CN105505894A - Aspartokinase/homoserine dehydrogenase mutant and application thereof - Google Patents
Aspartokinase/homoserine dehydrogenase mutant and application thereof Download PDFInfo
- Publication number
- CN105505894A CN105505894A CN201410494708.7A CN201410494708A CN105505894A CN 105505894 A CN105505894 A CN 105505894A CN 201410494708 A CN201410494708 A CN 201410494708A CN 105505894 A CN105505894 A CN 105505894A
- Authority
- CN
- China
- Prior art keywords
- homoserine dehydrogenase
- threonine
- aminoacid sequence
- seqidno
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides aspartokinase/homoserine dehydrogenase and an encoding gene thereof. In the amino acid sequence of the aspartokinase/homoserine dehydrogenase, mutation of amino acid residues at the 253 and/or 406 positions appear according to the SEQ ID No.2. The aspartokinase/homoserine dehydrogenase can high-effectively remove feedback inhibition of threonine and can be used effectively for producing L-threonine. The invention also provides a host cell including the encoding gene of the aspartokinase/homoserine dehydrogenase and a method of producing the L-threonine through the host cell or the aspartokinase/homoserine dehydrogenase.
Description
Technical field
The present invention relates to biological technical field.Specifically, the present invention relates to saltant type E.C. 2.7.2.4./homoserine dehydrogenase, its encoding gene and the application in Threonine is produced; The invention still further relates to the method utilizing described saltant type E.C. 2.7.2.4./homoserine dehydrogenase or its encoding gene to produce Threonine.
Background technology
L-threonine is most important indispensable amino acid in human and animal's nutrition, has very consequence in foodstuffs industry, aquaculture and fodder industry.In recent years, its market requirement increases steadily, and world market sales volume has broken through 1,000,000 tons of scales.
At present, Threonine mainly adopts Production by Microorganism Fermentation.In intestinal bacteria, the route of synthesis of L-threonine take aspartic acid as precursor, produces Threonine (as shown in Figure 1) by five step reactions.Wherein, the biosynthetic the first step reaction of E.C. 2.7.2.4./homoserine dehydrogenase catalysis Threonine and three-step reaction, it is the rate-limiting step that Threonine is produced, its vigor decides the ratio that metabolic fluxes flows to L-threonine route of synthesis, by thrA genes encoding, at the feedback inhibition (CostrejeanJM of enzyme activity level by end product Threonine, Truffa-BachiP (1977). " Threonine-sensitivehomoserinedehydrogenaseandaspartokina seactivitiesofEscherichiacoliK12.Kineticandspectroscopic effectsuponbindingofserineandthreonine. " JBiolChem252 (15), 5332-6.PMID:328500).
Current intestinal bacteria are transformed the suitability for industrialized production being used for carrying out Threonine by many enterprises.Because E.C. 2.7.2.4./homoserine dehydrogenase activity receives the rigorous regulation and control of Threonine, remove the only way which must be passed that the feedback inhibition of Threonine to E.C. 2.7.2.4./homoserine dehydrogenase is development high yield L-threonine-producing strain.Goldschmidt chemical corporation obtains by random mutation screening the AKI mutant removing feedback inhibition, is 345 Threonine Serines are replaced (S345F), produces, obtain great income (US8143032B1) for Threonine.
In addition, due to other metabolites of E.C. 2.7.2.4. to be L-threonine be precursor synthesis, the route of synthesis of such as ILE the enzyme that shares, in intestinal bacteria, the precursor of Isoleucine route of synthesis is Threonine, obtains Isoleucines through seven step catalytic reactions such as threonine deaminases; If can obtain the E.C. 2.7.2.4. of efficient solution except L-threonine feedback inhibition, the production for ILE all has great importance.
Therefore, in sum, this area be badly in need of have high enzyme live and efficient solution remove L-threonine feedback inhibition E.C. 2.7.2.4./homoserine dehydrogenase mutant.
Summary of the invention
An object of the present invention is E.C. 2.7.2.4./homoserine dehydrogenase, its encoding gene of providing the feedback inhibition removing Threonine, comprises expression vector and the host cell of this encoding gene.
Another object of the present invention is to, based on E.C. 2.7.2.4./homoserine dehydrogenase of the present invention, its encoding gene, comprise expression vector and the host cell of this encoding gene, a kind of method preparing L-threonine or ILE is provided.
The present invention has an object to be again, and providing a kind of transforms the method that wild-type aspartate kinase/homoserine dehydrogenase makes it to remove Threonine feedback inhibition.
In first aspect, the invention provides a kind of E.C. 2.7.2.4./homoserine dehydrogenase, the 253rd amino acids residue and/or the 406th amino acids residue that aminoacid sequence is corresponding to aminoacid sequence shown in SEQIDNO:2 of described E.C. 2.7.2.4./homoserine dehydrogenase are undergone mutation.
In a particular embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase derives from Escherichia bacteria; Preferably, intestinal bacteria are derived from.
In a preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase is:
A. the 253rd amino acids residue of its aminoacid sequence aminoacid sequence as shown in SEQIDNO:2 and shown in SEQIDNO:2 and/or the 406th amino acids residue are undergone mutation, or
B. there is sequence that a limits and position beyond the 253rd and the 406th through one or several amino-acid residue, the replacement of preferred 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino-acid residue, disappearance or interpolation and the sequence that formed, and there is the E.C. 2.7.2.4./homoserine dehydrogenase derived by a of E.C. 2.7.2.4./homoserine dehydrogenase function that a limits substantially.
In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase is Leu and/or the 406th amino acids residue at the 253rd amino acids residue corresponding to aminoacid sequence shown in SEQIDNO:2 is L-Ala.
In a preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase is:
A. its aminoacid sequence is as shown in SEQIDNO:4 or 6; Or
B. comprise sequence that a limits and position beyond the 253rd and the 406th through one or several amino-acid residue, the replacement of preferred 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino-acid residue, disappearance or interpolation and the sequence that formed, and there is the E.C. 2.7.2.4./homoserine dehydrogenase derived by a of E.C. 2.7.2.4./homoserine dehydrogenase function that a limits substantially.
