CN110283796B

CN110283796B - MviN protein mutant, the expression vector containing the mutant and host cell and its application

Info

Publication number: CN110283796B
Application number: CN201910787948.9A
Authority: CN
Inventors: 孙际宾; 李庆刚; 周文娟; 德莱奥西班乔·泰沃; 郑平; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2019-08-26
Filing date: 2019-08-26
Publication date: 2019-11-05
Anticipated expiration: 2039-08-26
Also published as: WO2021035793A1; CN110283796A

Abstract

The present invention discloses a kind of protein mutant and the recombinant bacterial strain containing the protein mutant encoding gene, it is that amino acid mutation is introduced by the specific site of the amino acid sequence in MviN albumen, the ability that bar bacterium produces glutamic acid, lysine is improved, inversion rate of glucose greatly improves.

Description

MviN protein mutant, the expression vector containing the mutant and host cell and its Using

Technical field

The invention belongs to genetic engineering fields, more particularly to the mutant of membrane spanning lipids II flippase (MviN), and Application of the mutant in terms of production glutamic acid, lysine.

Background technique

Glutamic acid, lysine are the important nutrients of human and animal, in the row such as medicine, health, food, animal feed There is highly important status in industry, is mainly produced using microbe fermentation method.In recent years, as the core of fermentation industry, The renovation technique of fermenting microbe is continually developed, and people are usually metabolized directly related way to it in the synthesis process of a certain compound Diameter (including substrate transport, product transport, energy production etc.) is transformed.Existing numerous studies report and Amino acid synthesis way The closely related module transformation of diameter, such as release the product feedback inhibition of key enzyme, reduction competition sexual approach, reinforce substrate or production Object transport etc., the acid producing ability of industrial producing strain also thus be greatly improved.Although current glutamic acid, lysine industry Bacterial strain has reached high level, however further increases bacterial strain acid yield, and especially (raw material is converted into product to raising conversion ratio Percentage), the demand for reducing production cost is still very urgent.But it is enterprising in high-caliber glutamic acid, Strains for Lysine Production One step is promoted, and even small elevation is all very difficult.

At present for fewer to the transformation of the unobvious relevant gene of Amino acid synthesis.The reason is that well-known Cell is a complicated metabolism network aggregate, influences to be unpredictable caused by bacterial strain the transformation of uncorrelated gene 's；In addition it is excavated from numerous genes huge to the difficulty of glutamic acid, the possible relevant transformation target spot of lysine production.

Membrane spanning lipids II flippase (MviN), the final step of catalysis peptide glycan (PG) synthesis, by lipid II out of cytoplasm Film transporte to cells periplasmic space makes newborn PG be cross-linked to form mature PG.The MviN in corynebacterium source is ground at present Study carefully it is less, an only patent (JP2010161970A) disclose in the albumen 3 amino acid residues (197,260, 181) glutamic acid yield of Corynebacterium glutamicum can be improved in mutation, but its glutamic acid yield increase rate is very low, and it sets out Bacterial strain is compared and only improves only 1-5%(product percentages), and the influence to conversion ratio is not reported then.

Summary of the invention

The purpose of the present invention is to provide new MviN protein mutants, and significantly improve place using the protein mutant Main bacterial strain production glutamic acid, lysine conversion ratio method.

In a first aspect, the present invention provides a kind of membrane spanning lipids II flippase (MviN) protein mutant, amino acid sequence Column include selected from the following group:

A) amino acid sequence is corresponding to SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ 346th proline of amino acid sequence shown in ID NO:8 is any is replaced by leucine, or by other aliphatic hydrocarbon side chain amino It is any replaced in sour such as isoleucine, valine or alanine；Or

B) amino acid sequence is corresponding to SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ 599th valine of amino acid sequence shown in ID NO:8 is any is replaced by phenylalanine or tryptophan.

In one embodiment, the MviN protein mutant further comprise or do not include other sites mutation. For example, the MviN protein mutant includes the conservative mutation from above-mentioned amino acid sequence, and the MviN albumen Mutant keeps activity of the lipid II from cytoplasm membrane transport to periplasmic space.

Second aspect, the present invention provides the encoding genes of the MviN protein mutant described in first aspect.

The third aspect, the present invention provides the expression loads for including MviN protein mutant encoding gene described in second aspect Body；In one embodiment, the expression vector is built-up, example that the nucleotide sequence of encoding gene is connected with plasmid As the plasmid is selected from pEC-XK99E.

Fourth aspect, the present invention provides a kind of host cells of MviN protein mutant described in expression first aspect.

In a preferred embodiment, the host cell for expressing the mutant includes expression vector described in the third aspect Or it is integrated with the nucleotide sequence of encoding gene described in second aspect in its genome.In one embodiment, by institute It states expression vector to import in original host cell, forms the host cell for containing the mutant code gene.

In further preferred embodiment, the original host cell comes from Escherichia (Escherichia), corynebacterium (Corynebacterium), general Pseudomonas (Pantoea), brevibacterium (Brevibacterium sp), bacillus (Bacillus), Klebsiella (Klebsiella), Serratia (Serratia) or vibrio (Vibrio).It is preferred that Escherichia coli (E. Coli) or corynebacterium glutamicum (Corynebacterium glutamicum), more preferable corynebacterium glutamicum (Corynebacterium glutamicum).

5th aspect, the present invention provide coding described in MviN protein mutant described in first aspect or second aspect Host cell described in expression vector described in gene or the third aspect or fourth aspect is in production glutamic acid, lysine Using.

At the 6th aspect, the present invention provides a kind of method for preparing glutamic acid or lysine, and the method includes following steps It is rapid:

A. host cell described in fourth aspect is constructed；

B. the host cell of incubation step a building, is allowed to generate the culture solution containing glutamic acid or lysine；With

C. the glutamic acid or lysine of generation are optionally separated from the culture solution of step b.

Beneficial effects of the present invention

1. the present invention provides new MviN protein mutant, amino acid mutation of the mutant through specific site, energy Improve glutamic acid, lysine yield and significantly improve inversion rate of glucose.

The present invention provides the transformation target spots of new MviN albumen, can improve the speed of growth of bacterial strain, reduce glutamic acid, rely The production cost of propylhomoserin.

Specific embodiment

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.

In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition such as Sambrook et al., Molecular cloning: institute in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) The condition stated, or according to condition proposed by device fabrication manufacturer.

Definition and explanation:

The term as used herein " membrane spanning lipids II flippase " and " memebrane protein ", " murein biosynthesis Protein ", " MviN albumen ", " albumen of the invention ", " polypeptide of the invention " are used interchangeably, and have this field common The normally understood meaning of technical staff.

" MviN albumen " of the invention refers to a kind of membrane spanning lipids II flippase, is catalyzed peptide glycan (PG) synthesis last Step, by lipid II from cytoplasm membrane transport to periplasmic space.MviN albumen can derive from various species, including but unlimited In Escherichia (Escherichia), corynebacterium (Corynebacterium), general Pseudomonas (Pantoea), brevibacterium Belong to (Brevibacterium), bacillus (Bacillus), Klebsiella (Klebsiella), Serratia (Serratia) or vibrio (Vibrio).About the present invention, MviN albumen source is in corynebacterium, such as SEQ ID NO:2 Or the corresponding albumen of any amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8；It can also be with It is containing any amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 And have by lipid II from cytoplasm membrane transport to periplasmic space active polypeptide；Can also be with SEQ ID NO:2 or Any amino acid sequence homology shown in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 is greater than 90%, preferably 95%, more preferable 98% or more from corynebacterium and with lipid II is living from cytoplasm membrane transport to periplasmic space The polypeptide of property.

