CN110129294B - Homoserine acetyltransferase mutant and host cell and application thereof - Google Patents

Abstract

The invention provides homoserine acetyltransferase, the amino acid sequence of the homoserine acetyltransferase is non-proline at the amino acid residue corresponding to the 250 th position of the amino acid sequence shown in SEQ ID NO. 3, and/or non-isoleucine at the amino acid residue at the 254 th position. The homoserine acetyltransferase of the present invention not only significantly improves the activity, but also removes the feedback inhibition of methionine and SAM, thereby being capable of efficiently producing O-acetylhomoserine, methionine, SAM and other products.

Description

Homoserine acetyltransferase mutant and host cell and application thereof

Technical Field

The invention relates to the field of biotechnology. In particular, the invention relates to homoserine acetyltransferase mutants and their use.

Background

O-acetyl-homoserine (OAH) or O-succinyl-homoserine (OSH) can be hydrolyzed to generate homoserine, and the homoserine can be converted into L-homoserine lactone, gamma-butyrolactone, 1, 4-butanediol and other platform compounds (Journal of Industrial Microbiology & Biotechnology,2014,41(10): 1517-.

Methionine is one of essential amino acids in vivo, is widely used in various fields such as animal feed, food and medicine, and has an annual demand of 160 ten thousand tons. Methionine can also be used as a precursor for the synthesis of lecithin and creatine, and also as a raw material for the synthesis of cysteine and taurine. At present, methionine is widely used as a feed additive in the feed aspects of some livestock such as broiler chickens, pigs, beef cattle and dairy cows. The methionine derivative, S-adenosylmethionine (SAM), is involved as a methyl donor in the synthesis of polyamines, biotin, lipids, etc., which are metabolic intermediates. SAM is useful for preventing lipid accumulation in the liver and arteries, and for treating depression, inflammation, liver disease and muscle pain. Methionine is also involved in the metabolic pathway of glutathione, a major antioxidant in human cells. The lack of methionine in human cells can cause diseases such as uremia and muscle paralysis. In the pharmaceutical preparation, L-methionine is added to a drug for treating liver injury for liver disease treatment. Methionine deficiency significantly upregulates proinflammatory cytokines and fibrosis genes, and the presence of methionine ameliorates these conditions.

As shown in FIG. 1, in microorganisms in which aspartic acid generates aspartate phosphate by the action of aspartokinase and homoserine is then produced by the action of aspartate semialdehyde dehydrogenase and homoserine dehydrogenase, which are important intermediate metabolites in the methionine synthesis pathway of microorganisms, homoserine is converted into OSH (biochemistry.1999Oct 26; 38 (14416-23)) by the action of L-homoserine-O-succinyltransferase in microorganisms of the genera Escherichia (Escherichia), Salmonella and Bacillus (Bacillus), homoserine is converted into OSH (biochemistry.19926; 38 (14416-23)) by the action of L-homoserine-O-acetyltransferase in microorganisms of the genera Corynebacterium (Corynebacterium), Leptospira (Leptospira), Deinococcus (Deinococcus), Pseudomonas (Pseudomonas) and Mycobacterium (Mycobacterium) by L-homoserine-O-acetyltransferase (metX, EC2.3.1.31) into OAH (Journal of Bacteriology, Mar.2002, p.1277-1286). Cysteine is used as a sulfur donor, OSH or OAH generates homocysteine under the action of gamma-Cystathionine Gamma Synthase (CGS) and beta-cystathionine lyase (CBL), and the homocysteine is methylated to generate methionine. In addition, since OSH or OAH can also be reacted directly with methylthio ether to produce methionine under the action of a sulfhydrylase (Journal of Microbiology and Biotechnology,20(8):1196-1203), OAH can also be used as a precursor for producing methionine, Seger developed a method of producing OAH using a microorganism and then enzymatically producing methionine in one step (CN 103397057B).

In microorganisms, metX is the first enzyme of the branched pathway for methionine synthesis, and homoserine, the substrate, is also an intermediate metabolite of the threonine synthesis pathway. It is reported in the literature that most of metX derived from various sources is feedback-inhibited by methionine and SAM, and that metX derived from Corynebacterium glutamicum retains only 25% of its relative enzymatic activity in the presence of 10mmol/L methionine (Journal of Microbiology and Biotechnology,2004,14(2): 373-378). metX is one of the rate limiting steps in the synthesis of OAH and methionine. Korea Hoger company published a method of mutating homoserine O-succinyltransferase activity into metX enzyme activity and applied it to OAH production (CN 103797027A), and Hoger company over-expressed metX from a different source to OAH (CN 101629160B).

In view of the important role of metX in OAH and methionine synthesis, and the fact that metX in the prior art is still unsatisfactory in terms of activity and feedback inhibition release, there is an urgent need in the art for a highly active and feedback-resistant homoserine acetyltransferase.

Disclosure of Invention

The object of the present invention is to provide a homoserine acetyltransferase which has high activity and is resistant to feedback inhibition.

In a first aspect, the present invention provides a homoserine acetyltransferase, the amino acid sequence of which is non-proline at the amino acid residue corresponding to position 250 and/or non-isoleucine at the amino acid residue 254 of the amino acid sequence shown in SEQ ID NO. 3.

In a preferred embodiment, the homoserine acetyltransferase is non-proline at the amino acid residue corresponding to position 250 of the amino acid sequence shown in SEQ ID NO. 3 and non-isoleucine at the amino acid residue at position 254.

In a preferred embodiment, the amino acid sequence of the homoserine acetyltransferase has a homology of 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% with the amino acid sequence shown in SEQ ID NO. 3.

In a preferred embodiment, the homoserine acetyltransferase is derived from Leptospira meyeri.

In a preferred embodiment, the homoserine acetyltransferase is:

a. 3, and the 250 th amino acid residue is non-proline, and/or the 254 th amino acid residue is non-isoleucine;

b. a homoserine acetyltransferase derived from a) having a sequence formed by substitution, deletion or addition of one or several amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, most preferably 1 amino acid residues, of the sequence defined in a), and having substantially the function of the homoserine acetyltransferase defined in a); or

c. A homoserine acetyltransferase derived from a) having the sequence defined in a), a sequence formed by deletion or addition, preferably addition, of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue at either end of the sequence defined in a), and having substantially the function of the homoserine acetyltransferase defined in a).

In a preferred embodiment, the homoserine acetyltransferase is selected from the group consisting of the amino acid residues at position 250 of the amino acid sequence shown in SEQ ID NO. 3: ser, Thr, Lys, Arg, Gln, Asn and Glu, preferably Ser or Lys;

the amino acid residue at position 254 corresponding to the amino acid sequence shown in SEQ ID NO. 3 is selected from one of the following amino acids: asn, Gln, His, Arg, Ala, Val, Leu, Asp, Glu, Lys, preferably Asn or Ala or Asp or Lys.

