of the present invention into an immobilized enzyme or in a whole-cell catalyzed form for catalyzing the production of ALA from glycine and succinyl-CoA.

Applications and advantages of the invention

1. The ALA synthetase of the invention can be applied industrially to achieve low cost production of ALA;

2. the ALA synthetase has high activity, can effectively relieve the feedback inhibition of heme, and has wide industrial application prospect;

3. the invention provides point mutation sites for modifying ALA synthetase, and mutation of the sites can effectively improve the enzyme activity of the ALA synthetase to be modified and can also relieve the feedback inhibition of heme.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Materials and methods

The DNA polymerase used in the examples of the present invention was purchased from Pyrobest of Dalianbao Bio Inc.; restriction enzymes, DNA ligases and the like were purchased from Fermentas;

yeast powder and peptone are available from Oxoid, UK; glycine and IPTG were purchased from Promega; ALA and p-dimethylaminobenzaldehyde and the like were purchased from Sigma; hemin, agar powder and antibiotics were purchased from Beijing Solyebao; glucose, glacial acetic acid, perchloric acid, trichloroacetic acid, acetylacetonatochloroform and other common chemical reagents are all purchased from national medicine.

The plasmid extraction kit and the agarose gel electrophoresis recovery kit are purchased from Shanghai workers, and related operations are executed strictly according to the instructions;

plasmid construction sequencing verification is completed by Jin Weizhi;

e.coil DH5 α competent cells, e.coil BL21 (DE 3) competent cells were purchased from total gold, beijing.

LB medium composition: 5g/L of yeast powder, 10g/L of peptone and 10g/L of NaCl, and 2% of agar powder is added into a solid culture medium.

The antibiotic concentrations were: ampicillin 100. Mu.g/mL, kanamycin 50. Mu.g/mL.

The detection method of ALA comprises the following steps: 200 mu L of diluted fermentation liquor or a sample after the enzyme activity determination reaction is ended is added with 100 mu L of pH 4.6 sodium acetate buffer solution, then 5 mu L of acetylacetone is added, water bath incubation at 100 ℃ is carried out for 15min, after cooling to room temperature, ehrlish's reagent (42 mL of glacial acetic acid, 8mL of 70% perchloric acid and 1g of dimethylaminobenzaldehyde) with the same volume is added and mixed evenly, and after developing for 10min, the absorbance under the wavelength of 553nm is measured.

Example 1 construction of ALA synthetase mutant vectors

Using Stratagene series Quik

XL-II site-directed mutagenesis kit, 2 pairs of primers (see Table 1) are designed, pET21a-hemA (construction process is referred to Zhang et al. Biotechnology Letters,2013,35 (5): 763-768) wild-type plasmid is used as a template, PCR amplification is carried out by using the primers, arginine (R) at the 40 th position and the 365 th position of the hemA is mutated into glycine (G) and lysine (K), and PCR reaction conditions are as follows: 95 ℃ for 5min,10 cycles (95 ℃ 30s,74 ℃ to 65 ℃ 30s,68 ℃ for 7 min), 13 cycles (95 ℃ 30s,65 ℃ 30s,68 ℃ for 7 min), and 68 ℃ for 10min. PCR amplification System (50. Mu.L): mu.L of template, 2. Mu.L of each of the upstream and downstream primers, 1. Mu.L of dNTP mix, 5. Mu.L of 10 XPyrobest Buffer, 38.5. Mu.L of sterilized double distilled water, and 0.5. Mu.L of Pyrobest DNA polymerase. And purifying and recovering the PCR product by using a gel recovery kit. Transformants were sequenced by Jin Weizhi and correctly sequenced expression vectors were named pET21a-R40G and pET21a-R365K, respectively.