In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase is as shown in SEQIDNO:4 or 6.
In a preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase removes Threonine feedback inhibition.
In a preferred embodiment, under the Threonine of 2mM concentration exists, described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 60%; Preferably, the activity of more than 80%; Most preferably, the activity of more than 90%.
In further preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase is under the Threonine of 16mM concentration exists, and described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 80%; More preferably, the activity of more than 90%.
In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase is as shown in SEQIDNO:4.
In second aspect, the invention provides the gene of E.C. 2.7.2.4./homoserine dehydrogenase described in coding first aspect present invention.
In a preferred embodiment, the nucleotide sequence of described gene is as shown in SEQIDNO:3 or 5.
In the third aspect, the invention provides the expression vector comprising encoding gene described in second aspect present invention.
In fourth aspect, the invention provides a kind of host cell, described host cell contains the encoding gene described in second aspect present invention or the expression vector described in third aspect present invention.
In a preferred embodiment, described host cell is from Escherichia (Escherichia), corynebacterium (Corynebacterium), brevibacterium sp (Brevibacteriumsp.), bacillus (Bacillus), serratia (Serratia) or Vibrio (Vibrio).
In a preferred embodiment, described host cell is intestinal bacteria (E.Coli) or corynebacterium glutamicum (Corynebacteriumglutamicum).
In a preferred embodiment, described host cell chromosome is integrated with encoding gene of the present invention or expression vector.
In a preferred embodiment, described host cell expression E.C. 2.7.2.4./homoserine dehydrogenase of the present invention.
In the 5th, the invention provides E.C. 2.7.2.4./homoserine dehydrogenase described in first aspect present invention, or the encoding gene described in second aspect present invention, or the expression vector described in third aspect present invention or the host cell described in fourth aspect present invention are producing the application in L-threonine or ILE.
In the 6th, the invention provides a kind of method preparing L-threonine or ILE, said method comprising the steps of:
A. cultivate the host cell described in fourth aspect present invention, make it to produce L-threonine or ILE; With
B. from nutrient solution, L-threonine or ILE is separated.
In a preferred embodiment, described method at 30-45 DEG C, more preferably 37 DEG C of enforcements.
In the 7th, the invention provides and a kind ofly transform the method that wild-type aspartate kinase/homoserine dehydrogenase makes it to remove Threonine feedback inhibition, said method comprising the steps of:
A. aminoacid sequence shown in the aminoacid sequence of wild-type aspartate kinase/homoserine dehydrogenase and SEQIDNO:2 is compared; With
B. transform the encoding sequence of described wild-type aspartate kinase/homoserine dehydrogenase, to make to correspond in the aminoacid sequence of encoding shown in SEQIDNO:2 the 253rd of aminoacid sequence the and/or the amino-acid residue of 406 undergo mutation;
C. the host cell that the encoding sequence direct transfection obtained by b is suitable or introduce suitable host cell through carrier;
D. the host cell that c obtains is cultivated;
E. from the culture system that steps d obtains, be separated E.C. 2.7.2.4./homoserine dehydrogenase that described host cell produces; With
F. the ability that described E.C. 2.7.2.4./homoserine dehydrogenase removes Threonine feedback inhibition is measured.
In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase be leucine and/or the 406th at the 253rd that corresponds to aminoacid sequence shown in SEQIDNO:2 is L-Ala.
In a preferred embodiment, the method preparing E.C. 2.7.2.4./homoserine dehydrogenase of the present invention comprises the following steps:
A. transform the encoding sequence of aminoacid sequence shown in SEQIDNO:2, to make to correspond in the aminoacid sequence of encoding shown in SEQIDNO:2 the 253rd of aminoacid sequence the and/or the amino-acid residue of 406 undergo mutation;
B. the host cell that the encoding sequence direct transfection obtained by a is suitable or introduce suitable host cell through carrier;
C. the host cell that b obtains is cultivated;
D. from the culture system that step c obtains, be separated E.C. 2.7.2.4./homoserine dehydrogenase that described host cell produces; With
E. the ability that described E.C. 2.7.2.4./homoserine dehydrogenase removes Threonine feedback inhibition is measured.
In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase be leucine and/or the 406th at the 253rd that corresponds to aminoacid sequence shown in SEQIDNO:2 is L-Ala.
In eighth aspect, the invention provides a kind of immobilized enzyme, described immobilized enzyme comprises the E.C. 2.7.2.4./homoserine dehydrogenase described in first aspect present invention.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Fig. 1 take aspartic acid as precursor, produced the schematic diagram of Threonine by five step reactions;
The feedback inhibition that Fig. 2 shows Threonine is on the impact of the activity of wild-type aspartate kinase/homoserine dehydrogenase and E.C. 2.7.2.4./homoserine dehydrogenase mutant.
Embodiment
Contriver is through extensive and deep research, find that the 253rd and/or 406 of the E.C. 2.7.2.4./homoserine dehydrogenase to Escherichia coli is carried out genetic modification unexpectedly, E.C. 2.7.2.4./homoserine dehydrogenase the mutant obtained not only has outstanding enzymic activity, also effectively relieve the feedback inhibition of L-threonine, thus High-efficient Production L-threonine can be used for.Complete the present invention on this basis.
E.C. 2.7.2.4./homoserine dehydrogenase of the present invention
Term used herein " E.C. 2.7.2.4./homoserine dehydrogenase " has the implication that those of ordinary skill in the art understand usually, it is by thrA genes encoding, there is E.C. 2.7.2.4. and homoserine dehydrogenase activity, can catalysis aspartic acid to aspartic acid phosphoric acid, and aspartic acid semialdehyde is to the reaction of homoserine, it is the key enzyme in threonine synthetic pathway.