In a preferred embodiment, the homoserine acetyltransferase is:

a. has an amino acid sequence shown as SEQ ID NO. 3, and

the amino acid residue at position 250 is selected from one of the following amino acids: ser, Thr, Lys, Arg, Gln, Asn and Glu, preferably Ser or Lys; and/or

The amino acid residue at position 254 is selected from one of the following amino acids: asn, Gln, His, Arg, Ala, Val, Leu, Asp, Glu, Lys, preferably Asn or Ala or Asp or Lys;

or

b. A homoserine acetyltransferase derived from a which comprises a sequence formed by substitution, deletion or addition of one or several amino acid residues, preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, still more preferably 1 to 3, most preferably 1 amino acid residues, of the sequence defined in (a), and which has substantially the function of the homoserine acetyltransferase defined in a;

or

c. A homoserine acetyltransferase derived from a) having the sequence defined in a), a sequence formed by deletion or addition, preferably addition, of one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue at either end of the sequence defined in a), and having substantially the function of the homoserine acetyltransferase defined in a).

In a preferred embodiment, the amino acid sequence of the homoserine acetyltransferase is shown in SEQ ID NO 5, 7, 27, 28, 29, 30 or 31.

In a preferred embodiment, the homoserine acetyltransferase is resistant to feedback inhibition by methionine or SAM.

In a preferred embodiment, the homoserine acetyltransferase retains at least 80% or more of its relative enzyme activity in the presence of methionine at a concentration of 10 mM/L; or

In the presence of SAM with the concentration of 10mM/L, the homoserine acetyltransferase at least retains more than 60% of relative enzyme activity.

In a second aspect, the present invention provides a gene encoding the homoserine acetyltransferase of the first aspect.

In a third aspect, the present invention provides an expression vector comprising the encoding gene of the second aspect.

In a fourth aspect, the present invention provides a host cell comprising the homoserine acetyltransferase of the first aspect.

In a preferred embodiment, the host cell comprises the expression vector of the third aspect or has integrated into its genome the coding gene of the second aspect.

In a preferred embodiment, the host cell is from the genus Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium sp.), Bacillus (Bacillus), Serratia (Serratia) or Vibrio (Vibrio).

In a further preferred embodiment, the host cell is escherichia coli (e.coli) or Corynebacterium glutamicum (Corynebacterium glutamicum).

In a fifth aspect, the invention provides the use of a homoserine acetyltransferase of the first aspect, or a gene encoding the same of the second aspect, or an expression vector of the third aspect, or a host cell of the fourth aspect, for the production of O-acetylhomoserine, methionine or SAM.

In a sixth aspect, the present invention provides a method for preparing O-acetylhomoserine, methionine or SAM, the method comprising the steps of:

a. culturing the host cell of the fourth aspect to produce O-acetylhomoserine, methionine or SAM; and

b. optionally isolating O-acetylhomoserine, methionine or SAM from the culture broth.

In a preferred embodiment, the process is carried out at 28 ℃ to 40 ℃, more preferably at 30 ℃ or 37 ℃.

In a seventh aspect, the present invention provides a method for preparing O-acetylhomoserine, methionine or SAM, the method comprising the steps of:

a. catalyzing the production of O-acetylhomoserine, methionine or SAM from homoserine using the homoserine acetyltransferase of the first aspect; and

b. optionally, O-acetylhomoserine, methionine or SAM is isolated from the above reaction system.

In an eighth aspect, the present invention provides a method for producing the homoserine acetyltransferase of the first aspect, the method comprising the steps of:

a. modifying the coding sequence of the amino acid sequence shown in SEQ ID NO. 3, so that the amino acid residue corresponding to the 250 th position of the amino acid sequence shown in SEQ ID NO. 3 in the coded amino acid sequence is non-proline, and/or the amino acid residue at the 254 th position is non-isoleucine;

b. transfecting the coding sequence obtained from a directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;

d. isolating homoserine acetyltransferase produced by said host cell from the culture system obtained in step c.

In a preferred embodiment, the amino acid residue corresponding to position 250 of the amino acid sequence shown in SEQ ID NO. 3 is selected from one of the following amino acids: ser, Thr, Lys, Arg, Gln, Asn and Glu, preferably Ser or Lys;

the amino acid residue corresponding to position 254 of the amino acid sequence shown in SEQ ID NO. 3 is selected from one of the following amino acids: asn, Gln, His, Arg, Ala, Val, Leu, Asp, Glu, Lys, preferably Asn or Ala or Asp or Lys.

In a preferred embodiment, the method further comprises determining the activity of the resulting homoserine acetyltransferase and the ability to release methionine or SAM feedback inhibition.

In a ninth aspect, the present invention provides a method of engineering a wild-type homoserine acetyltransferase so as to increase its activity and relieve methionine or SAM feedback inhibition, said method comprising the steps of:

a. comparing the amino acid sequence of the wild-type homoserine acetyltransferase with the amino acid sequence shown in SEQ ID NO. 3; and

b. modifying the coding sequence of the wild-type homoserine acetyltransferase so that the amino acid residue corresponding to the 250 th amino acid residue of the amino acid sequence shown in SEQ ID NO. 3 in the coded amino acid sequence is non-proline, and/or the amino acid residue at the 254 th amino acid residue is non-isoleucine;

c. transfecting the coding sequence obtained in the step b directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

d. culturing the resulting host cell;

e. isolating homoserine acetyltransferase produced by said host cell from the culture system obtained in step d.

In a preferred embodiment, the amino acid residue corresponding to position 250 of the amino acid sequence shown in SEQ ID NO. 3 is selected from one of the following amino acids: ser, Thr, Lys, Arg, Gln, Asn and Glu, preferably Ser or Lys;

the amino acid residue corresponding to position 254 of the amino acid sequence shown in SEQ ID NO. 3 is selected from one of the following amino acids: asn, Gln, His, Arg, Ala, Val, Leu, Asp, Glu, Lys, preferably Asn or Ala or Asp or Lys.

In a preferred embodiment, the method further comprises determining the ability of the homoserine acetyltransferase to relieve methionine or SAM feedback inhibition.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows methionine metabolism pathway in a microorganism; wherein the solid arrows represent one-step reactions, the dotted arrows represent multi-step reactions, and the solid boxes represent methionine metabolic pathways of microorganisms such as Escherichia, Salmonella, and Bacillus through OSH; the dotted line box represents the methionine metabolic pathway of the microorganism through OAH, and represents microorganisms such as Corynebacterium, Leptospira, deinococcus, Pseudomonas and Mycobacterium.

FIG. 2 shows a schematic representation of plasmid pET-LmeX.

Figure 3 shows the enzyme activity inhibition of LmetX and its mutants by different concentrations of methionine and SAM; wherein A shows an inhibitory effect of methionine; b shows inhibition of SAM.