TABLE 1 primer sequences

Primer name	Sequence numbering	Primer sequence (5 '-3')
			R40G-F	SEQ ID NO:2	CACCACGGTCCTGAGGGCGCCGGCGATGTGAC
R40G-R	SEQ ID NO:3	CTCAGGACCGTGGTGCGTGGCGC
			R365K-F	SEQ ID NO:4	GTGCCGAAAGGCACCGAGCGCCTTCGGATCAC
R365K-R	SEQ ID NO:5	CGGTGCCTTTCGGCACGGTCGGATAGTTGATC

Example 2 detection of enzymatic Properties of ALA synthetase mutant enzymes

pET21a-hemA, pET21a-R40G and pET21a-R365K mutant plasmids are respectively transformed into E.coli BL21 (DE 3), and recombinant strains BL21 (DE 3)/pET 21a-hemA, BL21 (DE 3)/pET 21a-R40G, BL (DE 3)/pET 21a-R365K are obtained and are used for expression and enzymatic property detection of different enzymes.

The single colonies of the recombinant bacteria were inoculated into 5mL of LB liquid medium containing 100. Mu.g/mL of ampicillin, and cultured at 37 ℃ and 220rpm for 12 hours. The cells were transferred to a 500mL Erlenmeyer flask containing 100mL of LB liquid medium containing 100. Mu.g/mL of ampicillin, and cultured at 37 ℃ and OD at 220rpm ₆₀₀ When the concentration is 0.6-0.8, IPTG with the final concentration of 0.1mM is added, and cells are collected and stored at-80 ℃ after induced culture at 20 ℃ for 22 h. The specific purification steps are as follows:

(1) The cells which had been harvested by centrifugation were resuspended in 10mL Tris-HCl buffer (containing 0.1mM PLP) at-80 ℃;

(2) Cell disruption by ultrasonication: ultrasonic wall breaking conditions: 30% power, total wall breaking time 30min, 2s work and 6s stop;

(3) And (3) purification of the target protein: the cell lysate was centrifuged at 12000rpm for 20min at 4 ℃ and the supernatant transferred to a pre-cooled 15mL centrifuge tube. Adding 600 μ L of supernatant to His SpinTrap columns of GE to bind the target protein to the chromatography medium, washing 3 times, 2 times with 50mM,70mM imidazole in buffer (20 mM sodium phosphate, 0.5M sodium chloride, 50/70mM imidazole, pH 7.4) and then eluting the protein twice with 200 μ L of 500mM imidazole buffer (20 mM sodium phosphate, 0.5M sodium chloride, 500mM imidazole, pH 7.4), collecting the eluates, and repeating once;

(4) Desalting and concentrating the target protein: the eluate containing the target protein was placed in 10kDa ultrafiltration tubes from Millipore, buffer (50 mM Tris-HCl,100mM NaCl, pH 7.5) was added to 4mL scale, and centrifuged at 7,500g for 20min at 4 ℃; discard waste, add buffer again to 4mL mark, repeat until dilution multiple is greater than 1000 (3 times). Transferring the protein solution into a precooled 1.5mL centrifuge tube;

(5) Protein concentration determination was performed using BCA protein quantification kit from Thermo Scientific with reference to the instructions.

And (3) enzyme activity determination: the measurement reaction was carried out in a total volume of 200. Mu.L of 50mM Tris-HCl buffer (pH 7.5 containing 100mM NaCl) and the concentrations of the respective components of the reaction solution in the enzyme reaction system are shown in Table 2. 20uL of enzyme with the concentration of 20 mug/mL is added into an enzyme reaction system, and 100 uL of 10 percent trichloroacetic acid solution is added into the system to stop the reaction after the oscillation reaction for 6min at 37 ℃ in a metal bath. Then, the amount of ALA produced in the enzyme reaction system was measured. The detection of ALA is described in the materials and methods section. The unit of enzyme activity U is defined as: the amount of enzyme required to produce 1. Mu. Mol ALA per minute at 37 ℃.