E.C. 2.7.2.4./homoserine dehydrogenase of the present invention is a kind of multienzyme syzygy, and described multienzyme syzygy refers to the enzyme containing two or more catalytic activity on a peptide chain.E.C. 2.7.2.4./homoserine dehydrogenase of the present invention has two active regions, and these two catalytic active centers are separate, and centre is interconnected with one section of polypeptide.
In a particular embodiment, the 253rd amino acids residue and/or the 406th amino acids residue that aminoacid sequence is corresponding to aminoacid sequence (its coding nucleotide sequence is as shown in SEQIDNO:1) shown in SEQIDNO:2 of E.C. 2.7.2.4./homoserine dehydrogenase of the present invention are undergone mutation.In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase is Leu and/or the 406th amino acids residue at the 253rd amino acids residue corresponding to aminoacid sequence shown in SEQIDNO:2 is L-Ala.In a preferred embodiment, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase as shown in SEQIDNO:4 or 6, preferably as shown in SEQIDNO:4.
E.C. 2.7.2.4. of the present invention/homoserine dehydrogenase removes Threonine feedback inhibition.In a preferred embodiment, under the Threonine of 2mM concentration exists, described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 60%; Preferably, the activity of more than 80%; Most preferably, the activity of more than 90%.In further preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase is under the Threonine of 16mM concentration exists, and described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 80%; More preferably, the activity of more than 90%.
Those of ordinary skill in the art are not difficult to know, in some region of polypeptide, such as insignificant area change a few amino acids residue can not change biological activity substantially, such as, the sequence that some amino acid of suitable replacement obtains can't affect its activity (can see Watson etc., MolecularBiologyofTheGene, the 4th edition, 1987, TheBenjamin/CummingsPub.Co.P224).Therefore, those of ordinary skill in the art can implement this replacement and guarantee that gained molecule still has required biological activity.
Therefore, sudden change is further done on the basis that E.C. 2.7.2.4./homoserine dehydrogenase of the present invention can be undergone mutation at the 253rd amino acids residue and/or the 406th amino acids residue corresponding to aminoacid sequence shown in SEQIDNO:2 and still possesses function and the activity of E.C. 2.7.2.4. of the present invention.Such as, E.C. 2.7.2.4./homoserine dehydrogenase of the present invention is: the 253rd amino acids residue and/or the 406th amino acids residue of its aminoacid sequence of a. aminoacid sequence as shown in SEQIDNO:2 and shown in SEQIDNO:2 are undergone mutation; Or, b. there is sequence that a limits and position beyond the 253rd and the 406th through one or several amino-acid residue, the replacement of preferred 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino-acid residue, disappearance or interpolation and the sequence that formed, and there is the E.C. 2.7.2.4./homoserine dehydrogenase derived by a of E.C. 2.7.2.4./homoserine dehydrogenase function that a limits substantially.
In the present invention, E.C. 2.7.2.4./homoserine dehydrogenase of the present invention comprises compared with the E.C. 2.7.2.4. with aminoacid sequence as shown in SEQIDNO:4 or 6, there are 20 at the most, preferably at the most 10, at the most 3 goodly, more preferably at the most 2, best at the most 1 amino acid replace by the similar or close amino acid of character and the mutant formed.The mutant of these conservative variation can basis, such as, carry out amino acid replacement shown in following table and produce.
| Original Residue | Representational replacement residue | Preferred replacement residue |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Present invention also offers the polynucleotide of code book invention polypeptide.Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising encoding such peptides, also can be the polynucleotide also comprising additional code and/or non-coding sequence.
Therefore, " containing " used herein, " having " or " comprising " include " comprising ", " primarily of ... form ", " substantially by ... form " and " by ... form "; " primarily of ... form ", " substantially by ... form " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
Corresponding to the 253rd of aminoacid sequence shown in SEQIDNO:2 the and/or the amino-acid residue of 406
Those of ordinary skill in the art all know, can make various sudden change, such as, replace, add or lack in the aminoacid sequence of certain albumen to some amino-acid residues, but the mutant obtained still can possess function or the activity of former albumen.Therefore; those of ordinary skill in the art can make certain change to the concrete disclosed aminoacid sequence of the present invention and still be had required active mutant; amino-acid residue corresponding with the 253rd of aminoacid sequence shown in SEQIDNO:2 the and/or the amino-acid residue of 406 in so this mutant may not be just the 253rd and/or 406, but the mutant so obtained must drop in protection scope of the present invention.
Term used herein " corresponds to " meaning having those of ordinary skill in the art and usually understand.Specifically, " corresponding to " represents that two sequences is after homology or sequence thereto comparison, the position that a sequence is corresponding with the specified location in another sequence.Therefore, with regard to " amino-acid residue of the 253rd corresponding to aminoacid sequence shown in SEQIDNO:2 ", if one end of aminoacid sequence adds 6-His label shown in SEQIDNO:2, the 253rd that so corresponds to aminoacid sequence shown in SEQIDNO:2 in gained mutant may be just the 259th; And if a few amino acids residue deleted in aminoacid sequence shown in SEQIDNO:2, the 253rd that so corresponds to aminoacid sequence shown in SEQIDNO:2 in gained mutant may be just the 248th, etc.Again such as, if the 20-420 position one article with aminoacid sequence shown in the sequence of 400 amino-acid residues and SEQIDNO:2 has higher homology or sequence thereto, the 253rd that so corresponds to aminoacid sequence shown in SEQIDNO:2 in gained mutant may be just the 233rd.Equally, above description is also equivalent is applicable to " amino-acid residue of the 406th corresponding to aminoacid sequence shown in SEQIDNO:2 ".
In a particular embodiment, described homology or sequence thereto can be more than 80%, preferably more than 90%, more preferably 95%-98%, most preferably more than 99%.