Figure 4 shows the different mutants obtained by point mutation of LmetX and their relative enzymatic activities; wherein the lower part of the horizontal line in the abscissa represents the site where mutation occurs, the upper part of the horizontal line represents the amino acid after mutation, and None represents no mutation, corresponding to wild-type LmeX.

Detailed Description

The inventor has conducted extensive and intensive research and unexpectedly found that by genetically modifying the 250 th position and/or 254 th position of the homoserine acetyltransferase derived from leptospirillum meyeri, the obtained homoserine acetyltransferase mutant not only has significantly improved enzymatic activity, but also has significantly improved tolerance to feedback inhibition of methionine and SAM, so that the homoserine acetyltransferase mutant can be used for efficiently producing products such as O-acetylhomoserine, methionine, SAM and the like. The present invention has been completed based on this finding.

Homoserine acetyltransferase of the present invention

The terms "homoserine acetyltransferase of the present invention" and "polypeptide of the present invention" as used herein are used interchangeably and have the meaning commonly understood by those of ordinary skill in the art. The homoserine acetyltransferase of the present invention has the activity of catalyzing homoserine to produce O-acetylhomoserine.

The homoserine acetyltransferase is obtained by mutating an amino acid sequence shown in SEQ ID NO. 3, and the obtained mutant has excellent activity and can remarkably remove the feedback inhibition of methionine or SAM.

Specifically, the homoserine acetyltransferase of the present invention has an amino acid sequence in which the amino acid residue at the 250 th position corresponding to the amino acid sequence shown in SEQ ID NO. 3 is mutated to non-proline, and/or the amino acid residue at the 254 th position is mutated to non-isoleucine.

It is known to those skilled in the art that for mutations in the wild-type polypeptide it is more important to find a site that achieves the desired purpose. Thus, based on the teaching of the present invention, the skilled person will mutate the amino acid residues at position 250 and/or 254 of the amino acid sequence shown in SEQ ID NO. 3 or the amino acid residues in an amino acid sequence corresponding to position 250 and/or 254 of the amino acid sequence shown in SEQ ID NO. 3 and test the mutants for the relevant activity. In a specific embodiment, the homoserine acetyltransferase of the present invention may be mutated to (but not limited to) the amino acid residue corresponding to position 250 of the amino acid sequence shown in SEQ ID NO: 3: ser, Thr, Lys, Arg, Gln, Asn and Glu, preferably Ser or Lys; the amino acid residue at position 254 corresponding to the amino acid sequence shown in SEQ ID NO:3 may be mutated to (but is not limited to): asn, Gln, His, Arg, Ala, Val, Leu, Asp, Glu, Lys, preferably Asn or Ala or Asp or Lys.

Furthermore, it will be appreciated by those of ordinary skill in The art that The alteration of a small number of amino acid residues in certain regions, e.g., non-critical regions, of a polypeptide does not substantially alter The biological activity, e.g., The sequence resulting from The appropriate substitution of certain amino acids does not affect The activity (see Watson et al, Molecular Biology of The Gene, fourth edition, 1987, The Benjamin/Cummings pub. Co. P224). Thus, one of ordinary skill in the art would be able to effect such a substitution and ensure that the resulting molecule still possesses the desired biological activity.

It is therefore apparent that further mutations may be made to the homoserine acetyltransferase of the present invention to obtain further mutants still possessing the function and activity of homoserine acetyltransferase. For example, it is well known to those skilled in the art that the addition or subtraction of several amino acid residues, e.g., preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residue, at either end of a polypeptide does not affect the function of the resulting mutant. For example, for ease of purification, the skilled artisan will often have a 6 × His tag on either end of the resulting protein, which has the same function as a protein without the 6 × His tag.

Thus, the invention shall include conservative mutants of the homoserine acetyltransferase of the invention. These conservative mutants can be generated by amino acid substitution, for example, as shown in the following table.

The present invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

Thus, as used herein, "comprising," "having," or "including" includes "comprising," "consisting essentially of … …," "consisting essentially of … …," and "consisting of … …"; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

"corresponds to"

The term "corresponding to" as used herein has the meaning commonly understood by a person of ordinary skill in the art. Specifically, "corresponding to" means the position of one sequence corresponding to a specified position in the other sequence after alignment of the two sequences by homology or sequence identity. Thus, in the case of "amino acid residue corresponding to position 250 of the amino acid sequence shown in SEQ ID NO. 3", if a 6 XHis tag is added to one end of the amino acid sequence shown in SEQ ID NO. 3, position 250 of the resulting mutant corresponding to the amino acid sequence shown in SEQ ID NO. 3 may be position 256.

In a specific embodiment, the homology or sequence identity may be 90% or more, preferably 95% or more, more preferably 96%, 97%, 98%, 99% homology.

Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), Lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic Projects (Biocomputing: information and Genome Projects), Smith, d.w. eds, academic press, new york, 1993; computer Analysis of Sequence Data (Computer Analysis of Sequence Data), first part, Griffin, a.m. and Griffin, h.g. eds, Humana Press, new jersey, 1994; sequence Analysis in Molecular Biology (Sequence Analysis in Molecular Biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis Primer), Gribskov, m. and Devereux, j. eds M Stockton Press, New York, 1991 and Carllo, h. and Lipman, d.s., SIAM j.applied Math., 48:1073 (1988). The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). BLASTX programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md.20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Host cell

The term "host cell" as used herein has the meaning commonly understood by a person of ordinary skill in the art, i.e., a host cell capable of producing the homoserine acetyltransferase of the present invention. In other words, the present invention may utilize any host cell as long as the homoserine acetyltransferase of the present invention can be expressed in the host cell.

For example, host cells suitable for use in the present invention are derived from, but not limited to, the genera Escherichia (Escherichia), Corynebacterium (Corynebacterium), Brevibacterium (Brevibacterium sp.), Bacillus (Bacillus), Serratia (Serratia), or Vibrio (Vibrio).

In a further preferred embodiment, the host cell is escherichia coli (e.coli) or Corynebacterium glutamicum (Corynebacterium glutamicum).

Relieving feedback inhibition of methionine or SAM

It will be understood by those skilled in the art that the term "de-methionine or SAM feedback inhibition" as used herein refers to an enzyme that is originally feedback inhibited by methionine or SAM and which has been engineered to exhibit a reduced degree of inhibition by methionine or SAM. This reduction was obtained by comparing the degree of inhibition of both enzymes at the same methionine or SAM concentration. "relieving methionine or SAM feedback inhibition" encompasses partial to complete relief of feedback inhibition. The degree of inhibition refers to the ratio of loss (i.e., inhibition) of homoserine acetyltransferase activity in the presence of a certain concentration of methionine or SAM, as compared to the absence of methionine or SAM. Under such conditions, the ratio of the homoserine acetyltransferase activity to be retained is called as the enzyme activity residual ratio or the enzyme activity retention ratio or the relative enzyme activity, because:

the ratio of enzyme activity loss and enzyme activity residual ratio is 100 percent,

therefore, the degree of inhibition is often expressed by the ratio of the enzyme activity survival. The higher the ratio of the enzyme activity residual, the lower the inhibition degree. Accordingly, "de-methionine or SAM feedback inhibition" is also typically characterized by a comparison of the ratio of the residual enzyme activities of the two enzymes before and after the modification.