" MviN protein mutant " of the invention refers to by amino acid sequence such as SEQ ID NO:2 or SEQ ID Any amino acid sequence shown in NO:4 or SEQ ID NO:6 or SEQ ID NO:8 carries out mutation acquisition.Specifically, this hair Bright MviN protein mutant is that amino acid sequence is corresponding to SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 Or the 346th proline of any amino acid sequence shown in SEQ ID NO:8 is replaced by leucine, or is corresponding to SEQ The 599th of any amino acid sequence shown in ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 Valine is replaced by phenylalanine；Or MviN protein mutant of the invention is the amino acid sequence for including above-mentioned mutational site Segment.About the present invention, it is also possible to containing SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID Any amino acid sequence shown in NO:8 and have by lipid II from cytoplasm membrane transport to periplasmic space active polypeptide； Can also include and any amino shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 Acid sequence homology is greater than 90%, and preferably 95%, most preferably 98% or more from Corynebacterium glutamicum and has lipid II from born of the same parents Matter membrane transport to the active polypeptide in cytoplasm week gap, as long as its correspond to SEQ ID NO:2 or SEQ ID NO:4 or 346th proline of any amino acid sequence shown in SEQ ID NO:6 or SEQ ID NO:8 is replaced by leucine, or right It should shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 any amino acid sequence 599th valine is replaced by phenylalanine, also within the scope of the invention.

Currently, that has announced in ncbi database (https: //www.ncbi.nlm.nih.gov/) derives from paddy ammonia The amino of " membrane spanning lipids II flippase " (partial sequence annotation is hypothesis albumen or memebrane protein in database) of sour bar bacterium Acid sequence shares 22, wherein only the homology of a sequence and sequence shown in SEQ ID NO:2 of the invention is 93%, remaining The homology of 21 sequences and sequence shown in SEQ ID NO:2 of the invention is all larger than 98%；Also, 22 whole sequences exist The 346th corresponding to sequence shown in SEQ ID NO:2 is proline, is corresponding to sequence described in SEQ ID NO:2 599th is valine.As it can be seen that in corynebacterium glutamicum, membrane spanning lipids II flippase is highly conserved, and in correspondence The 346th of the sequence shown in SEQ ID NO:2 or the 599th is also highly conserved.Further, the present invention is to deriving from 4 " membrane spanning lipids II flippase " sequences of Corynebacterium glutamicum are transformed, the results show that by any bar in this 4 346th proline of sequence sports leucine, or by the 599th valine mutation is phenylalanine, can be improved paddy Propylhomoserin, lysine yield and significantly improve inversion rate of glucose.Therefore, based on the above reasons, other and SEQ ID NO:2 Shown sequence homology is greater than 98% and derives from the polypeptide of Corynebacterium glutamicum, as long as it is corresponding to SEQ ID NO:2 institute Show that the 346th proline of sequence is replaced by leucine, or in the 599th corresponding to sequence shown in SEQ ID NO:2 Valine replaced by phenylalanine, be within the scope of the invention.

The term as used herein " host cell " is with the normally understood meaning of those of ordinary skill in the art, that is, is contained There are MviN albumen of the present invention or the cell of its mutant.In other words, the present invention can use any host cell, as long as institute It states in cell containing MviN albumen of the present invention or its mutant and the cell for being able to produce amino acid.The host cell Can come from Escherichia (Escherichia), corynebacterium (Corynebacterium), general Pseudomonas (Pantoea), Brevibacterium (Brevibacterium sp), bacillus (Bacillus), Klebsiella (Klebsiella), it is husky Thunder Bordetella (Serratia) or vibrio (Vibrio).It is preferred that Escherichia coli (E. Coli) or corynebacterium glutamicum (Corynebacterium glutamicum), most preferably corynebacterium glutamicum (Corynebacterium glutamicum).Specifically, host of the present invention refers to the bacterial strain for being able to produce glutamic acid, lysine.

The meaning that there are the term as used herein " containing MviN of the invention " those skilled in the art routinely to understand, and It can be implemented by methods known in the art, including but not limited to, such as: by the more of the polynucleotide sequence comprising coding albumen In nucleotides inserted to chromosome, or polynucleotides are cloned on carrier and introduce microorganism, or directly increased on chromosome The methods of copy of the polynucleotides realizes, can also without limitation include that any of can introduce protein active Method.

The term as used herein " activity with MviN albumen " is identical as the meaning that those skilled in the art routinely understand Or it is similar, each mean that the amino acid sequence of a certain segment is a part of the amino acid sequence of intact proteins or polypeptide, have with Intact proteins or the same or similar function of polypeptide or activity.Specifically, in the present invention, indicating from MviN egg of the invention White acquisition has MviN albumen arbitrary amino acid segment with the same function.It should be understood by one skilled in the art that Bioactivity will not substantially be changed in some regions of polypeptide, such as insignificant area change a few amino acids residue, for example, Suitably replacing the sequence that certain amino acid obtain will not influence its activity (reference can be made to Watson etc., Molecular Biology Of The Gene, fourth edition, 1987, The Benjamin/Cummings Pub. Co. P224).Therefore, this field is common Technical staff can implement this replacement and ensure that gained molecule still has required bioactivity.Therefore, to of the invention MviN makees further mutation and is still had the further mutant of MviN function to be obvious.For example, this field skill Art personnel increase or decrease several amino acid residues known in the either end of polypeptide, such as preferred 1-20 is a, more preferable 1-15 is a, The function for the mutant that more preferable 1-10 is a, 1-3 more preferable, most preferably 1 amino acid residue will not influence.For example, For convenient for purifying, technical staff's often 6 × His label on the either end band of obtained albumen, and this albumen and do not have 6 The albumen function having the same of × His label.In addition, the present invention should include the conservative mutation body of MviN of the invention.This A little conservative mutation bodies can basis, such as carry out amino acid substitution shown in following table and generate.

The present invention also provides the polynucleotides for encoding polypeptide of the present invention.Term " polynucleotides of coding polypeptide " can be Polynucleotides including encoding this polypeptide, be also possible to further include additional code and/or non-coding sequence polynucleotides.

Coding MviN albumen gene can be under strict conditions with SEQ ID NO:1 or SEQ ID NO:3 or The probe of the preparation of any nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:7, for example, with SEQ ID NO:1 or SEQ The partly or completely sequence complementation of any nucleotide sequence shown in ID NO:3 or SEQ ID NO:5 or SEQ ID NO:7 The DNA of sequence hybridization, as long as keeping its Elementary Function." the stringent condition " refers to that can to form so-called specificity miscellaneous The condition of friendship and not formed non-specific hybridization.For example, the higher DNA of homology, such as the DNA with 90% or more homology Hybridize each other, the cleaning condition of condition or common Southern hybridization that DNA of the homology lower than 90% does not hybridize each other, It is being equivalent to 60 DEG C, 1*SSC, 0.1%SDS, preferably 60 DEG C, 0.1*SSC, 0.1%SDS, more preferable 68 DEG C, 0.1*SSC, 0.1% The salinity of SDS and at a temperature of clean 1 time, preferably 2-3 times condition.

Further, since the degeneracy of codon is different because of host, any codon in the gene of MviN albumen can be used Corresponding equivalent cipher replacement, that is to say, that MviN protein gene can be the degeneracy due to genetic code and above Such as any MviN protein gene mutation.For example, MviN protein gene can be modified gene, so that it is with root According to the best codon of codon frequency in host to be used.