The method of mensuration sequence homology known to a person of ordinary skill in the art or homogeny includes but not limited to: computer molecular biology (ComputationalMolecularBiology), Lesk, A.M. compile, Oxford University Press, New York, 1988; Biological computation: information science and Genome Project (Biocomputing:InformaticsandGenomeProjects), Smith, D.W. compile, academic press, New York, 1993; The Computer Analysis (ComputerAnalysisofSequenceData) of sequence data, first part, Griffin, A.M. and Griffin, H.G. compiles, HumanaPress, New Jersey, 1994; Sequential analysis (SequenceAnalysisinMolecularBiology) in molecular biology, vonHeinje, G., academic press, 1987 and sequence analysis primer (SequenceAnalysisPrimer), Gribskov, M. with Devereux, J. MStocktonPress is compiled, New York, 1991 and Carillo, H. with Lipman, D., SIAMJ.AppliedMath., 48:1073 (1988).The preferred method measuring homogeny will obtain maximum coupling between the sequence of test.The method measuring homogeny is compiled in the obtainable computer program of the public.Between preferred mensuration two sequences, the computer program means of homogeny includes but not limited to: GCG routine package (Devereux, J. etc., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. etc., 1990).The public can obtain BLASTX program (BLAST handbook, Altschul, S. etc., NCBINLMNIHBethesda, Md.20894 from NCBI and other source; Altschul, S. etc., 1990).The SmithWaterman algorithm known also can be used for measuring homogeny.
Host cell
Term used herein " host cell " has the implication that those of ordinary skill in the art understand usually, that is, can produce the host cell of E.C. 2.7.2.4./homoserine dehydrogenase of the present invention.In other words, the present invention can utilize any host cell, as long as E.C. 2.7.2.4./homoserine dehydrogenase of the present invention can be expressed in this host cell.
Such as, in the particular embodiment, what the present invention utilized is comprise ectogenic E.C. 2.7.2.4. of the present invention/homoserine dehydrogenase encoding gene, the such as host cell of nucleotide sequence shown in SEQIDNO:3 or 5, preferred coli strain.But those of ordinary skill in the art it should be understood that the host cell that the invention is not restricted to comprise exogenous encoding gene.Such as, the encoding gene of the E.C. 2.7.2.4./homoserine dehydrogenase comprised in host cell of the present invention can be not only recombinant vectors or plasmid, it is likely also encoding gene genome being integrated with described enzyme, namely, the encoding gene of the enzyme on genome conformity may be carry out homologous recombination obtain by proceeding to plasmid, also the likely corresponding site of rite-directed mutagenesis and obtaining on genome.
In a particular embodiment, host cell of the present invention efficiently can produce L-threonine, and has the feedback-inhibition resistance ability to L-threonine.
In a particular embodiment, host cell of the present invention can produce L-threonine and take L-threonine as other amino acid of precursor, such as ILE.
In a preferred embodiment, described host cell is from Escherichia (Escherichia), corynebacterium (Corynebacterium), brevibacterium sp (Brevibacteriumsp.), bacillus (Bacillus), serratia (Serratia) or Vibrio (Vibrio).
In a preferred embodiment, described host cell is intestinal bacteria (E.Coli) or corynebacterium glutamicum (Corynebacteriumglutamicum).
The application of polypeptide of the present invention or host cell of the present invention
In view of instruction of the present invention, those skilled in the art can know E.C. 2.7.2.4./homoserine dehydrogenase of the present invention, or its encoding gene, or comprise the expression vector of described encoding gene or described host cell may be used for producing L-threonine.And in view of other metabolites of E.C. 2.7.2.4. to be L-threonine be precursor synthesis, the route of synthesis of such as ILE the enzyme that shares, polypeptide of the present invention or host cell of the present invention also can be used in generation ILE.
In a particular embodiment, host cell of the present invention can at 30-45 DEG C, and preferably 37 DEG C produce 1B.
Remove Threonine feedback inhibition
It will be understood by those skilled in the art that term used herein " is removed Threonine feedback inhibition " and referred to that a kind of script is subject to the enzyme of Threonine feedback inhibition, suppressing degree to reduce making it after transformation by Threonine.This reduction compares acquisition by the suppression degree of two kinds of enzymes under identical threonine concentration." remove Threonine feedback inhibition " comprises and removes the past release of feedback inhibition and all solutions.And suppress degree to refer under certain density Threonine exists, and compared with when there is not Threonine, the ratio of E.C. 2.7.2.4./homoserine dehydrogenase loss of enzyme activity (being namely suppressed).Under these conditions, the ratio that E.C. 2.7.2.4. enzymic activity remains, is called enzyme remaining ratio alive or enzyme retaining ratio alive or enzyme is alive relatively, due to:
Enzyme loss ratio+enzyme alive remaining ratio=100% alive,
So represent suppression degree through conventional enzyme remaining ratio alive.Enzyme remaining ratio alive is higher, suppresses degree lower.Accordingly, " Threonine feedback inhibition is removed " also usually with transforming relatively portraying of former and later two enzymes remaining enzyme ratio alive.
In a particular embodiment, under the Threonine of 2mM concentration exists, described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 60%; Preferably, the activity of more than 80%; Most preferably, the activity of more than 90%.
In a preferred embodiment, described E.C. 2.7.2.4./homoserine dehydrogenase is under the Threonine of 16mM concentration exists, and described E.C. 2.7.2.4./homoserine dehydrogenase at least retains the activity of more than 80%; More preferably, the activity of more than 90%.
Immobilized enzyme
Term used herein " immobilized enzyme " has the implication that those of ordinary skill in the art's routine is understood.Specifically, this term represents that water-soluble enzyme is after physics or chemical process process, makes enzyme be combined with water-insoluble macromolecular carrier or enzyme is embedded in wherein, makes the microcapsule of enzyme solubleness gel or semi-permeable membranes in water thus cause mobility to reduce.
Immobilized enzyme still has enzymic activity, in catalyzed reaction, act on substrate with solid state shape.Enzyme general stability after immobilization increases, and is easily separated from reactive system, and is easy to control, can repeated multiple times use.Be convenient to transport and storage, be conducive to automatic production.Immobilized enzyme is the enzyme utilisation technology grown up in nearly more than ten years, in industrial production, chemical analysis and medicine etc., have tempting application prospect.