In a specific embodiment, the homoserine acetyltransferase retains at least 80% or more of its relative enzyme activity in the presence of methionine at a concentration of 10 mM/L; alternatively, in the presence of SAM at a concentration of 10mM/L, the homoserine acetyltransferase retains at least 60% of its relative enzyme activity.

Immobilized enzyme

The term "immobilized enzyme" as used herein has the meaning conventionally understood by a person of ordinary skill in the art. Specifically, the term means that a water-soluble enzyme is physically or chemically treated to bind the enzyme to a water-insoluble macromolecular carrier or entrap the enzyme therein, so that the enzyme forms microcapsules of a soluble gel or semi-permeable membrane in water to cause a decrease in fluidity.

The immobilized enzyme still has enzymatic activity and acts on the substrate in a solid phase in the catalytic reaction. After being immobilized, the enzyme has increased stability, is easy to separate from the reaction system, is easy to control and can be used repeatedly. Is convenient for transportation and storage and is beneficial to automatic production. The immobilized enzyme is an enzyme application technology developed in more than ten years, and has attractive application prospects in the aspects of industrial production, chemical analysis, medicine and the like.

It is not difficult for those skilled in the art to process the homoserine acetyltransferase of the present invention into an immobilized enzyme in view of the teachings herein, thereby catalyzing the production of O-acetylhomoserine from homoserine and thus efficiently producing methionine, SAM, etc.

Applications and advantages of the invention

1. The homoserine acetyltransferase of the present invention can be industrially used to produce O-acetylhomoserine and products such as methionine, SAM, etc.;

2. the homoserine acetyltransferase disclosed by the invention has high activity, can effectively remove feedback inhibition of methionine and SAM, and has a wide industrial application prospect;

3. the invention provides a point mutation site of homoserine acetyltransferase to be modified, the mutation is not in the active center of enzyme, and the mutation of the site can effectively improve the enzyme activity of homoserine acetyltransferase of enzyme to be modified and remove the feedback inhibition of methionine and SAM.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Examples

Example 1 construction of LmeX and its mutant expression vectors and strains

The gene is completely synthesized according to the gene sequence (SEQ ID NO:1) of leptospira mairei LmeX, and is subjected to codon optimization according to the codon preference of escherichia coli, and the synthesized gene sequence after optimization is shown as SEQ ID NO:2 (the gene synthesis is completed by Suzhou Jinwei Biotechnology Co., Ltd., China). The sequence of the LmeX protein is shown in SEQ ID NO. 3. The inventor obtains two mutants in the process of utilizing optimized LmeX gene (SEQ ID NO:2) to carry out evolution, wherein the gene sequence of the first mutant LmeX-T1 is shown as SEQ ID NO:4, the protein sequence of the first mutant is shown as SEQ ID NO:5, the 250 th proline of the SEQ ID NO:5 is mutated into serine (P250S) compared with the SEQ ID NO:3, the gene sequence of the second mutant LmeX-T2 is shown as SEQ ID NO:6, the protein sequence of the second mutant is shown as SEQ ID NO:7, and the 254 th isoleucine of the SEQ ID NO:7 is mutated into asparagine (I254N) compared with the SEQ ID NO: 3.

Using an expression vector pET28a commonly used by escherichia coli as a template, and amplifying a plasmid skeleton by using primers pET-F1 and pET-R1 shown in the table 1; genes shown in sequences SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 are taken as templates, LmeX-T1 and LmeX-T1 genes are amplified respectively by using primers LmeX-F1 and LmeX-R1 shown in Table 1, and homologous fragments are arranged between the amplified plasmid skeleton and the LmeX and mutant gene fragments thereof. Thus, LmeX and its mutant gene fragments were ligated to pET28a vector using a One-Step seamless Cloning Kit (Clon ExpressTM II One Step Cloning Kit, Vazyme Biotech Co., Ltd.) to obtain plasmids pET-LmeX (shown in FIG. 2), pET-LmeX-T1, and pET-LmeX-T2, respectively. Plasmids are respectively transformed into escherichia coli BL21(DE3) to obtain LmeX and mutant expression strains BL21 (pET-LmeX), BL21 (pET-LmeX-T1) and BL21 (pET-LmeX-T2), and the LmeX protein expressed by the strains is provided with histidine tags at the N end and can be conveniently purified by using a nickel column.

TABLE 1 primers used for construction of LmeX and its mutant expression vectors

Primer and method for producing the same	Sequence of
		pET-F1	TGACTGGTGGACAGCAAATGGGTCGCGGATC(SEQ ID NO:8)
pET-R1	CGGCACCAGGCCGCTGCTGTGATGATGATG(SEQ ID NO:9)
		LmetX-F1	AGCGGCCTGGTGCCGATGCCTACCTCTGAGCAGAAC(SEQ ID NO:10)
LmetX-R1	GCTGTCCACCAGTCATTACAGAAAAACGCCTTCGTCGG(SEQ ID NO:11)

Example 2 characterization of LmeX and its mutant enzyme Activity

1. Enzyme activity assay

The strains BL21 (pET-LmeX), BL21 (pET-LmeX-T1) and BL21 (pET-LmeX-T2) were cultured in LB medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L), kanamycin was added to the culture medium to a final concentration of 50mg/L, and the culture was carried out at 37 ℃ for 10 hours, followed by 1% inoculationThe seed amount was transferred to a fresh LB plus kanamycin medium, cultured at 37 ℃ for 2 hours, added with IPTG at a final concentration of 0.5mM, and cultured at 20 ℃ for 15 hours. The cells were washed once with 100mM phosphate buffer pH 7.5, resuspended, sonicated, the disruption was centrifuged at 7500rpm for 5min, and the supernatant was collected to obtain a crude protein solution, which was purified using His SpinTrap columns (available from GE, Cat. No. 28-4013-53), according to the protocol. Protein quantification was performed using BCA protein quantification kit from ThermoFisher. The enzyme activity is measured by using a 5,5' -dithiobis (2-nitrobenzoic acid) (DTNB color developing agent) color development method, and the measuring method comprises the following steps: homoserine, acetyl-CoA and enzyme solutions with different concentrations were added to 100mM phosphate buffer solution with a final volume of 150ul, and the assay was performed after reaction at 30 ℃ and pH 7.5 for different periods of time, as described in the prior art (Journal of Bacteriology 1987.169(8): 3458-3463.). The enzyme activity unit U is defined as: the amount of enzyme required to catalyze the production of 1mmol of CoASH per minute under standard enzymatic reaction conditions is defined as one enzyme activity unit. Km value of LmeX and its mutant to substrate homoserine, maximum rate of reaction Vmax, and K_cat/K_mAs shown in Table 2, it can be seen that the maximum enzyme activity (Vmax) of the mutants LmeX-T1 (P250S) and LmeX-T2 (I254N) is respectively improved by more than 43 times and 13 times compared with the wild enzyme, and K is_cat/K_mThe improvement is more than 37 times and 16 times respectively.