In a particular embodiment, the MviN protein gene can be and coding SEQ ID NO:2 or SEQ ID The DNA homology or sequence identity of any amino acid sequence shown in NO:4 or SEQ ID NO:6 or SEQ ID NO:8 exist 90% or more, preferably 95% or more, more preferable 99% DNA.

Therefore, the MviN albumen specifically obtained based on the teachings of the present invention and the present invention, those skilled in the art are not rare To the active fragment with same or similar activity or function, such active fragment be can be mutational site of the invention (corresponding to the 346th of SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8, the 599th Position) it is mutated the active fragment obtained as other amino acid residues, it is also possible to (correspond to mutational site of the present invention The 346th, the 599th of SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8) it is adjacent Or close site be mutated obtained from active fragment, such active fragment should be considered as equivalent right of the invention and falls Enter in protection scope of the present invention.

The term as used herein " corresponding to " has the normally understood meaning of those of ordinary skill in the art.Specifically, " corresponding to " indicates specific bit of the two sequences after homology or sequence identity compare, in a sequence and another sequence Set corresponding position.Thus, for example, just " corresponding to SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ For 40th amino acid residue of any amino acid sequence shown in ID NO:8 ", if in SEQ ID NO:2 or SEQ One end of any amino acid sequence shown in ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 adds 6 × His label, that Correspond to shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 in gained mutant The 40th of any amino acid sequence may be the 46th.

In a particular embodiment, the homology or sequence identity can be 90% or more, preferably 95% or more, more It is preferred that 98% homology and derive from corynebacterium.

The method of measurement sequence homology known to a person of ordinary skill in the art or the phase same sex includes but is not limited to: calculating Machine molecular biology (Computational Molecular Biology), Lesk, A.M. are compiled, Oxford University Press, knob About, 1988；Biological computation: informatics and Genome Project (Biocomputing:Informatics and Genome Projects), Smith, D.W. are compiled, academic press, New York, and 1993；The computer of sequence data analyzes (Computer Analysis of Sequence Data), first part, Griffin, A.M. and Griffin, H.G. are compiled, Humana Press, New Jersey, 1994；Sequence in molecular biology analyzes (Sequence Analysis in Molecular Biology), von Heinje, G., academic press, 1987；Sequence analysis primer (Sequence Analysis Primer), Gribskov, M. and Devereux, J. volume M Stockton Press, New York, 1991；And Carillo, H. with Lipman, D., SIAM J. Applied Math., 48:1073(1988).The preferred method for measuring the phase same sex will be in test Maximum matching is obtained between sequence.The method of the measurement phase same sex is compiled in publicly available computer program.Preferably The computer program means of the phase same sex include but is not limited between measurement two sequences: GCG program bag (Devereux, J. etc., 1984), BLASTP, BLASTN and FASTA(Altschul, S, F. etc., 1990).The public can obtain from NCBI and other sources BLASTX program (BLAST handbook, Altschul, S. etc., NCBI NLM NIH Bethesda, Md.20894；Altschul, S. Deng 1990).Well known Smith Waterman algorithm can also be used for the measurement phase same sex.

Embodiment:

Embodiment 1 introduces MviN gene mutation in Corynebacterium glutamicum strain Z188 and B253 genome

To the Corynebacterium glutamicum Z188(GenBank Accession number:NZ_ for producing glutamic acid When AKXP00000000) carrying out mutagenesis screening, we obtain two plant mutant bacterium, and gene order-checking analysis is found, a plant mutant strain The C in the 1037th site of MviN gene nucleotide series corresponding to Z188 sports the corresponding amino acid of T(in the P in the 346th site Sport L), the G that another plant mutant strain corresponds to its 1795th site of MviN gene nucleotide series sports the corresponding ammonia of T( V of the base acid in the 599th site sports F).Paddy ammonia is produced to Z188 in order to test P346L and the V599F mutation of separate sources MviN Acid produces the influence of lysine with B253(GeneBank accession number CP010451), has selected from glutamic acid The MviN(of bar bacterium Z188 is named as MviNZ, and nucleotide and amino acid sequence are respectively SEQ ID NO:1 and SEQ ID NO: 2), the MviN(from Corynebacterium glutamicum B253 is named as MviNB, and nucleotide and amino acid sequence are respectively SEQ ID NO:3 and SEQ ID NO:4), derive from Corynebacterium glutamicum ATCC 13869(GeneBank accession number CP016335 MviN() is named as MviN9, and nucleotide and amino acid sequence are respectively SEQ ID NO:5 and SEQ ID NO: 6), from the MviN(life of Corynebacterium glutamicum ATCC 13032(GeneBank accession number CP025533) Entitled MviN2, nucleotide and amino acid sequence are respectively SEQ ID NO:7 and SEQ ID NO:8).

The MviN gene of Z188 and B253 is mutated using the method for homologous recombination.Utilize primer MF (SEQ ID NO:9 CCTCGAATTCATGAATGGTCAACAAGTGAGTTCTTC) and primer MR1 (SEQ ID NO:10 TCTACTGCAG TTACCAACCAACGAGTTGTACTTCAG), respectively with Z188,13869 genome of B253, ATCC is template, carries out PCR expansion Increase；Using primer MF and primer MR2 (SEQ ID NO:11 TCTACTGCAGTTACCAACCAACAAGTTGTACTTCAG), with 13032 genome of ATCC is template, carries out PCR amplification.Utilize restriction enzymeEcoRI andPstI to PCR fragment respectively into After row double digestion, it is connected respectively to the plasmid pK18mobsacB(GenBank Accession number of same double digestion: FJ437239 on), corresponding plasmid pK18-MviNZ, pK18-MviNB, pK18-MviN9, pK18-MviN2 are obtained.Utilize primer ATGCTGCGCCGTTTATTTAT(SEQ ID NO:12) and ATAAATAAACGGCGCAGCAT(SEQ ID NO:13), respectively with PK18-MviNZ, pK18-MviN9 and pK18-MviN2 are template, PCR amplification；Utilize primer TGATGCTGCACCGTTTATTT (SEQ ID NO:14) and AAATAAACGGTGCAGCATCA(SEQ ID NO:15), using pK18-MviNB as template, PCR expands Increase.Using one-step method directed cloning kit, (The ClonExpress II One Step Cloning kit, Nanjing promise is only Biotechnology Co., Ltd is praised, China), by PCR product respectively from connecting, obtain the P346L mutation of MviN on corresponding plasmid, mutation Plasmid afterwards is respectively designated as pK18-MviNZ^P346L, pK18-MviNB^P346L, pK18-MviN9^P346L, pK18-MviN2^P346L.Benefit With primer TCTGCCAGAGGTCCAAAACT(SEQ ID NO:16) and AGTTTTGGACCTCTGGCAGA(SEQ ID NO:17), Respectively with pK18-MviNZ, pK18-MviNB and pK18-MviN9 for template, PCR amplification；Utilize primer TTTGCCGGAGGTCCAAAACT(SEQ ID NO:18) and AGTTTTGGACCTCCGGCAAA(SEQ ID NO:19), with PK18-MviN2 is template, PCR amplification.Utilize one-step method directed cloning kit (The ClonExpress II One Step Cloning kit, Nanjing Vazyme Biotechnology Co., Ltd., China), by PCR product respectively from connecting, obtain on corresponding plasmid The V599F of MviN is mutated, and the plasmid after mutation is respectively designated as pK18-MviNZ^V599F, pK18-MviNB^V599F, pK18- MviN9^V599F, pK18-MviN2^V599F。