Those of ordinary skill in the art in view of the teachings contained herein, E.C. 2.7.2.4./homoserine dehydrogenase of the present invention is not difficult to be processed into immobilized enzyme, and then for the reaction of catalysis from aspartic acid to L-threonine, thus L-threonine can be produced efficiently, efficient solution can remove Threonine feedback inhibition again.
Application of the present invention and advantage
1. various E.C. 2.7.2.4./homoserine dehydrogenase provided by the invention, its encoding gene and comprise the host cell that described coding has and can industrially apply to produce L-threonine and other amino acid, such as ILE;
2. various E.C. 2.7.2.4./homoserine dehydrogenase provided by the invention is E.C. 2.7.2.4./homoserine dehydrogenase that a kind of high specific activity and efficient solution remove L-threonine feedback inhibition.Therefore, various E.C. 2.7.2.4./homoserine dehydrogenase of the present invention, its encoding gene and the host cell comprising described encoding gene can not only produce L-threonine efficiently, efficient solution can also remove Threonine feedback inhibition, having a extensive future industrially;
3. various E.C. 2.7.2.4./homoserine dehydrogenase provided by the invention and their encoding gene contribute to illustrating and the Related Mechanism understanding L-threonine biosynthetic pathway and feedback inhibition, thus for utilizing genetic engineering means transformation related protein or host cell to provide theoretical basis and material further.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.
Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the inventive method.The use that better implementation method described in literary composition and material only present a demonstration.
Embodiment
The clonal expression of embodiment 1. E.C. 2.7.2.4.s/homoserine dehydrogenase wild type gene
By intestinal bacteria (E.coli) MG1655 (available from ATCC700926, can with reference to BlattnerFR etc., ThecompletegenomesequenceofEscherichiacoliK-12.Science27 7:1453-62 (1997)) at LB substratum (Tryptones 10g/L, yeast powder 5g/L, sodium-chlor 10g/L, pH7.0) in, 37 DEG C, 200rpm, cultivates 12-16h, then collecting cell.The little extraction reagent kit of Biomiga genome is adopted to extract genomic dna.Take genome of E.coli as template, obtained the expression cassette of wild-type thrA gene by PCR.
Concrete operations are:
Pcr amplification: with CATATGCGAGTGTTGAAGTTCGGCGGTACA (SEQIDNO:7) and CGCGAATTCTCAGACTCCTAACTTCCATGAGAGGGTAC (SEQIDNO:8) for primer, to increase the thrA gene (encoding gene of wild-type thrA from intestinal bacteria MG1655 genomic dna, its aminoacid sequence is SEQIDNO:2, and its coding nucleotide sequence is SEQIDNO:1); The restriction enzyme site of NdeI and EcoRI on the last DNA fragmentation band obtained.By NdeI and EcoRI, the DNA fragmentation finally obtained is cloned into pET28a plasmid (be purchased from Novozymes Company, article No. is 69864-3), gained plasmid called after pET-thrA.
The rite-directed mutagenesis of embodiment 2. E.C. 2.7.2.4.s/homoserine dehydrogenase
Utilize Stratagene series Quik
xL-II site-directed mutagenesis kit (Stratagene company, the U.S.), by primer ThrA253F/R (see table 1), PCR is carried out to plasmid pET-thrA and introduce mutational site, the plasmid obtained reclaims through PCR primer, after removing the enzyme in PCR system and the salt ion in buffer system, adopt DpnI enzyme to cut 1h and remove methylated template plasmid DNA, plasmid after process proceeds to competent cell DE3 (purchased from Beijing Quanshijin Biotechnology Co., Ltd), the correct mutant plasmid called after pET-thrA253 obtained, the thrA mutant nucleotide sequence carried is as shown in SEQIDNO:3, the aminoacid sequence of translation is as shown in SEQIDNO:4.
By primer ThrA406F/R (see table 1), PCR is carried out to plasmid pET-thrA again and introduce mutational site, the plasmid obtained reclaims through PCR primer, after removing the enzyme in PCR system and the salt ion in buffer system, adopt Dpn1 enzyme to cut 1h and remove methylated template plasmid DNA, plasmid after process proceeds to competent cell DE3, the correct mutant plasmid called after pET-thrA406 obtained, the thrA mutant nucleotide sequence carried is as shown in SEQIDNO:5, and the aminoacid sequence of translation is as shown in SEQIDNO:6.
Table 1
| ThrA253F | GTCCTACCAGAAAGCGATGGAGCTTTCCTACTTCG(SEQ ID NO:9) |
| ThrA253R | CCATCGCTTTCTGGTAGGACATCGACTTCAACAAC(SEQ ID NO:10) |
| ThrA406F | GTGATGGTGCGCGCACCTTGCGTGGGATCTCGGCG(SEQ ID NO:11) |
| ThrA406R | AAGGTGCGCGCACCATCACCTACCACCGAGATAATG(SEQ ID NO:12) |
The expression and purification of embodiment 3. E.C. 2.7.2.4.s/homoserine dehydrogenase
By in embodiment 1 and 2 build wild plasmid pET-thrA and mutant plasmid pET-thrA253 and pET-thrA406 respectively electricity be converted into intestinal bacteria DE3, the bacterial strain obtained successively is called after E.coliDE3 (pET-thrA), E.coliDE3 (pET-thrA253) and E.coliDE3 (pET-thrA406) respectively, to realize its abduction delivering.
Protein expression: by E.coliDE3 (pET-thrA), E.coliDE3 (pET-thrA253) and E.coliDE3 (pET-thrA406) bacterial strain respectively on LB substratum in 37 DEG C of incubated overnight.Then the 500ml triangular flask of 50mlLB substratum is housed according to 2% switching.Add the penbritin of 50mg/L, at 37 DEG C, under 200rpm, be cultured to OD
600be about 0.6.Add 250uL1MIPTG, carry out inducing (during temperature height, induction inclusion body is more) at 16 DEG C, induction time 16h.