TABLE 2 enzyme kinetic parameters of LmeX and its mutants

2. Influence of inhibitors on enzyme Activity

The enzyme activity assay method described in example 2 was used to detect the inhibitory effect of methionine and SAM on LmeX and its mutants, where the final concentrations of homoserine and acetyl-CoA were 5mmol/L and 1mmol/L, respectively, and different concentrations of methionine or SAM were added to the reaction system. As shown in FIG. 3, the activity of the enzyme is reduced significantly in the presence of low concentration of methionine or SAM, but the activity of the wild-type enzyme is reduced more greatly, and the activity of the enzyme tends to be stable as the concentration of methionine or SAM is increased, but the mutant is inhibited to a lower extent as a whole. Therefore, the mutant can eliminate the inhibition effect of methionine and SAM on enzyme activity to a certain extent, and the inhibition elimination effect is more obvious particularly under the condition of low concentration.

Example 3 Effect of LmeX and its mutants on the production of OAH by strains

The plasmid pSYM-4 (modified from ptrc99A: GenBank Accession NO. U13872, detailed information is shown in the reference: Biotechnology Bulletin 2017,33(9): 1-6; wherein the promoter sequences of thrA and metX genes are both J23110: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC (SEQ ID NO:12), the specific promoter information can refer to the website http:// part.igem.org/Part: BBa _ J23110) as templates, the primers ptrc-F1 and ptrc-R1 in Table 3 are used for PCR amplification, and simultaneously, the primers LmeX-F2 and LmeX-LmR 2 are used for PCR amplification respectively for LmeX and mutant genes corresponding to SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 as templates to obtain LmeX and mutant genes thereof. And carrying out homologous recombination on the different primer amplified fragments by utilizing a one-step seamless cloning kit to obtain a plasmid ptrcAX with thrA and LmetX genes, a plasmid ptrcAX-T1 with thrA and LmetX-T1 genes and a plasmid ptrcAX-T2 with thrA and LmetX-T2 genes. The strains MG1655(ptrcAX), MG1655(ptrcAX-T1) and MG1655(ptrcAX-T2) were obtained by introducing ptrcAX, ptrcAX-T1 and ptrcAX-T2 into E.coli MG1655 by electrotransformation, respectively.

TABLE 3 plasmid construction primers containing thrA and LmeX or their mutant genes

Primer and method for producing the same	Sequence of
		ptrc-F1	GTTCTGCTCAGAGGTAGGCATATGTATATTCTCCTTCTTAA(SEQ ID NO:13)
ptrc-R1	GACGAAGGCGTTTTTCTGTAACCGCTGCAGGCATGCAAGCTT(SEQ ID NO:14)
		LmetX-F2	TTAAGAAGGAGAATATACATATGCCTACCTCTGAGCAGAAC(SEQ ID NO:15)
LmetX-R2	AAGCTTGCATGCCTGCAGCGGTTACAGAAAAACGCCTTCGTC(SEQ ID NO:16)

Strains MG1655(ptrcAX), MG1655(ptrcAX-T1) and MG1655(ptrcAX-T2) were each cultured overnight in LB medium and transferred to a medium containing 20ml of fermentation medium (glucose 30 g/L; yeast powder 6g/L, (NH) in an amount of 1%₄)₂SO₄ 10g/L；KH₂PO₄2 g/L; 80g/L of 3- (N-morpholine) propanesulfonic acid; MgSO (MgSO)₄·7H₂O 0.5g/L；FeSO₄·5H₂O 0.1g/L，MnSO₄·5H₂O0.1 g/L) in a 500ml conical flask, culturing for 40h at 220r/min in a shaking table at 37 ℃, taking out, and measuring the content of OAH in the fermentation liquor by using a liquid chromatograph, wherein the results are shown in Table 4. It can be seen that the LmeX mutants LmeX-T1 (P250S) and LmeX-T2 (I254N) are capable of significantly increasing strain yield.

TABLE 4 Effect of overexpression of LmeX and its mutants on OAH production by the strains

Bacterial strains	MG1655(ptrcAX)	MG1655(ptrcAX-T1)	MG1655(ptrcAX-T2)
				OAH yield (g/L)	0.01±0.00	0.29±0.02	0.18±0.01

Example 4 Effect of LmeX and its mutants on the methionine production of the Strain

The plasmids ptrcAX, ptrcAX-T1 and ptrcAX-T2 are respectively used as templates, and ptrc-F2 and ptrc-R2 sequences in Table 5 are used as primers to carry out PCR amplification, so as to obtain a fragment with a ptrc99A vector fragment, a thrA gene and LmeX or a mutant P250S or I254N gene thereof. MetY-F1 and MetY-R1 in Table 5 were used as primers, and the genome of Corynebacterium glutamicum 13032 was used as a template to amplify the metY protein gene. The metY protein gene was ligated with the fragments amplified with the ptrc-F2 and ptrc-R2 primers, respectively, using a one-step seamless cloning kit to obtain plasmids ptrcAYX, ptrcAYX-T1 and ptrcAYX-T2, respectively, and the plasmids were introduced into E.coli MG1655 by electrotransformation to obtain strains MG1655(ptrcAYX), MG1655(ptrcAYX-T1) and MG1655(ptrcAYX-T2), respectively. MG1655(ptrcAYX), MG1655(ptrcAYX-T1) and MG1655(ptrcAYX-T2) were subjected to fermentation culture by the methods described in example 3, respectively, and after the fermentation was completed, the methionine content in the fermentation liquid was measured by HPLC, and the results are shown in Table 6.