By plasmid pK18-MviNZ, pK18-MviNB, pK18-MviN9, pK18-MviN2, pK18-MviNZ^P346L, pK18- MviNB^P346L, pK18-MviN9^P346L, pK18-MviN2^P346L, pK18-MviNZ^V599F, pK18-MviNB^V599F, pK18- MviN9^V599F, pK18-MviN2^V599FIt is directed respectively into Z188 and B253 competence that (wherein, pK18-MviNZ is without importing Z188 In, pK18-MviNB is without importing in B253), utilize LBG culture medium (glucose 10g/L, yeast powder 5g/L, peptone 10g/ L, sodium chloride 10g/L) be incubated overnight after, selected on the LBG solid plate of (25 mg/L) containing kanamycin have block that The clone of chloramphenicol resistance.After picked clones, it is incubated overnight in the LBG fluid nutrient medium containing 10 g/L sucrose, coating contains The LBG solid plate of 10 g/L sucrose selects the clone that can be grown, and solid using the LBG of (25 mg/L) containing kanamycin Body plate verifies it and is lost kalamycin resistance gene to grow.The gene of obtained clone is expanded using MF and MR1, It is complete by the MviN of corresponding separate sources and its mutant by original MviN gene on sequencing selection Z188 or B253 genome The clone replaced entirely, to obtain bacterial strain Z188-MviNB, Z188-MviN9, Z188-MviN2, Z188-MviNZ^P346L, Z188- MviNB^P346L, Z188-MviN9^P346L, Z188-MviN2^P346L, Z188-MviNZ^V599F, Z188-MviNB^V599F, Z188- MviN9^V599F Z188-MviN2^V599FAnd bacterial strain B253-MviNZ, B253-MviN9, B253-MviN2, B253- MviNZ^P346L, B253-MviNB^P346L, B253-MviN9^P346L, B253-MviN2^P346L, B253-MviNZ^V599F, B253- MviNB^V599F, B253-MviN9^V599F, B253-MviN2^V599F。

Embodiment 2 utilizes the different MviN gene mutations of plasmid overexpression in Corynebacterium glutamicum strain Z188 and B253 Body

MviN gene and its mutant are cloned first from different strains.Utilize primer MV-F (SEQ ID NO:20 CT CGATGGAATTCCGTTAAGGCGCGCACTCGTAC) and MV-R(SEQ ID NO:21 CGCGGGATCCTTA ATGAATGGTC CCAACCAACGAGTTGTACTTCAGCGATC), respectively with Z188-MviNZ^P346L, Z188-MviNZ^V599F, B253- MviNB^P346L, B253-MviNB^V599FGenome is template, PCR amplification, and amplified production is used respectivelyEcoRI andBamHI double digestion, It is then separately connected to equally useEcoRI andBamPlasmid pEC-XK99E [Kirchner O, the Tauch A. J of HI double digestion Biotechnol. 2003,104 (1-3): 287-299] on, pEC-MviNZ is obtained respectively^P346LAnd pEC-MviNZ^V599F, with And pEC-MviNB^P346LAnd pEC-MviNB^V599F.In addition, willEcoRI andBamIt mends the end plasmid pEC-XK99E of HI double digestion From connecting after flat, the control plasmid for being free of MviN gene is obtained, pEC is named as.By plasmid pEC, pEC-MviNZ^P346LAnd pEC- MviNZ^V599FIt is transformed into Z188, obtains bacterial strain Z188 (pEC), Z188 (pEC-MviNZ respectively^P346L) and Z188 (pEC- MviNZ^V599F).By plasmid pEC, pEC-MviNB^P346LAnd pEC-MviNB^V599FIt is transformed into B253 respectively, obtains bacterial strain respectively B253 (pEC), B253 (pEC-MviNB^P346L) and B253 (pEC-MviNB^V599F)。

Embodiment 3, Corynebacterium glutamicum Z188 and its MviN gene mutation strain fermentation produce glutamic acid test

Z188 bacterial strain is tested using 96 orifice plates, bacterial strain Z188-MviNB, the Z188-MviN9 of MviN mutation on genome, Z188-MviN2, Z188-MviNZ^P346L, Z188-MviNB^P346L, Z188-MviN9^P346L, Z188-MviN2^P346L, Z188- MviNZ^V599F, Z188-MviNB^V599F, Z188-MviN9^V599F, Z188-MviN2^V599F, and be overexpressed MviNZ using plasmid and dash forward Bacterial strain Z188 (the pEC-MviNZ of variant^P346L) and Z188 (pEC-MviNZ^V599F) and its control strain Z188 (pEC), hair Ferment produces glutamate levels.Seed culture medium are as follows: 50 g/L of glucose, 0.7 g/L of phosphoric acid, 0.8 g/L of epsom salt, sulphur Sour 10 g/L of ammonium, 3- (N- Ma Lindai) propane sulfonic acid 84 g/L, 3 g/L of corn starch, 10 g/L of urea, 1 g/ of peptone L, 0.5 g/L of yeast powder are 7.0 with sodium hydroxide tune pH.Fermentation medium and seed culture medium are distinguished as fermentation medium In do not add peptone and yeast powder.It cultivates Z188 (pEC), Z188 (pEC-MviNZ^P346L) and Z188 (pEC- MviNZ^V599F) when, the isopropylthiogalactoside (IPTG) and final concentration of 25 μ g/L of final concentration of 0.1 mM is added Kanamycins.It after bacterial strain is incubated overnight in seed culture medium, is inoculated into fermentation medium with 10% inoculum concentration, 96 holes Contain 150 μ L fermentation mediums, 3 parallel laboratory tests of each bacterial strain in each hole of plate, cultivation temperature is 30 degrees Celsius, orifice plate Shaking speed is 800 rpm, and glutamic acid yield and the conversion ratio from glucose to glutamic acid are detected after culture 33 hours, and part is tied Fruit is as shown in Table 1 and Table 2.Position is mutated with P346L or V599F by introducing in the genome it can be seen from Tables 1 and 2 The separate sources MviN of point, and the MviN for having the mutational site P346L or V599F is overexpressed by plasmid, it can improve Bacterial strain produces the level of glutamic acid, and conversion ratio is opposite to improve 15.77-22.29%.In addition, relative to Z188, Z188-MviNB, Z188-MviN9 and Z188-MviN2 introduces the bacterial strain containing P346L or V599F point mutation in the genome, produces paddy ammonia The conversion ratio of acid is opposite to improve 9.06-22.18%.

The fermentation of 1 Z188 genome different mutants of table produces glutamate levels

Table 2 bacterial strain Z188 (pEC), Z188 (pEC-MviNZ^P346L) and Z188 (pEC-MviNZ^V599F) fermentation production paddy Propylhomoserin water

It is flat

Embodiment 4, Corynebacterium glutamicum B253 and its MviN gene mutation strain fermentation produce lysine test