Protein purification: collect cultured thalline, under 6000rpm, centrifugal 10min is to collect thalline.Abandoning supernatant, thalline 30mLbufferA (25mMTris, 150mMNaCl, 20mM imidazoles, pH7.5; ) suspend, high-pressure homogeneous crusher machine three times.After fragmentation, at 4 DEG C, the centrifugal 1h of 16000rpm.Expressing protein is added with His label, utilizes the nickel post of AKTApurifier10 to carry out purifying; Purified reagent is bufferB (BufferB:25mMTris, 150mMNaCl, 500mM imidazoles, pH7.5), and condition is: loading flow velocity is 0.5mL/min, gradient elution time 1h, flow velocity 1mL/min, and often 2mL collected by pipe.
The Enzyme activity assay of embodiment 4. wild-type and saltant type E.C. 2.7.2.4./homoserine dehydrogenase
Enzyme activity determination: containing 200mMTris-HCl (pH7.5), 10mM20MgSO in 1ml reaction solution
46H
2the L-threonine of O, 10mML-aspartic acid, 10mMATP, 160mM oxammonium hydrochloride and appropriate crude enzyme liquid and desired concn, 37 DEG C of reaction 20min; Add 1ml5% (w/v) FeCl
3termination enzyme is lived, and gets 200ul and measure OD in microplate reader
540(BlackandWright, 1954).
Result as shown in Figure 2, under having 2mM Threonine to exist, live by the wild-type aspartate kinase/homoserine dehydrogenase only remaining enzyme of about 5%, illustrates that enzyme is lived and be subject to the feedback inhibition of Threonine; Even and if under 16mM Threonine exists, the enzyme of E253L mutant is lived and is still reached 90%, illustrate 253 amino acids sudden changes can efficient solution except the feedback inhibition of Threonine; Equally, under 16mM Threonine exists, the enzyme of M406A mutant is lived and is still reached 38%, illustrates that 406 amino acids sudden changes also can the feedback inhibition of releasing Threonine to a great extent.
Embodiment 5. wild-type and saltant type E.C. 2.7.2.4./homoserine dehydrogenase produce the ability of L-threonine
1. the clonal expression of E.C. 2.7.2.4./homoserine dehydrogenase wild type gene
By intestinal bacteria MG1655 (available from ATCC700926, can with reference to BlattnerFR etc., ThecompletegenomesequenceofEscherichiacoliK-12.Science27 7:1453-62 (1997)) at LB substratum (Tryptones 10g/L, yeast powder 5g/L, sodium-chlor 10g/L, pH7.0) in, 37 DEG C, 200rpm, after cultivating 12-16h, collecting cell, adopts the little extraction reagent kit of Biomiga genome to extract genomic dna.Take genome of E.coli as template, obtain wild-type thrA gene expression frame by PCR.
Concrete operations are:
Pcr amplification: with CGCGGATTCAGCTTTTCATTCTGACTGCAACGGG (SEQIDNO:13) and GCGGAGCTCTCAGACTCCTAACTTCCATGAGAGGGTAC (SEQIDNO:14) for primer, to increase thrABC gene from E.coliMG1655 genomic dna; The restriction enzyme site of BamHI and SacI on the last DNA fragmentation band obtained.By BamHI and SacI, the DNA fragmentation finally obtained is cloned into pWSK29 plasmid (to be preserved by this laboratory, can reference RongFuWang, SidneyR.Kushner, Constructionofversatilelow-copy-numbervectorsforcloning, sequencingandgeneexpressioninEscherichiacoli, Gene, Volume100, April1991, Pages195-199), gained plasmid called after pWSK-thrABC.
2. the rite-directed mutagenesis of E.C. 2.7.2.4./homoserine dehydrogenase
Utilize Stratagene series Quik
xL-II site-directed mutagenesis kit, by primer ThrA253F/R (see table 1), PCR is carried out to plasmid pWSK-thrABC and introduce mutational site, the plasmid obtained reclaims through PCR primer, after removing the enzyme in PCR system and the salt ion in buffer system, adopt DpnI enzyme to cut 1h and remove methylated template plasmid DNA, plasmid after process proceeds to escherichia coli DH5a competence (being purchased from health is century), the correct mutant plasmid called after pWSK-thrABC253 obtained, the mutant nucleotide sequence carried is as shown in SEQIDNO:3, the aminoacid sequence 20 of translation is as shown in SEQIDNO:4, carry the coli strain called after DH5athrA253 respectively of plasmid pWSK-thrABC253.
By primer ThrA406F/R (see table 1), PCR is carried out to plasmid pET-thrA again and introduce mutational site, the plasmid obtained reclaims through PCR primer, after removing the enzyme in PCR system and the salt ion in buffer system, adopt Dpn1 enzyme to cut 1h and remove methylated template plasmid DNA, plasmid after process proceeds to competent cell MG1655 (available from ATCC700926, can with reference to BlattnerFR etc., ThecompletegenomesequenceofEscherichiacoliK-12.Science27 7:1453-62 (1997)) and BW25113 (derive from CGSC (Yale's intestinal bacteria preservation center), the correct mutant plasmid called after pWSK-thrABC406 obtained, the thrA mutant nucleotide sequence carried is as shown in SEQIDNO:5, the aminoacid sequence of translation is as shown in SEQIDNO:6, carry the coli strain called after DH5athrA406 respectively of plasmid pWSK-thrABC406.
3. fermentative production
Fermention medium is as follows: glucose 50g/L, ammonium sulfate 10g/L, potassium primary phosphate 2g/L, yeast powder 3g/L, bitter salt 0.5g/L; Five ferrous sulfate hydrate 0.01g/L, five anhydrous manganese 0.01g/L, MOPS0.4M.Shaker fermentation, the bottled 20mL fermention medium of 500ml triangle, inoculation, the bacterium liquid of 1mLLB incubated overnight is at 37 DEG C, 250rpm, and ferment 38h.