TABLE 5 plasmid construction primers containing thrA, LmeX or mutants thereof, and metY gene thereof

TABLE 6 Effect of over-expression of LmeX and its mutants on methionine production by the strains

Bacterial strains	MG1655(ptrcAYX)	MG1655(ptrcAYX-T1)	MG1655(ptrcAYX-T2)
				Methionine production (mg/L)	12±3	70±14	53±9

Example 5 site-directed mutagenesis of the LmeX Gene and determination of its enzymatic Activity

The plasmid pET-LmeX is used as a template, the primer pET-R2 in the table 7 is used as a reverse primer, the primers pP250S/I254N, pP250K, pI254D, pI254K and pI254A in the table 7 are respectively used as upstream primers, PCR amplification is carried out by taking pET-R2 as downstream primers, the amplification products are respectively self-connected by a one-step seamless cloning kit, different LmeX mutant genes connected to the plasmid pET28a are obtained, and the mutant names and the corresponding protein sequence numbers are shown in the table 7. Vmax of the mutant was measured by the enzyme activity measuring method in example 2, and the results are shown in FIG. 4. Compared with LmeX, the enzyme activities of the mutant P250K (SEQ ID NO:27), I254A (SEQ ID NO:28), I254D (SEQ ID NO:29), I254K (SEQ ID NO:30) and double mutant P250S/I254N (SEQ ID NO:31) are improved to different degrees, wherein the enzyme activity of the double mutant P250S/I254N is improved by more than 88 times. The 250 and 254 site mutation and double mutation thereof are proved to have obvious effect on improving the enzyme activity of LmeX.

TABLE 7 LmeX site-directed mutagenesis primers and mutant protein sequences thereof

The 250 or 254 site corresponding to SEQ ID NO 3 provided by the invention is the inactive center of SEQ ID NO 3, and the enzyme activity can be obviously improved, and the feedback inhibition of methionine and SAM can be relieved, which cannot be foreseen by the technical personnel in the field. However, after the present invention is disclosed, those skilled in the art can derive the teaching of the present invention that mutation at the position corresponding to 250 or 254 of SEQ ID NO. 3 and/or its neighboring position makes it possible to obtain homoserine acetyltransferase with improved enzymatic activity and relieved feedback inhibition of methionine and SAM.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> homoserine acetyltransferase mutant and host cell and application thereof

<130> P2018-0161

<160> 31

<170> PatentIn version 3.5

<210> 1

<211> 1140

<212> DNA

<213> Leptospira interrogans (Leptospira obovata)

<400> 1

atgcctacct ccgaacagaa cgagttttcc cacggatccg taggtgtcgt atatactcag 60

agcattcgat ttgagtcttt gactctagag gggggtgaaa ccatcactcc tcttgaaatt 120

gcctacgaaa cgtatggcac tctcaatgaa aaaaaagaca atgccattct agtttgccat 180

gcgctttcgg gagatgctca tgcagcaggt ttccatgaag gagacaaacg tcctggctgg 240

tgggattatt atattggacc gggcaaatcc tttgatacca atcgttactt tatcatttct 300

tccaacgtaa ttggtggttg taagggttcc agtggaccac ttaccatcaa tgggaaaaat 360

ggaaaaccat tccaatccac ttttcccttt gtctccatag gagatatggt gaatgctcaa 420

gaaaaattaa tcagccattt tggaattcat aaactatttg ctgttgccgg tggttcgatg 480

ggtggaatgc aagccttaca atggtcagtc gcatacccag atcggctcaa aaattgtatc 540

gtgatggcat cttcttccga acattctgca caacaaattg cctttaatga agtgggaaga 600

caagccattc tttctgatcc caattggaac caaggtttgt acacccagga aaacagaccg 660

tcaaagggac ttgctcttgc tcgaatgatg ggtcatatca cttacttaag cgatgaaatg 720

atgagagaaa aatttggtcg taaaccaccc aaaggaaata tccaatccac agactttgcg 780

gtaggaagtt atctaatcta ccaaggcgaa tcctttgtcg atcggtttga tgcaaactca 840

tatatttatg ttacaaaagc attggatcat tttagtttag gtacaggaaa agaacttaca 900

aaggtattgg caaaagtgag atgccggttt ttggtagtgg cttatacttc cgattggttg 960

tatccaccgt atcaatctga agaaattgtg aaatctttgg aagtgaatgc tgttcccgtt 1020

agttttgtag aactcaacaa tccagcagga cgacatgata gttttttgtt accaagtgag 1080

caacaagact cgatcctaag agatttttta agttctacgg acgaaggagt tttcctttaa 1140

<210> 2

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcctacct ctgagcagaa cgaattctcc cacggttctg tcggtgtcgt atacacgcaa 60

tctatccgtt tcgaatccct gacgctggaa ggtggcgaaa ctatcacccc tctggaaatc 120

gcatacgaga cgtacggtac cctgaacgag aagaaggata acgcaatcct ggtctgccac 180

gcactgtctg gcgatgctca tgctgcaggt tttcatgaag gtgacaagcg tccaggttgg 240

tgggattatt acatcggtcc aggtaaatcc ttcgacacca accgttactt tatcatctcc 300

tccaacgtga ttggcggttg caaaggttcc tccggcccgc tgactatcaa cggtaaaaac 360

ggcaaaccgt tccagagcac cttcccattc gtgtccatcg gcgacatggt gaacgctcaa 420

gagaaactga tcagccactt cggtatccac aaactgttcg cagtggcagg tggtagcatg 480

ggtggtatgc aggctctgca atggtctgta gcttacccgg atcgtctgaa gaactgtatt 540

gtgatggcgt ctagctctga acacagcgct cagcagattg ctttcaatga agtaggccgt 600

caggcgatcc tgtctgaccc gaactggaac cagggtctgt atacccagga gaatcgtccg 660

tctaaaggtc tggccctggc ccgtatgatg ggccatatta cttatctgtc tgatgaaatg 720

atgcgcgaga aattcggccg taaaccgccg aaaggcaaca ttcagtccac tgacttcgcg 780

gtaggctctt acctgatcta ccagggcgaa tctttcgtgg accgttttga cgccaactct 840

tacatctacg ttaccaaagc gctggaccac ttctccctgg gcactggcaa agaactgacc 900

aaagtactgg cgaaagttcg ctgtcgcttc ctggttgttg cgtatacctc cgactggctg 960

tatccgccgt atcagagcga agaaattgtt aaatccctgg aagttaacgc cgttccggtt 1020

agcttcgttg aactgaacaa tccggcgggc cgccacgata gctttctgct gccgagcgaa 1080

cagcaggata gcattctgcg cgattttctg tctagcaccg acgaaggcgt ttttctgtaa 1140

<210> 3

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Pro Lys Gly Asn Ile Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 4