TABLE 2 measurement of the concentration of each component in the reaction System for ALA synthetase Activity

Components	Volume of addition
		Glycine (1M)	40μL
Succinyl coenzyme A (10 mM)	4μL
		Pyridoxal phosphate (10 mM)	2μL
ALA synthetase (20. Mu.g/mL)	20μL
		Tris-HCl (50mM, pH7.5, containing 100mM NaCl)	134μL

Stability assay (stability was characterized using one hour residual enzyme activity at 37 ℃): after diluting ALA synthetase to 20. Mu.g/mL with 50mM Tris-HCl buffer (pH 7.5, containing 100mM NaCl,0.1mM PLP), the remaining enzyme activity was measured as described above by incubating in a water bath at 37 ℃ for one hour.

Measurement of ability to release feedback inhibition of heme: adding heme with the final concentration of 2.5 mu M into a reaction system, measuring the residual enzyme activity according to the method, and comparing the enzyme activity with the enzyme activity without heme addition to characterize the feedback inhibition capability of ALA synthetase mutant enzymolysis for removing heme.

TABLE 3 pure enzyme activity, stability and DeHerubin feedback inhibition of ALA synthetase mutants

Example 3 use of ALA synthetase mutant enzymes in ALA Synthesis

Will be at the topThe single colony of the recombinant strain was inoculated into 5mL of LB liquid medium containing 100. Mu.g/mL of ampicillin, and cultured at 37 ℃ and 220rpm for 12 hours. Transferring into a 250mL triangular flask containing 50mL fermentation medium according to initial OD of 0.05, culturing at 37 deg.C and 220rpm for 3h, adding IPTG with final concentration of 0.05mM, inducing and culturing for 24h, collecting fermentation liquid, and detecting ALA concentration. The formula of the shake flask fermentation medium is as follows: 15g/L glucose, 2.0g/L yeast powder and Na ₂ HPO ₄ ·12H ₂ O 17.1g/L，KH ₂ PO ₄ 3.0g/L，NaCl 0.5g/L，NH ₄ Cl 1.0g/L，MgSO ₄ 2.0mM，CaCl ₂ 0.1mM, glycine 4g/L, pH adjusted to 7.0. Ampicillin was at a final concentration of 100. Mu.g/mL. Detection of ALA and glucose analysis methods are described in the materials and methods section. The fermentation results of the recombinant bacteria are shown in the table 4,2 mutants, and the corresponding yield is improved by 10% compared with that of the control strain.

TABLE 4 influence of ALA synthetase mutant enzymes on ALA Synthesis

Different strains of bacteria	Relative ALA yield
		HemA	1.0
R40G	1.1
		R365K	1.1

Example 4 construction of combinatorial mutant enzyme vectors

The same procedure as in example 1 was used, with the primers shown in Table 5, and the individual mutants were constructed on the basis of the single mutantsDouble mutation is established. An R40G/C75A double-mutation expression plasmid is constructed on the basis of the R40G mutant and is named as pET21a-R40G/C75A. An R365K/C75A double-mutation expression plasmid is constructed on the basis of the R365K mutant and is named as pET21a-R365K/C75A. At the same time, the Stratagene series Quik is utilized

XL-II site-directed mutagenesis kit, using constructed pZWA1 (construction process refer to Rao Deming, etc., biotechnology report, 2017,33 (1): 148-156) plasmid as template, adopting primers in Table 5 to perform PCR amplification, mutating arginine (R) at 365 th position of HemA into lysine (K), and the obtained plasmid expressing mutants is named as pEC-XK99E-R365K. PCR amplification was performed on the basis of the R365K mutant using the primers in Table 1 and Table 5 to construct H29R/R365 3238 zxft 3240G/R365K and A44P/R365K double mutation expression plasmids, named pEC-XK99E-H29R/R365K, pEC-XK99E-R40G/R365K and pEC-XK99E-A44P/R365K, respectively. The above plasmid was verified by sequencing by Jin Weizhi.