Using 96 orifice plate test b, 253 bacterial strain, bacterial strain B253-MviNZ, the B253-MviN9 that MviN is mutated on genome, B253-MviN2, B253-MviNZ^P346L, B253-MviNB^P346L, B253-MviN9^P346L, B253-MviN2^P346L, B253- MviNZ^V599F, B253-MviNB^V599F, B253-MviN9^V599F, B253-MviN2^V599F, and be overexpressed MviNB using plasmid and dash forward Bacterial strain B253 (the pEC-MviNB of variant^P346L)、B253 (pEC-MviNB^V599F) and its control strain B253 (pEC) fermentation Produce lysine level.Using LBG as seed culture medium, fermentation medium composition are as follows: 80 g/L of glucose；8 g/ of yeast powder L；9 g/L of urea；K₂HPO₄1.5 g/L；MnSO₄0.01 g/L；MgSO₄0.6 g/L；FeSO₄0.01 g/L；MOPS 42 g/L.B253 (pEC) when culture, B253 (pEC-MviNB^P346L) and B253 (pEC-MviNB^V599F) when be added it is final concentration of The kanamycins of the IPTG of 0.1 mM and final concentration of 25 μ g/L.Strain inoculated is trained overnight into LBG culture medium first It supports, culture is inoculated into every hole as seed and contains in 96 hole deep-well plates of 150 μ L fermentation mediums, inoculum concentration 5%, and 30 DEG C Culture 48 hours, plate shaker revolving speed are 800 rpm, and 3 parallel laboratory tests of each bacterial strain detect lysine production after fermentation With the conversion ratio from glucose to lysine.It is as shown in Table 3 and Table 4 that plasmid is overexpressed MviNB mutant strain test result.It can To find out, it is overexpressed the MviN for having the mutational site P346L or V599F by plasmid, can be improved the water that bacterial strain produces lysine Flat, conversion ratio is opposite to improve 7.48%.Relative to B253, B253-MviNZ, B253-MviN9 and B253-MviN2, in gene The bacterial strain containing P346L or V599F point mutation is introduced in group, the conversion ratio for producing lysine improves 5.23-8.22% relatively.

3 B253 of table (pEC), B253 (pEC-MviNB^P346L) and B253 (pEC-MviNB^V599F) fermentation production lysine It is horizontal

The fermentation of 4 B253 genome different mutants of table produces lysine level

More than, embodiments of the present invention are illustrated.But the present invention is not limited to above embodiment.It is all Within the spirit and principles in the present invention, any modification, equivalent substitution, improvement and etc. done should be included in guarantor of the invention Within the scope of shield.

Sequence table

<110>Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences

<120>MviN protein mutant, the expression vector containing the mutant and host cell and its application