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgcctacct ctgagcagaa cgaattctcc cacggttctg tcggtgtcgt atacacgcaa 60

tctatccgtt tcgaatccct gacgctggaa ggtggcgaaa ctatcacccc tctggaaatc 120

gcatacgaga cgtacggtac cctgaacgag aagaaggata acgcaatcct ggtctgccac 180

gcactgtctg gcgatgctca tgctgcaggt tttcatgaag gtgacaagcg tccaggttgg 240

tgggattatt acatcggtcc aggtaaatcc ttcgacacca accgttactt tatcatctcc 300

tccaacgtga ttggcggttg caaaggttcc tccggcccgc tgactatcaa cggtaaaaac 360

ggcaaaccgt tccagagcac cttcccattc gtgtccatcg gcgacatggt gaacgctcaa 420

gagaaactga tcagccactt cggtatccac aaactgttcg cagtggcagg tggtagcatg 480

ggtggtatgc aggctctgca atggtctgta gcttacccgg atcgtctgaa gaactgtatt 540

gtgatggcgt ctagctctga acacagcgct cagcagattg ctttcaatga agtaggccgt 600

caggcgatcc tgtctgaccc gaactggaac cagggtctgt atacccagga gaatcgtccg 660

tctaaaggtc tggccctggc ccgtatgatg ggccatatta cttatctgtc tgatgaaatg 720

atgcgcgaga aattcggccg taaaccgtcg aaaggcaaca ttcagtccac tgacttcgcg 780

gtaggctctt acctgatcta ccagggcgaa tctttcgtgg accgttttga cgccaactct 840

tacatctacg ttaccaaagc gctggaccac ttctccctgg gcactggcaa agaactgacc 900

aaagtactgg cgaaagttcg ctgtcgcttc ctggttgttg cgtatacctc cgactggctg 960

tatccgccgt atcagagcga agaaattgtt aaatccctgg aagttaacgc cgttccggtt 1020

agcttcgttg aactgaacaa tccggcgggc cgccacgata gctttctgct gccgagcgaa 1080

cagcaggata gcattctgcg cgattttctg tctagcaccg acgaaggcgt ttttctgtaa 1140

<210> 5

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Ser Lys Gly Asn Ile Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 6

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgcctacct ctgagcagaa cgaattctcc cacggttctg tcggtgtcgt atacacgcaa 60

tctatccgtt tcgaatccct gacgctggaa ggtggcgaaa ctatcacccc tctggaaatc 120

gcatacgaga cgtacggtac cctgaacgag aagaaggata acgcaatcct ggtctgccac 180

gcactgtctg gcgatgctca tgctgcaggt tttcatgaag gtgacaagcg tccaggttgg 240

tgggattatt acatcggtcc aggtaaatcc ttcgacacca accgttactt tatcatctcc 300

tccaacgtga ttggcggttg caaaggttcc tccggcccgc tgactatcaa cggtaaaaac 360

ggcaaaccgt tccagagcac cttcccattc gtgtccatcg gcgacatggt gaacgctcaa 420

gagaaactga tcagccactt cggtatccac aaactgttcg cagtggcagg tggtagcatg 480

ggtggtatgc aggctctgca atggtctgta gcttacccgg atcgtctgaa gaactgtatt 540

gtgatggcgt ctagctctga acacagcgct cagcagattg ctttcaatga agtaggccgt 600

caggcgatcc tgtctgaccc gaactggaac cagggtctgt atacccagga gaatcgtccg 660

tctaaaggtc tggccctggc ccgtatgatg ggccatatta cttatctgtc tgatgaaatg 720

atgcgcgaga aattcggccg taaaccgccg aaaggcaaca accagtccac tgacttcgcg 780

gtaggctctt acctgatcta ccagggcgaa tctttcgtgg accgttttga cgccaactct 840

tacatctacg ttaccaaagc gctggaccac ttctccctgg gcactggcaa agaactgacc 900

aaagtactgg cgaaagttcg ctgtcgcttc ctggttgttg cgtatacctc cgactggctg 960

tatccgccgt atcagagcga agaaattgtt aaatccctgg aagttaacgc cgttccggtt 1020

agcttcgttg aactgaacaa tccggcgggc cgccacgata gctttctgct gccgagcgaa 1080

cagcaggata gcattctgcg cgattttctg tctagcaccg acgaaggcgt ttttctgtaa 1140

<210> 7

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Pro Lys Gly Asn Asn Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 8

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgactggtgg acagcaaatg ggtcgcggat c 31

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggcaccagg ccgctgctgt gatgatgatg 30

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agcggcctgg tgccgatgcc tacctctgag cagaac 36

<210> 11

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gctgtccacc agtcattaca gaaaaacgcc ttcgtcgg 38

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tttacggcta gctcagtcct aggtacaatg ctagc 35

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gttctgctca gaggtaggca tatgtatatt ctccttctta a 41

<210> 14

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gacgaaggcg tttttctgta accgctgcag gcatgcaagc tt 42

<210> 15

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttaagaagga gaatatacat atgcctacct ctgagcagaa c 41

<210> 16

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aagcttgcat gcctgcagcg gttacagaaa aacgccttcg tc 42

<210> 17

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gaaagctttt tacggctagc tcagtcctag gtacaatgct agcctttaag aaggagaat 59

<210> 18

<211> 89

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cagagtaaac attgtgttaa tggacgtcaa tacatctgga catctaaact tctttgcgta 60

tagattgata cgcgaacgag ccatgacat 89

<210> 19

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ttaacacaat gtttactctg gtgcctgaca tttcaccgac aaagcccagg gaacttcatc 60

acatgccaaa gtacgacaat tccaatgctg 90

<210> 20

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gctagccgta aaaagctttc tagattgcag caaagccgcc ttcgaggtca gcgat 55

<210> 21

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gaaattcggc cgtaaaccgt cgaaaggcaa caatcagtcc actgacttcg cggtag 56

<210> 22

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gaaattcggc cgtaaaccga aaaaaggcaa cattcagtcc actgacttcg cggtag 56

<210> 23

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gaaattcggc cgtaaaccgc cgaaaggcaa cgatcagtcc actgacttcg cggtag 56

<210> 24

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gaaattcggc cgtaaaccgc cgaaaggcaa caaacagtcc actgacttcg cggtag 56

<210> 25

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gaaattcggc cgtaaaccgc cgaaaggcaa cgcccagtcc actgacttcg cggtag 56

<210> 26

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cggtttacgg ccgaatttct cgcgcatcat ttcatcagac agataagtaa tatgg 55

<210> 27

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 27

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Lys Lys Gly Asn Ile Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 28

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 28

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Pro Lys Gly Asn Ala Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 29

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 29

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Pro Lys Gly Asn Asp Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 30

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 30

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Pro Lys Gly Asn Lys Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