TABLE 5 primer sequences

Primer name	Sequence numbering	Primer sequence (5 '-3')
			C75A-F	SEQ ID NO:6	GACAGCGCCGGCGCCGGCGCCGGCGGCAC
C75A-R	SEQ ID NO:7	GCCGGCGCCGGCGCTGTCCAGCGCCTCGTG
			H29R-F	SEQ ID NO:8	GCTGATCTGGAACGTCGTGCCGGCTCGTTCCCG
H29R-R	SEQ ID NO:9	CGGGAACGAGCCGGCACGACGTTCCAGATCAGC
			A44P-F	SEQ ID NO:10	CACCGGCCTGAGGGCCCGGGCGATGTGACGGTG
A44P-R	SEQ ID NO:11	CACCGTCACATCGCCCGGGCCCTCAGGCCGGTG

Example 5 investigation of enzyme Activity Properties of combination mutant ALA synthetase and applications in ALA Synthesis

In order to verify the performance of over-expression combined mutant ALA synthetase and the influence on ALA synthesis, pET21a-R40G/C75A and pET21a-R365K/C75A in the vector are respectively transformed into E.coli BL21 (DE 3) strain. The transformant is coated with an ampicillin resistant plate, after overnight culture, positive clones are picked out and plasmids are extracted for verification, and recombinant bacteria BL21 (DE 3)/pET 21a-R40G/C75A and BL21 (DE 3)/pET 21a-R365K/C75A are respectively obtained. The engineered strain was verified to release heme feedback inhibition according to the method of example 2, and the final test data are shown in table 6. Meanwhile, all the engineering bacteria and the reference adopt the same shake flask fermentation system in the example 3 to evaluate the performance of the engineering bacteria, and the ALA yield in the final solution is shown in the table 7. Compared with the strain expressing the wild type HemA, the yield of the R40G/C75A mutant is 1.3 times that of the wild type, and the yield of the R365K/C75A mutant is 1.4 times that of the wild type.

TABLE 6 ability of combination mutant ALA synthetic enzymatic hydrolysis to remove blood red feedback inhibition

TABLE 7 Effect of combinatorial mutant ALA synthetases on ALA Synthesis

The influence of combined mutant ALA synthetase on ALA synthesis in Corynebacterium glutamicum is verified, and pEC-XK99E-H29R/R365K, pEC-XK99E-R40G/R365K and pEC-XK99E-A44P/R365K in the vectors are respectively transferred into C.glutamicum ATCC 13032 strain. The transformation products are coated on a kanamycin-resistant plate, positive clones are picked after overnight culture, plasmids are extracted for verification, and recombinant bacteria 13032/pEC-XK99E-H29R/R365K, 13032/pEC-XK99E-R40G/R365K and 13032/pEC-XK99E-A44P/R365K are obtained respectively.

The single colony of the recombinant strain is inoculated into 5mL of liquid culture medium (glucose 20g/L, naCl 10g/L, peptone 10g/L and yeast powder 5 g/L) containing 50 mu g/mL kanamycin, and cultured at 30 ℃ and 200rpm for 12h. 50mL of fermentation medium (Na) was transferred according to an initial OD of 0.5 ₂ HPO ₄ ·12H ₂ O 17.1g/L、KH ₂ PO ₄ 3.0g/L、NH ₄ Cl 1.0g/L, naCl 0.5.5 g/L, yeast powder 2g/L, mgSO ₄ 2mM、CaCl ₂ 0.1mM, 50g/L glucose, 4g/L glycine, and, if necessary, 50. Mu.g/mL kanamycin) at 30 ℃ at 220rpm for 3 hours, adding IPTG having a final concentration of 0.05mM, inducing culture for 24 hours, collecting the fermentation broth, and measuring the ALA concentration. Detection of ALA and glucose analysis methods are described in the materials and methods section.

The results of shake flask fermentation are shown in Table 8, and compared with the expression of wild-type RP-HemA, the yield of H29R/R365K mutant is 1.17 times that of wild-type, the yield of R40G/R365K mutant is 1.13 times that of wild-type, and the yield of A44P/R365K mutant is 1.13 times that of wild-type.