<130> CPCN19111016

<141> 2019-08-13

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3345

<212> DNA

<213> Corynebacterium

<400> 1

atgaatggtc aacaagtgag ttcttcgctt tcgaataatt cggagcagtc cggcctgcgt 60

agcaggatcg ttgctccagc accgccggcg cctgtgcccg aggcgcgcaa gaaggctgtc 120

gcacgcacgg atggtgatcg ctcgagtttg aaaaactcgc ctacggcatc cgccacccag 180

gcagcccaga cgcgcccggc agaaccggaa ccagaaaagc acacctccga ttctgatgtg 240

gtgcgctcga ctggctccat ggcaatagcc acgctgctga gtcgtatcac cggtttcctg 300

cgcaccgtga tgattggtgc ggcgctgtcg ccggctatcg cgtcggcgtt caacactgcc 360

aacacgctgc ccaacctgat cactgaaatc gtgttgggtg cggtgctgac atcgctggtt 420

attccggtgc ttacccgcgc ggaaaaggaa gacgccgacg gcggttccgg gttcttcagg 480

cggctgctca ccctgtcggt gacgctgctg ggtggtgtca ccatcctgtc gattatcggc 540

gcgccgctgc tgacacggat gatgctgtcc tctgagggac aagtcaacgt ggtcatgtcc 600

acggcctttg cgtattggct gctgccacag attttcttct acggcctgtt tgccctgttc 660

atggctgtgt tgaacacccg tgaagtgttc aaacccggcg cgtgggcacc tgttgtcaac 720

aatgtgatca ccttgaccgt gctgggcgtg tacatggtgc tgcctgcgcg tttgcacccg 780

catgagcagg tgggcatttt tgatccgcag atcgttttcc tcggcgtggg caccaccctt 840

ggtgtggttg cacagtgtct aatcatgatt ccgtacctgc gtcgcgcggg cattgatatg 900

cgcccactgt ggggtatcga tgcgcgtttg aagcagttcg gtggcatggc catggcgatc 960

atcgtgtacg tggcgatctc ccagttcggt tacatcatca ccactcgtat tgcctcactg 1020

gcagacgatg ctgcgccgtt tatttatcag cagcactgga tgttgctgca agttccttat 1080

ggcatcatcg gcgtcacctt gctcaccgcg attatgccgc gactgtcccg caacgcggca 1140

gacggcgatg atagggcagt agtctctgac cttcagttgg gttctaagct aaccttcatc 1200

gcactgatcc ccatcgtggt gtttttcacc gccttcggtg tccctattgc caatggcctt 1260

tttgcctacg gccaattcga tgccaacgcc gccaacatcc ttggttggac tctgagcttc 1320

tctgctttca cgctgattcc ttacgctttg gtgctgctac atctgcgtgt gttttatgcg 1380

cgtgaagagg tctggacccc aaccttcatc atcgccggca tcaccgccac caaggtcgtg 1440

ctgtccctgt tggcaccgct gctctcgagc tccccagagc gcgtagtagt tcttcttggt 1500

gcggccaacg gcttcagttt catcaccggc gcggtcatcg gcgcgtatct gttacgcaag 1560

aaactcggcc tgttgggtat gcgctctttg gctaaaacct ccctgtgggc gttgggctct 1620

gcggcggttg gtgcagcagc agcatgggcg ttggggtggc tgattcaagc cgtcgtgggc 1680

gatttcttgc tgggcactct aagctccgta ggctacttgt tgtacctggc tgtgctgggt 1740

gtcttcttca tcatcgtcac cggcatcgtg ctgtcacgtt ctggtctgcc agaggtccaa 1800

aacttaggcc aggcactgac ccgcatcccg ggtatgggtc gctttattcg cccgaacacc 1860

aagatctctt tggatgtcgg cgaagtctcc cagcaggatt tctccaccca gctggtcgca 1920

ccaagcgagt tctccgcaac ccctgttccg ccaccaatgt ctgccggtat tgtccgcgga 1980

cctcgcctgg ttccgggtgc cccagtcagc gacggtcgct tccgcttgct cgccgatcac 2040

ggcggcgtcc agggtgcgcg tttctggcag gcccgcgaga tcgccaccgg caaggaagtc 2100

gcgctgatct ttgtggatac ttccggcaac gccccatttg cgccactgtc ttcggcagcc 2160

gcagcgggca tcgcctacga ggtgcagcgc cgcaccaaga agctggccag cttgggcagc 2220

ttggcggtgg cccccaatat ccactccgag gcgtaccgca acggttgcct cattgtggcc 2280

gattgggtgc ctggctccag cttgagcgcc gtcgcggaat ccggtgccga tccccgcgcc 2340

gccgcgttcg cgctcgcgga actaactgaa accatcggcg aggcccacga gatgggtatc 2400

ccggccggct tggacaacaa gtgccgcatc cgcatcaaca ccgacggcca tgccgtcctc 2460

gccttcccgg cgattttgcc caatgcctca gagctccgcg acgccaagtc cctggcctcg 2520

gccgccgaga tgcttatcga cgcgaccctc gctcccagcg acgtcaaggc aatggtcact 2580

gaagcccagg ggctagctac agaagacaat cccgattacg catcacttgc catggcgatg 2640

cgcacctgcg gactgttcac cgaggaacca acccaccttg tggtgaagaa ggaaaagaca 2700

ccaaagcctg cgacacgtga tggtttcggt gcctccgact acaccgtcaa gggcatggca 2760

gccatcgccg ctgtggtgat catcttggtc tccctggtgg ctgccggtac cgcgttcctc 2820

accagcttct tcggcagcag caccaacgaa caatccccgt tggcctctgt tgaagccacc 2880

acttctgcaa caccagaacc tgtggggcca ccggtctacc tggatctgga tcaagcccgc 2940

acgtgggatg acggtgcagg aacagatgtc accgacgtca ccgacggcaa cacctccacc 3000

gcatggacct ccaccggcgg cgacggcctc ctagttgacc tgtccacgcc tgcccgcctc 3060

gaccgcgtca tcttgaccac cggcaccggc tccgacagca acgtgacctc gaccgtgaag 3120

atctacgcat tcaacgacgc ctcaccacac tccctgtcgg aaggcatcga gatcggcacc 3180

gtggattatt ccggccgcag tctcagccac agcatccgtg attcctccaa gcttccgggt 3240

caggtggaat ccgtggtgat tctggtcgat gaggttcatt cctcacaaac ctcagacacc 3300

aatccacaga tgcagatcgc tgaagtacaa ctcgttggtt ggtaa 3345

<210> 2

<211> 1114

<212> PRT

<213> Corynebacterium

<400> 2

Met Asn Gly Gln Gln Val Ser Ser Ser Leu Ser Asn Asn Ser Glu Gln

1 5 10 15

Ser Gly Leu Arg Ser Arg Ile Val Ala Pro Ala Pro Pro Ala Pro Val

20 25 30

Pro Glu Ala Arg Lys Lys Ala Val Ala Arg Thr Asp Gly Asp Arg Ser

35 40 45

Ser Leu Lys Asn Ser Pro Thr Ala Ser Ala Thr Gln Ala Ala Gln Thr

50 55 60

Arg Pro Ala Glu Pro Glu Pro Glu Lys His Thr Ser Asp Ser Asp Val

65 70 75 80

Val Arg Ser Thr Gly Ser Met Ala Ile Ala Thr Leu Leu Ser Arg Ile

85 90 95

Thr Gly Phe Leu Arg Thr Val Met Ile Gly Ala Ala Leu Ser Pro Ala

100 105 110

Ile Ala Ser Ala Phe Asn Thr Ala Asn Thr Leu Pro Asn Leu Ile Thr

115 120 125

Glu Ile Val Leu Gly Ala Val Leu Thr Ser Leu Val Ile Pro Val Leu

130 135 140

Thr Arg Ala Glu Lys Glu Asp Ala Asp Gly Gly Ser Gly Phe Phe Arg

145 150 155 160

Arg Leu Leu Thr Leu Ser Val Thr Leu Leu Gly Gly Val Thr Ile Leu

165 170 175

Ser Ile Ile Gly Ala Pro Leu Leu Thr Arg Met Met Leu Ser Ser Glu

180 185 190

Gly Gln Val Asn Val Val Met Ser Thr Ala Phe Ala Tyr Trp Leu Leu

195 200 205

Pro Gln Ile Phe Phe Tyr Gly Leu Phe Ala Leu Phe Met Ala Val Leu

210 215 220

Asn Thr Arg Glu Val Phe Lys Pro Gly Ala Trp Ala Pro Val Val Asn

225 230 235 240

Asn Val Ile Thr Leu Thr Val Leu Gly Val Tyr Met Val Leu Pro Ala

245 250 255

Arg Leu His Pro His Glu Gln Val Gly Ile Phe Asp Pro Gln Ile Val

260 265 270

Phe Leu Gly Val Gly Thr Thr Leu Gly Val Val Ala Gln Cys Leu Ile

275 280 285

Met Ile Pro Tyr Leu Arg Arg Ala Gly Ile Asp Met Arg Pro Leu Trp

290 295 300

Gly Ile Asp Ala Arg Leu Lys Gln Phe Gly Gly Met Ala Met Ala Ile

305 310 315 320