<210> 31

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 31

Met Pro Thr Ser Glu Gln Asn Glu Phe Ser His Gly Ser Val Gly Val

1 5 10 15

Val Tyr Thr Gln Ser Ile Arg Phe Glu Ser Leu Thr Leu Glu Gly Gly

20 25 30

Glu Thr Ile Thr Pro Leu Glu Ile Ala Tyr Glu Thr Tyr Gly Thr Leu

35 40 45

Asn Glu Lys Lys Asp Asn Ala Ile Leu Val Cys His Ala Leu Ser Gly

50 55 60

Asp Ala His Ala Ala Gly Phe His Glu Gly Asp Lys Arg Pro Gly Trp

65 70 75 80

Trp Asp Tyr Tyr Ile Gly Pro Gly Lys Ser Phe Asp Thr Asn Arg Tyr

85 90 95

Phe Ile Ile Ser Ser Asn Val Ile Gly Gly Cys Lys Gly Ser Ser Gly

100 105 110

Pro Leu Thr Ile Asn Gly Lys Asn Gly Lys Pro Phe Gln Ser Thr Phe

115 120 125

Pro Phe Val Ser Ile Gly Asp Met Val Asn Ala Gln Glu Lys Leu Ile

130 135 140

Ser His Phe Gly Ile His Lys Leu Phe Ala Val Ala Gly Gly Ser Met

145 150 155 160

Gly Gly Met Gln Ala Leu Gln Trp Ser Val Ala Tyr Pro Asp Arg Leu

165 170 175

Lys Asn Cys Ile Val Met Ala Ser Ser Ser Glu His Ser Ala Gln Gln

180 185 190

Ile Ala Phe Asn Glu Val Gly Arg Gln Ala Ile Leu Ser Asp Pro Asn

195 200 205

Trp Asn Gln Gly Leu Tyr Thr Gln Glu Asn Arg Pro Ser Lys Gly Leu

210 215 220

Ala Leu Ala Arg Met Met Gly His Ile Thr Tyr Leu Ser Asp Glu Met

225 230 235 240

Met Arg Glu Lys Phe Gly Arg Lys Pro Ser Lys Gly Asn Asn Gln Ser

245 250 255

Thr Asp Phe Ala Val Gly Ser Tyr Leu Ile Tyr Gln Gly Glu Ser Phe

260 265 270

Val Asp Arg Phe Asp Ala Asn Ser Tyr Ile Tyr Val Thr Lys Ala Leu

275 280 285

Asp His Phe Ser Leu Gly Thr Gly Lys Glu Leu Thr Lys Val Leu Ala

290 295 300

Lys Val Arg Cys Arg Phe Leu Val Val Ala Tyr Thr Ser Asp Trp Leu

305 310 315 320

Tyr Pro Pro Tyr Gln Ser Glu Glu Ile Val Lys Ser Leu Glu Val Asn

325 330 335

Ala Val Pro Val Ser Phe Val Glu Leu Asn Asn Pro Ala Gly Arg His

340 345 350

Asp Ser Phe Leu Leu Pro Ser Glu Gln Gln Asp Ser Ile Leu Arg Asp

355 360 365

Phe Leu Ser Ser Thr Asp Glu Gly Val Phe Leu

370 375

Claims (17)

1. A homoserine acetyltransferase which has an amino acid residue at position 250 corresponding to the amino acid sequence shown in SEQ ID NO. 3 selected from Ser or Lys; and/or

The amino acid residue at position 254 corresponding to the amino acid sequence shown in SEQ ID NO. 3 is selected from Asn or Ala or Asp or Lys.

2. The homoserine acetyltransferase of claim 1, wherein the amino acid sequence of the homoserine acetyltransferase is set forth in SEQ ID NO 5, 7, 27, 28, 29, 30 or 31.

3. A gene encoding homoserine acetyltransferase of claim 1 or 2.

4. An expression vector comprising the coding gene of claim 3.

5. A host cell comprising the homoserine acetyltransferase of claim 1 or 2.

6. The host cell of claim 5, wherein the host cell comprises the expression vector of claim 4 or has integrated into its genome the gene encoding the gene of claim 3.

7. The host cell of claim 5 or 6, wherein the host cell is from the genus Escherichia (E.coli-A.) (II: (III))Escherichia) Corynebacterium genus (A), (B), (C)Corynebacterium) Brevibacterium (Brevibacterium) (II)Brevibacterium spBacillus, Bacillus (A), (B) and (B)Bacillus) Serratia (A), (B) and (C)Serratia) Or genus Vibrio (A)Vibrio)。

8. The host cell of claim 7, wherein the host cell is E.coli (E.coli)E. Coli) Or Corynebacterium glutamicum: (Corynebacterium glutamicum)。

9. Use of homoserine acetyltransferase of claim 1 or 2, or of coding gene of claim 3, or of expression vector of claim 4, or of host cell of any one of claims 5 to 8 for the production of O-acetylhomoserine, methionine or S-adenosylmethionine.

10. A method for preparing O-acetylhomoserine, methionine or S-adenosylmethionine, comprising the steps of:

a. culturing the host cell of any one of claims 5-8 to produce O-acetylhomoserine, methionine or S-adenosylmethionine; and

b. optionally isolating O-acetylhomoserine, methionine or S-adenosylmethionine from the culture broth.

11. The method of claim 10, wherein the method is performed at 28 ℃ to 40 ℃.

12. The method of claim 11, wherein the method is performed at 30 ℃ or 37 ℃.

13. A method for preparing O-acetylhomoserine, methionine or S-adenosylmethionine, comprising the steps of:

a. catalyzing the production of O-acetylhomoserine, methionine or S-adenosylmethionine from homoserine using the homoserine acetyltransferase of claim 1 or 2; and

b. optionally isolating O-acetylhomoserine, methionine or S-adenosylmethionine from the above reaction system.

14. A method of producing homoserine acetyltransferase of claim 1 or 2, said method comprising the steps of:

a. modifying the coding sequence of the amino acid sequence shown in SEQ ID NO. 3 such that the amino acid residue in the encoded amino acid sequence corresponding to position 250 of the amino acid sequence shown in SEQ ID NO. 3 is Ser or Lys, and/or the amino acid residue at position 254 is Asn or Ala or Asp or Lys;

b. transfecting the coding sequence obtained from a directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

c. culturing the host cell obtained in step b;

d. isolating homoserine acetyltransferase produced by said host cell from the culture system obtained in step c.

15. The method according to claim 14, further comprising determining the activity of the resulting homoserine acetyltransferase and the ability to release the feed back inhibition by methionine or S-adenosylmethionine.

16. A method for engineering a wild-type homoserine acetyltransferase so as to increase its activity and relieve methionine or S-adenosylmethionine feedback inhibition, said method comprising the steps of:

a. comparing the amino acid sequence of the wild-type homoserine acetyltransferase with the amino acid sequence shown in SEQ ID NO. 3; and

b. modifying the coding sequence of the wild-type homoserine acetyltransferase, so that the amino acid residue at the 250 th position of the coded amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO. 3 is Ser or Lys, and/or the amino acid residue at the 254 th position is Asn or Ala or Asp or Lys;

c. transfecting the coding sequence obtained in the step b directly into a suitable host cell or introducing the coding sequence into a suitable host cell through a vector;

d. culturing the resulting host cell;

e. isolating homoserine acetyltransferase produced by said host cell from the culture system obtained in step d.

17. The method of claim 16, further comprising determining the ability of said homoserine acetyltransferase to release feedback inhibition by methionine or S-adenosylmethionine.

Images