TABLE 8 Effect of combination mutant ALA synthetases on ALA Synthesis

ALA synthetase	Relative yield
		HemA	1.00
H29R/R365K	1.17
		R40G/R365K	1.13
A44P/R365K	1.13

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> 5-aminolevulinic acid synthase mutant, host cell and application thereof

<130> P2021-0562

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 403

<212> PRT

<213> Rhodopseudomonas palustris (Rhodopseudomonas palustris)

<400> 1

Met Asn Tyr Glu Ala Tyr Phe Arg Arg Gln Leu Asp Gly Leu His Arg

1 5 10 15

Glu Gly Arg Tyr Arg Val Phe Ala Asp Leu Glu Arg His Ala Gly Ser

20 25 30

Phe Pro Arg Ala Thr His His Arg Pro Glu Gly Ala Gly Asp Val Thr

35 40 45

Val Trp Cys Ser Asn Asp Tyr Leu Gly Met Gly Gln His Pro Ala Val

50 55 60

Leu Thr Ala Met His Glu Ala Leu Asp Ser Cys Gly Ala Gly Ala Gly

65 70 75 80

Gly Thr Arg Asn Ile Ala Gly Thr Asn His Tyr His Val Leu Leu Glu

85 90 95

Gln Glu Leu Ala Ala Leu His Gly Lys Glu Ser Ala Leu Leu Phe Thr

100 105 110

Ser Gly Tyr Val Ser Asn Trp Ala Ser Leu Ser Thr Leu Ala Ser Arg

115 120 125

Met Pro Gly Cys Val Ile Leu Ser Asp Glu Leu Asn His Ala Ser Met

130 135 140

Ile Glu Gly Ile Arg His Ser Arg Ser Glu Thr Arg Ile Phe Ala His

145 150 155 160

Asn Asp Pro Arg Asp Leu Glu Arg Lys Leu Ala Asp Leu Asp Pro His

165 170 175

Ala Pro Lys Leu Val Ala Phe Glu Ser Val Tyr Ser Met Asp Gly Asp

180 185 190

Ile Ala Pro Ile Ala Glu Ile Cys Asp Val Ala Asp Ala His Asn Ala

195 200 205

Met Thr Tyr Leu Asp Glu Val His Gly Val Gly Leu Tyr Gly Pro Asn

210 215 220

Gly Gly Gly Ile Ala Asp Arg Glu Gly Ile Ser His Arg Leu Thr Ile

225 230 235 240

Ile Glu Gly Thr Leu Ala Lys Ala Phe Gly Val Val Gly Gly Tyr Ile

245 250 255

Ala Gly Ser Ser Ala Val Cys Asp Phe Val Arg Ser Phe Ala Ser Gly

260 265 270

Phe Ile Phe Ser Thr Ser Pro Pro Pro Ala Val Ala Ala Gly Ala Leu

275 280 285

Ala Ser Ile Arg His Leu Arg Ala Ser Ser Ala Glu Arg Glu Arg His

290 295 300

Gln Asp Arg Val Ala Arg Leu Arg Ala Arg Leu Asp Gln Ala Gly Val

305 310 315 320

Ala His Met Pro Asn Pro Ser His Ile Val Pro Val Met Val Gly Asp

325 330 335

Ala Ala Leu Cys Lys Gln Ile Ser Asp Glu Leu Ile Ser Arg Tyr Gly

340 345 350

Ile Tyr Val Gln Pro Ile Asn Tyr Pro Thr Val Pro Arg Gly Thr Glu

355 360 365

Arg Leu Arg Ile Thr Pro Ser Pro Gln His Thr Asp Ala Asp Ile Glu

370 375 380

His Leu Val Gln Ala Leu Ser Glu Ile Trp Thr Arg Val Gly Leu Ala

385 390 395 400

Lys Ala Ala

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 2

caccacggtc ctgagggcgc cggcgatgtg ac 32

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 3

ctcaggaccg tggtgcgtgg cgc 23

<210> 4

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 4

gtgccgaaag gcaccgagcg ccttcggatc ac 32

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 5

cggtgccttt cggcacggtc ggatagttga tc 32

<210> 6

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 6

gacagcgccg gcgccggcgc cggcggcac 29

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 7

gccggcgccg gcgctgtcca gcgcctcgtg 30

<210> 8

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 8

gctgatctgg aacgtcgtgc cggctcgttc ccg 33

<210> 9

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 9

cgggaacgag ccggcacgac gttccagatc agc 33

<210> 10

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 10

caccggcctg agggcccggg cgatgtgacg gtg 33

<210> 11