Ile Val Tyr Val Ala Ile Ser Gln Phe Gly Tyr Ile Ile Thr Thr Arg

325 330 335

Ile Ala Ser Leu Ala Asp Asp Ala Ala Pro Phe Ile Tyr Gln Gln His

340 345 350

Trp Met Leu Leu Gln Val Pro Tyr Gly Ile Ile Gly Val Thr Leu Leu

355 360 365

Thr Ala Ile Met Pro Arg Leu Ser Arg Asn Ala Ala Asp Gly Asp Asp

370 375 380

Arg Ala Val Val Ser Asp Leu Gln Leu Gly Ser Lys Leu Thr Phe Ile

385 390 395 400

Ala Leu Ile Pro Ile Val Val Phe Phe Thr Ala Phe Gly Val Pro Ile

405 410 415

Ala Asn Gly Leu Phe Ala Tyr Gly Gln Phe Asp Ala Asn Ala Ala Asn

420 425 430

Ile Leu Gly Trp Thr Leu Ser Phe Ser Ala Phe Thr Leu Ile Pro Tyr

435 440 445

Ala Leu Val Leu Leu His Leu Arg Val Phe Tyr Ala Arg Glu Glu Val

450 455 460

Trp Thr Pro Thr Phe Ile Ile Ala Gly Ile Thr Ala Thr Lys Val Val

465 470 475 480

Leu Ser Leu Leu Ala Pro Leu Leu Ser Ser Ser Pro Glu Arg Val Val

485 490 495

Val Leu Leu Gly Ala Ala Asn Gly Phe Ser Phe Ile Thr Gly Ala Val

500 505 510

Ile Gly Ala Tyr Leu Leu Arg Lys Lys Leu Gly Leu Leu Gly Met Arg

515 520 525

Ser Leu Ala Lys Thr Ser Leu Trp Ala Leu Gly Ser Ala Ala Val Gly

530 535 540

Ala Ala Ala Ala Trp Ala Leu Gly Trp Leu Ile Gln Ala Val Val Gly

545 550 555 560

Asp Phe Leu Leu Gly Thr Leu Ser Ser Val Gly Tyr Leu Leu Tyr Leu

565 570 575

Ala Val Leu Gly Val Phe Phe Ile Ile Val Thr Gly Ile Val Leu Ser

580 585 590

Arg Ser Gly Leu Pro Glu Val Gln Asn Leu Gly Gln Ala Leu Thr Arg

595 600 605

Ile Pro Gly Met Gly Arg Phe Ile Arg Pro Asn Thr Lys Ile Ser Leu

610 615 620

Asp Val Gly Glu Val Ser Gln Gln Asp Phe Ser Thr Gln Leu Val Ala

625 630 635 640

Pro Ser Glu Phe Ser Ala Thr Pro Val Pro Pro Pro Met Ser Ala Gly

645 650 655

Ile Val Arg Gly Pro Arg Leu Val Pro Gly Ala Pro Val Ser Asp Gly

660 665 670

Arg Phe Arg Leu Leu Ala Asp His Gly Gly Val Gln Gly Ala Arg Phe

675 680 685

Trp Gln Ala Arg Glu Ile Ala Thr Gly Lys Glu Val Ala Leu Ile Phe

690 695 700

Val Asp Thr Ser Gly Asn Ala Pro Phe Ala Pro Leu Ser Ser Ala Ala

705 710 715 720

Ala Ala Gly Ile Ala Tyr Glu Val Gln Arg Arg Thr Lys Lys Leu Ala

725 730 735

Ser Leu Gly Ser Leu Ala Val Ala Pro Asn Ile His Ser Glu Ala Tyr

740 745 750

Arg Asn Gly Cys Leu Ile Val Ala Asp Trp Val Pro Gly Ser Ser Leu

755 760 765

Ser Ala Val Ala Glu Ser Gly Ala Asp Pro Arg Ala Ala Ala Phe Ala

770 775 780

Leu Ala Glu Leu Thr Glu Thr Ile Gly Glu Ala His Glu Met Gly Ile

785 790 795 800

Pro Ala Gly Leu Asp Asn Lys Cys Arg Ile Arg Ile Asn Thr Asp Gly

805 810 815

His Ala Val Leu Ala Phe Pro Ala Ile Leu Pro Asn Ala Ser Glu Leu

820 825 830

Arg Asp Ala Lys Ser Leu Ala Ser Ala Ala Glu Met Leu Ile Asp Ala

835 840 845

Thr Leu Ala Pro Ser Asp Val Lys Ala Met Val Thr Glu Ala Gln Gly

850 855 860

Leu Ala Thr Glu Asp Asn Pro Asp Tyr Ala Ser Leu Ala Met Ala Met

865 870 875 880

Arg Thr Cys Gly Leu Phe Thr Glu Glu Pro Thr His Leu Val Val Lys

885 890 895

Lys Glu Lys Thr Pro Lys Pro Ala Thr Arg Asp Gly Phe Gly Ala Ser

900 905 910

Asp Tyr Thr Val Lys Gly Met Ala Ala Ile Ala Ala Val Val Ile Ile

915 920 925

Leu Val Ser Leu Val Ala Ala Gly Thr Ala Phe Leu Thr Ser Phe Phe

930 935 940

Gly Ser Ser Thr Asn Glu Gln Ser Pro Leu Ala Ser Val Glu Ala Thr

945 950 955 960

Thr Ser Ala Thr Pro Glu Pro Val Gly Pro Pro Val Tyr Leu Asp Leu

965 970 975

Asp Gln Ala Arg Thr Trp Asp Asp Gly Ala Gly Thr Asp Val Thr Asp

980 985 990

Val Thr Asp Gly Asn Thr Ser Thr Ala Trp Thr Ser Thr Gly Gly Asp

995 1000 1005

Gly Leu Leu Val Asp Leu Ser Thr Pro Ala Arg Leu Asp Arg Val Ile

1010 1015 1020

Leu Thr Thr Gly Thr Gly Ser Asp Ser Asn Val Thr Ser Thr Val Lys

1025 1030 1035 1040

Ile Tyr Ala Phe Asn Asp Ala Ser Pro His Ser Leu Ser Glu Gly Ile

1045 1050 1055

Glu Ile Gly Thr Val Asp Tyr Ser Gly Arg Ser Leu Ser His Ser Ile

1060 1065 1070

Arg Asp Ser Ser Lys Leu Pro Gly Gln Val Glu Ser Val Val Ile Leu

1075 1080 1085

Val Asp Glu Val His Ser Ser Gln Thr Ser Asp Thr Asn Pro Gln Met

1090 1095 1100

Gln Ile Ala Glu Val Gln Leu Val Gly Trp

1105 1110

<210> 3

<211> 3345

<212> DNA

<213> Corynebacterium

<400> 3

atgaatggtc aacaagtgag ttcttcgctt tcgaataatt cggagcagtc cggcctgcgt 60

ggcaggatcg ttgctccagc accgccggcg cctgtgcccg aggcgcgcaa gaaggctgtc 120

gcacgcacgg atggtgatcg ctcgagtttg aaaaactcgc ctacggcatc cgccacgcag 180

gcagcccaga cgcgtccagc agaaccggaa ccagaaaagc acacctccga ttctgatgtg 240

gtgcgctcga ctggctccat ggcaatagcc acgctgctga gtcgtatcac cggtttcctg 300

cgcaccgtga tgattggtgc ggcgctgtcg ccggctatcg cgtcggcgtt caacactgcc 360

aacacgctgc ccaacctgat cactgaaatc gtgttgggtg cggtgctgac atcgctggtt 420

attccggtgc ttacccgcgc ggaaaaggaa gacgccgacg gcggttccgg gttcttcagg 480

cggctactca ccctgtcggt tacgctgctg ggtggtgtca ccatcttgtc gattatcggc 540

gcgccgctgc tgacacggat gatgctgtcc tctgagggac aagtcaacgt ggtcatgtcc 600

acggcctttg cgtattggct gctgccacag attatcttct acggcctgtt tgccctgttc 660

atggctgtgt tgaacacccg tgaagtgttc aaacccggcg cgtgggcacc tgttgtcaac 720

aatgtgatca ccttgaccgt gctgggcgtg tacatggtgc tgcctgcgcg tttgcacccg 780

catgagcagg tgggcatttt tgatccgcag atcattttcc tcggcgtggg caccaccctt 840

ggtgtggttg cacagtgtct aatcatgatt ccgtacctgc gtcgcgcggg cattgatatg 900

cgccctctgt ggggtatcga tgcgcgtttg aagcaattcg gtggcatggc gatggcgatc 960

atcgtgtacg tggcaatctc ccagttcggt tacatcatca ccactcgtat tgcctcactg 1020

gcagatgatg ctgcaccgtt tatttatcag caacactgga tgttgttgca ggttccttat 1080

ggcatcatcg gcgtcacttt actcaccgcg attatgccgc gactgtcccg caacgccgcg 1140

gacggcgacg atagggcagt ggtctctgac cttcagttgg gttccaagct gaccttcatt 1200

gcattgatcc cgatcgtggt gtttttcacc gccttcggtg tgccgattgc caatggcctt 1260

tttgcctacg gccaattcga ttccaccgcc gctaacatcc ttggttggac gttgagcttc 1320

tctgctttca cgttgattcc ttacgctttg gtgctgctgc atttgcgtgt gttttatgcg 1380

cgtgaagagg tctggacccc aaccttcatc atcgccggca tcaccgccac caaggtcgtg 1440

ctttccctgt tggcaccgct gctctcgagc tccccagagc gtgtggtggt gcttcttggt 1500