In DH5a bacterial strain, the production amount of threonine of process LAN E.C. 2.7.2.4./homoserine dehydrogenase wild-type and mutant is shown in Table 2, the growth of process LAN E.C. 2.7.2.4./homoserine dehydrogenase wild-type and mutant and to consume sugared situation basically identical, E.C. 2.7.2.4./the homoserine dehydrogenase of overexpression sudden change can produce the Threonine of 1.2-1.5g/L, and the E.C. 2.7.2.4./homoserine dehydrogenase of overexpresses wild-type can only produce the Threonine of 0.9g/L, mutant is significantly improved than wild type strain production amount of threonine.
The production amount of threonine of table 2. process LAN AKIII wild-type and mutant
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. E.C. 2.7.2.4./homoserine dehydrogenase, the 253rd amino acids residue and/or the 406th amino acids residue that aminoacid sequence is corresponding to aminoacid sequence shown in SEQIDNO:2 of described E.C. 2.7.2.4./homoserine dehydrogenase are undergone mutation.
2. E.C. 2.7.2.4./homoserine dehydrogenase as claimed in claim 1, it is characterized in that, described E.C. 2.7.2.4./homoserine dehydrogenase is:
A. the 253rd amino acids residue of its aminoacid sequence aminoacid sequence as shown in SEQIDNO:2 and shown in SEQIDNO:2 and/or the 406th amino acids residue are undergone mutation, or
B. there is sequence that a limits and position beyond the 253rd and the 406th through one or several amino-acid residue, the replacement of preferred 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino-acid residue, disappearance or interpolation and the sequence that formed, and there is the E.C. 2.7.2.4./homoserine dehydrogenase derived by a of E.C. 2.7.2.4./homoserine dehydrogenase function that a limits substantially.
3. E.C. 2.7.2.4./homoserine dehydrogenase as claimed in claim 1 or 2, it is characterized in that, described E.C. 2.7.2.4./homoserine dehydrogenase is:
A. its aminoacid sequence is as shown in SEQIDNO:4 or 6; Or
B. comprise sequence that a limits and position beyond the 253rd and the 406th through one or several amino-acid residue, the replacement of preferred 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino-acid residue, disappearance or interpolation and the sequence that formed, and there is the E.C. 2.7.2.4./homoserine dehydrogenase derived by a of E.C. 2.7.2.4./homoserine dehydrogenase function that a limits substantially.
4. E.C. 2.7.2.4./homoserine dehydrogenase as claimed in claim 1 or 2, it is characterized in that, the aminoacid sequence of described E.C. 2.7.2.4./homoserine dehydrogenase is as shown in SEQIDNO:4.
5. the gene of E.C. 2.7.2.4./homoserine dehydrogenase according to any one of coding claim 1-4.
6. comprise the expression vector of encoding gene described in claim 5.
7. a host cell, described host cell contains encoding gene according to claim 5 or expression vector according to claim 6.
8. E.C. 2.7.2.4./homoserine dehydrogenase according to any one of claim 1-4, or encoding gene according to claim 5, or expression vector according to claim 6 or host cell according to claim 7 are producing the application in L-threonine or ILE.
9. prepare a method for L-threonine or ILE, said method comprising the steps of:
A. cultivate host cell according to claim 7, make it to produce L-threonine or ILE; With
B. from nutrient solution, L-threonine or ILE is separated.
10. transform the method that wild-type aspartate kinase/homoserine dehydrogenase makes it to remove Threonine feedback inhibition, said method comprising the steps of:
A. aminoacid sequence shown in the aminoacid sequence of wild-type aspartate kinase/homoserine dehydrogenase and SEQIDNO:2 is compared; With
B. transform the encoding sequence of described wild-type aspartate kinase/homoserine dehydrogenase, to make to correspond in the aminoacid sequence of encoding shown in SEQIDNO:2 the 253rd of aminoacid sequence the and/or the amino-acid residue of 406 undergo mutation;
C. the host cell that the encoding sequence direct transfection obtained by b is suitable or introduce suitable host cell through carrier;
D. the host cell that c obtains is cultivated;
E. from the culture system that steps d obtains, be separated E.C. 2.7.2.4./homoserine dehydrogenase that described host cell produces; With
F. the ability that described E.C. 2.7.2.4./homoserine dehydrogenase removes Threonine feedback inhibition is measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410494708.7A CN105505894A (en) | 2014-09-24 | 2014-09-24 | Aspartokinase/homoserine dehydrogenase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410494708.7A CN105505894A (en) | 2014-09-24 | 2014-09-24 | Aspartokinase/homoserine dehydrogenase mutant and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105505894A true CN105505894A (en) | 2016-04-20 |
Family
ID=55714189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410494708.7A Pending CN105505894A (en) | 2014-09-24 | 2014-09-24 | Aspartokinase/homoserine dehydrogenase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105505894A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182319A (en) * | 2018-08-20 | 2019-01-11 | 浙江大学 | A kind of threonine deaminase mutant and its preparation method and application |
| CN109295028A (en) * | 2018-11-05 | 2019-02-01 | 吉林农业大学 | The preparation method of high enzyme activity aspartokinase enzyme mutant, engineering bacteria and the mutant |
| CN110129294A (en) * | 2018-02-02 | 2019-08-16 | 中国科学院天津工业生物技术研究所 | Homoserine acetyltransferase mutant and its host cell and application |
| CN110945121A (en) * | 2018-05-28 | 2020-03-31 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or L-amino acid derived from homoserine using the same |
| CN111601886A (en) * | 2018-12-21 | 2020-08-28 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or homoserine-derived L-amino acid using the same |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1266905A (en) * | 1999-02-20 | 2000-09-20 | 德古萨－于尔斯股份公司 | Method for producing L-amino acid by fermentation with corynebacteria |
| CN1954067A (en) * | 2004-05-12 | 2007-04-25 | 代谢探索者公司 | Recombinant enzyme for changing feed-back sensitivity |