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 11

caccgtcaca tcgcccgggc cctcaggccg gtg 33

Claims (10)

1. An ALA synthetase, characterized by:

(a) The amino acid residue of the amino acid sequence of the ALA synthetase at the 365 th site corresponding to the amino acid sequence shown in SEQ ID NO. 1 is lysine, or the amino acid residue at the 365 th site is lysine and the amino acid residue at the 40 th site is glycine;

or

(b) The amino acid residue of the amino acid sequence of the ALA synthetase at the 365 th site corresponding to the amino acid sequence shown in SEQ ID NO. 1 is lysine, and the amino acid residue at the 29 th site is arginine, or the 44 th site is proline, or the 75 th site is alanine.

2. The nucleic acid molecule encoding ALA synthetase of claim 1.

3. An expression vector comprising the ALA synthetase encoding nucleic acid molecule of claim 1.

4.A host cell comprising the ALA synthase of claim 1,

the host cell is Escherichia coli (Escherichia coli) Glutamic acid Corynebacterium (A)Corynebacterium glutamicum) Rhodobacter sphaeroides (A), (B), (C)Rhodobacter sphaeroides) Rhodopseudomonas palustris (A.palustris)Rhodopseudomonas palustris)。

5. The host cell of claim 4, wherein the host cell is E.coli or C.glutamicum.

6. Use of the ALA synthetase of claim 1, or the encoding nucleic acid molecule of claim 2, or the expression vector of claim 3, or the host cell of claim 4 or 5 for the production of ALA.

7. A process for preparing ALA, the process comprising the steps of:

a. culturing the host cell of claim 4 or 5 to produce ALA; and

b. optionally separating the ALA produced in step a from the culture broth.

8. A process for preparing ALA, the process comprising the steps of:

a. catalytically synthesizing ALA using the ALA synthetase of claim 1; and

b. optionally, ALA is isolated from the above reaction system.

9. A process for the preparation of ALA synthetase as claimed in claim 1, the process comprising the steps of:

a. obtaining a coding sequence for the ALA synthetase of claim 1;

b. transfecting the coding sequence obtained from a directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;

d. isolating ALA synthase produced by said host cells from the culture system obtained in step c.

10. A method of engineering an ALA synthetase so as to increase its activity, the method comprising the steps of:

a. comparing the amino acid sequence of ALA synthetase to be modified with the amino acid sequence shown in SEQ ID NO. 1; and

b. modifying the coding sequence of the ALA synthetase to be modified, so that the amino acid residue at the 365 th site of the amino acid sequence shown in SEQ ID NO. 1 in the coded amino acid sequence is lysine, or the amino acid residue at the 365 th site is lysine and the amino acid residue at the 40 th site is glycine;

or

The amino acid residue corresponding to the 365 th site of the amino acid sequence shown in SEQ ID NO. 1 is lysine, and the amino acid residue at the 29 th site is arginine or the 44 th site is proline or the 75 th site is alanine;

c. transfecting the coding sequence obtained in the step b directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

d. culturing the host cell obtained in step c; and

e. isolating ALA synthase produced by said host cells from the culture system obtained in step d.