| CN101198702A (en) * | 2005-06-29 | 2008-06-11 | 味之素株式会社 | Method for producing L-threonine |
| EP2036979A1 (en) * | 2007-09-15 | 2009-03-18 | Evonik Degussa GmbH | Method for manufacturing L-amino acids using improved strains of the enterobacteriaceae family |
| CN103773745A (en) * | 2012-10-18 | 2014-05-07 | 中粮生物化学（安徽）股份有限公司 | Aspartokinase III mutant, and host cell and application thereof |
-
2014
- 2014-09-24 CN CN201410494708.7A patent/CN105505894A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1266905A (en) * | 1999-02-20 | 2000-09-20 | 德古萨－于尔斯股份公司 | Method for producing L-amino acid by fermentation with corynebacteria |
| CN1954067A (en) * | 2004-05-12 | 2007-04-25 | 代谢探索者公司 | Recombinant enzyme for changing feed-back sensitivity |
| CN101198702A (en) * | 2005-06-29 | 2008-06-11 | 味之素株式会社 | Method for producing L-threonine |
| EP2036979A1 (en) * | 2007-09-15 | 2009-03-18 | Evonik Degussa GmbH | Method for manufacturing L-amino acids using improved strains of the enterobacteriaceae family |
| CN103773745A (en) * | 2012-10-18 | 2014-05-07 | 中粮生物化学（安徽）股份有限公司 | Aspartokinase III mutant, and host cell and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| JIN-HO LEE ET AL: "Global Analyses of Transcriptomes and Proteomes of a Parent Strain and anl-Threonine-Overproducing Mutant Strain", 《JOURANL OF BACTERIOLOGY》 * |
| K OMORI ET AL: "Role of serine 352 in the allosteric response of Serratia marcescens aspartokinase I-homoserine dehydrogenase I analyzed by using site-directed mutagenesis", 《JOURANL OF BACTERIOLOGY》 * |
| KENJI OMORI ET AL: "Nucleotide sequence of the Serratia marcescens threonine operon and analysis of the threonine operon mutations which alter feedback inhibition of both aspartokinase I and homoserine dehydrogenase I", 《JOURNAL OF BACTERIOLOGY》 * |
| 无: "Method for producing L-threonine", 《REARCH DISCCLOSURE DATABASE》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129294A (en) * | 2018-02-02 | 2019-08-16 | 中国科学院天津工业生物技术研究所 | Homoserine acetyltransferase mutant and its host cell and application |
| CN110129294B (en) * | 2018-02-02 | 2021-12-24 | 中国科学院天津工业生物技术研究所 | Homoserine acetyltransferase mutant and host cell and application thereof |
| CN110945121A (en) * | 2018-05-28 | 2020-03-31 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or L-amino acid derived from homoserine using the same |
| CN110945121B (en) * | 2018-05-28 | 2021-09-28 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or L-amino acid derived from homoserine using the same |
| CN109182319A (en) * | 2018-08-20 | 2019-01-11 | 浙江大学 | A kind of threonine deaminase mutant and its preparation method and application |
| CN109295028A (en) * | 2018-11-05 | 2019-02-01 | 吉林农业大学 | The preparation method of high enzyme activity aspartokinase enzyme mutant, engineering bacteria and the mutant |
| CN109295028B (en) * | 2018-11-05 | 2021-12-17 | 吉林农业大学 | High-enzyme-activity aspartokinase mutant, engineering bacterium and preparation method of mutant |
| CN111601886A (en) * | 2018-12-21 | 2020-08-28 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or homoserine-derived L-amino acid using the same |
| CN111601886B (en) * | 2018-12-21 | 2021-11-23 | Cj第一制糖株式会社 | Modified homoserine dehydrogenase and method for producing homoserine or homoserine-derived L-amino acid using the same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105505894A (en) | Aspartokinase/homoserine dehydrogenase mutant and application thereof | |
| EP2990483A1 (en) | Psicose epimerase mutant and method for preparing psicose by using same | |
| CA2888606C (en) | Asparaginic acid kinase iii mutant and host cells and use thereof | |
| CN107603937B (en) | Recombinant escherichia coli for expressing lysine aminopeptidase and construction method thereof | |
| CN105296456B (en) | A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application | |
| CN107164352B (en) | Novel lysine decarboxylase mutants and uses thereof | |
| CN110139930A (en) | Saltant type nitrile hydratase, the nucleic acid for encoding the saltant type nitrile hydratase, the expression vector containing the nucleic acid and transformant, the manufacturing method of the saltant type nitrile hydratase and amide compound manufacturing method | |
| CN113166752A (en) | Lactic acid producing transformant of hydrogenophilus bacteria | |
| CN110229774B (en) | Arginine decarboxylase gene engineering bacterium and high-density fermentation culture method thereof | |
| CN108368477A (en) | The membrane permeability of modification | |
| CN101336292B (en) | Method for production of L-glutamine | |
| CN106978405B (en) | Aspartokinase/homoserine dehydrogenase mutant and application thereof | |
| CN110195088B (en) | Arginine hydrolase, and coding gene and application thereof | |
| WO2022078127A1 (en) | Polypeptide with aspartate kinase activity and use thereof in production of amino acid | |
| TWI789734B (en) | Novel promoter and method of producing glutathione using the same | |
| CN110283796B (en) | MviN protein mutant, the expression vector containing the mutant and host cell and its application | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN110157691A (en) | 5-aminolevulinate synthetase mutant and its host cell and application | |
| CN110331121B (en) | Recombinant bacterium for high-yield lipopeptide and application thereof | |
| CN110129294A (en) | Homoserine acetyltransferase mutant and its host cell and application | |
| CN113584054B (en) | DNA molecules encoding arginine deiminase and uses thereof | |
| RU2821273C1 (en) | Variant of glutamate cysteine ligase and method of producing glutathione using same | |
| RU2806289C1 (en) | New promoter and a method of producing glutathione using it | |
| RU2793368C1 (en) | New version of the transcription regulator and a method for obtaining l-valine with its use | |
| RU2756113C1 (en) | Recombinant plasmid dna pmf230-gsmt/dmt encoding chimeric betaine biosynthesis enzyme and recombinant strain of pseudomonas denitrificans/pmf230-gsmt/dmt - betaine producer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160420 |
|
| WD01 | Invention patent application deemed withdrawn after publication |