gcggccaacg gcttcagttt catcaccggc gcggtcatcg gcgcgtatct gttgcgcaag 1560

aaactcggcc tgttgggtat gcgctctttg gctaaaacct ccctgtgggc gttgggctct 1620

gcggcggttg gtgcagcagc agcatgggcg ttggggtggc tgattcaagc cgtcgtgggc 1680

gatttcttgc tgggcactct aagctccgta ggctacttgt tgtacctggc tgtgttgggt 1740

gtcttcttca tcatcgtcac cggcatcgtg ctgtcacgtt ctggtctgcc agaggtccaa 1800

aacttaggcc aggcactgac ccgcatcccg ggtatgagtc gctttattcg cccgaacacc 1860

aagatctctt tggatgtcgg cgaagtctcc cagcaagatt tctccaccca gctggtcgca 1920

ccaagcgagt tctccgcaac ccctgttccg ccaccaatgt ctgccggtat tgtccgcgga 1980

cctcgcctgg ttccgggtgc cccagtcagc gacggtcgct tccgcttgct cgccgatcac 2040

ggcggcgtcc agggtgcgcg tttctggcag gcccgcgaga tcgccaccgg caaggaagtc 2100

gcgctgatct tcgtggatac ttccggcaac gccccatttg cgccactgtc ttcggcagcc 2160

gcagcgggca tcgcctacga ggtgcagcgc cgcaccaaga agctggccag cttgggcagc 2220

ttggcggtgg cccccaatat ccactccgag gcgtaccgca acggttgcct cattgtggcc 2280

gattgggtgc ctggctccag cttgagcgcc gtcgcggaat ccggtgccga tccccgcgcc 2340

gccgcgttcg cgctcgcgga actaactgaa accatcggcg aggcccacga gatgggtatc 2400

ccggccggct tggacaacaa gtgccgcatc cgcatcaaca ccgacggcca tgccgtcctc 2460

gccttcccgg cgattttgcc cgatgcctca gagctccgcg acgccaagtc cctggcctct 2520

gccaccgaga tgcttatcga cgcaaccctc gctcccagcg acgttaaggc aatggtcact 2580

gaagcccagg ggctagctac agaagacaat cccgattacg catcacttgc catggcgatg 2640

cgcacctgcg gactgttcac cgaggaacca acccaccttg tggtgaagaa ggaaaagaca 2700

ccaaagcccg ccaagcgcga cggcttcggc gcctccgact acaccgtcaa gggcatggca 2760

gccatcgccg ctgtggtgat catcttggtt tccctggtgg ctgccggtac cgcgttcctc 2820

accagcttct tcggcagcag caccaacgaa caatccccat tggcttctgt tgaagccacc 2880

acctctgcaa caccagaacc tgtggggcca ccggtctacc tggatctgga tcaagcccgc 2940

acgtgggatg acggtgcagg aacagatgtc accgacgtca ccgacggcaa cacctccacc 3000

gcatggacct ccaccggcgg cgacggcctc ctagttgacc tgtccacgcc tgcccgcctc 3060

gaccgcgtca tcttgaccac cggcaccggc tccgacagca acgtgacctc gaccgtgaag 3120

atctacgcat tcaacgacgc ctcaccacac tccttgtcgg aaggcatcga gatcggcacc 3180

gtggattatt ccggccgcag tctcagccac agcatccgcg attcctccaa gcttccgggt 3240

caggtggaat ccgtggtgat tctggtcgat gaggttcatt cctcacaaac ctcagacacc 3300

aatccacaga tgcagatcgc tgaagtacaa ctcgttggtt ggtaa 3345

<210> 4

<211> 1114

<212> PRT

<213> Corynebacterium

<400> 4

Met Asn Gly Gln Gln Val Ser Ser Ser Leu Ser Asn Asn Ser Glu Gln

1 5 10 15

Ser Gly Leu Arg Gly Arg Ile Val Ala Pro Ala Pro Pro Ala Pro Val

20 25 30

Pro Glu Ala Arg Lys Lys Ala Val Ala Arg Thr Asp Gly Asp Arg Ser

35 40 45

Ser Leu Lys Asn Ser Pro Thr Ala Ser Ala Thr Gln Ala Ala Gln Thr

50 55 60

Arg Pro Ala Glu Pro Glu Pro Glu Lys His Thr Ser Asp Ser Asp Val

65 70 75 80

Val Arg Ser Thr Gly Ser Met Ala Ile Ala Thr Leu Leu Ser Arg Ile

85 90 95

Thr Gly Phe Leu Arg Thr Val Met Ile Gly Ala Ala Leu Ser Pro Ala

100 105 110

Ile Ala Ser Ala Phe Asn Thr Ala Asn Thr Leu Pro Asn Leu Ile Thr

115 120 125

Glu Ile Val Leu Gly Ala Val Leu Thr Ser Leu Val Ile Pro Val Leu

130 135 140

Thr Arg Ala Glu Lys Glu Asp Ala Asp Gly Gly Ser Gly Phe Phe Arg

145 150 155 160

Arg Leu Leu Thr Leu Ser Val Thr Leu Leu Gly Gly Val Thr Ile Leu

165 170 175

Ser Ile Ile Gly Ala Pro Leu Leu Thr Arg Met Met Leu Ser Ser Glu

180 185 190

Gly Gln Val Asn Val Val Met Ser Thr Ala Phe Ala Tyr Trp Leu Leu

195 200 205

Pro Gln Ile Ile Phe Tyr Gly Leu Phe Ala Leu Phe Met Ala Val Leu

210 215 220

Asn Thr Arg Glu Val Phe Lys Pro Gly Ala Trp Ala Pro Val Val Asn

225 230 235 240

Asn Val Ile Thr Leu Thr Val Leu Gly Val Tyr Met Val Leu Pro Ala

245 250 255

Arg Leu His Pro His Glu Gln Val Gly Ile Phe Asp Pro Gln Ile Ile

260 265 270

Phe Leu Gly Val Gly Thr Thr Leu Gly Val Val Ala Gln Cys Leu Ile

275 280 285

Met Ile Pro Tyr Leu Arg Arg Ala Gly Ile Asp Met Arg Pro Leu Trp

290 295 300

Gly Ile Asp Ala Arg Leu Lys Gln Phe Gly Gly Met Ala Met Ala Ile

305 310 315 320

Ile Val Tyr Val Ala Ile Ser Gln Phe Gly Tyr Ile Ile Thr Thr Arg

325 330 335

Ile Ala Ser Leu Ala Asp Asp Ala Ala Pro Phe Ile Tyr Gln Gln His

340 345 350

Trp Met Leu Leu Gln Val Pro Tyr Gly Ile Ile Gly Val Thr Leu Leu

355 360 365

Thr Ala Ile Met Pro Arg Leu Ser Arg Asn Ala Ala Asp Gly Asp Asp

370 375 380

Arg Ala Val Val Ser Asp Leu Gln Leu Gly Ser Lys Leu Thr Phe Ile

385 390 395 400

Ala Leu Ile Pro Ile Val Val Phe Phe Thr Ala Phe Gly Val Pro Ile

405 410 415

Ala Asn Gly Leu Phe Ala Tyr Gly Gln Phe Asp Ser Thr Ala Ala Asn

420 425 430

Ile Leu Gly Trp Thr Leu Ser Phe Ser Ala Phe Thr Leu Ile Pro Tyr

435 440 445

Ala Leu Val Leu Leu His Leu Arg Val Phe Tyr Ala Arg Glu Glu Val

450 455 460

Trp Thr Pro Thr Phe Ile Ile Ala Gly Ile Thr Ala Thr Lys Val Val

465 470 475 480

Leu Ser Leu Leu Ala Pro Leu Leu Ser Ser Ser Pro Glu Arg Val Val

485 490 495

Val Leu Leu Gly Ala Ala Asn Gly Phe Ser Phe Ile Thr Gly Ala Val

500 505 510

Ile Gly Ala Tyr Leu Leu Arg Lys Lys Leu Gly Leu Leu Gly Met Arg

515 520 525

Ser Leu Ala Lys Thr Ser Leu Trp Ala Leu Gly Ser Ala Ala Val Gly

530 535 540

Ala Ala Ala Ala Trp Ala Leu Gly Trp Leu Ile Gln Ala Val Val Gly

545 550 555 560

Asp Phe Leu Leu Gly Thr Leu Ser Ser Val Gly Tyr Leu Leu Tyr Leu

565 570 575

Ala Val Leu Gly Val Phe Phe Ile Ile Val Thr Gly Ile Val Leu Ser

580 585 590

Arg Ser Gly Leu Pro Glu Val Gln Asn Leu Gly Gln Ala Leu Thr Arg

595 600 605

Ile Pro Gly Met Ser Arg Phe Ile Arg Pro Asn Thr Lys Ile Ser Leu

610 615 620

Asp Val Gly Glu Val Ser Gln Gln Asp Phe Ser Thr Gln Leu Val Ala

625 630 635 640

Pro Ser Glu Phe Ser Ala Thr Pro Val Pro Pro Pro Met Ser Ala Gly

645 650 655

Ile Val Arg Gly Pro Arg Leu Val Pro Gly Ala Pro Val Ser Asp Gly

660 665 670

Arg Phe Arg Leu Leu Ala Asp His Gly Gly Val Gln Gly Ala Arg Phe

675 680 685

Trp Gln Ala Arg Glu Ile Ala Thr Gly Lys Glu Val Ala Leu Ile Phe

690 695 700

Val Asp Thr Ser Gly Asn Ala Pro Phe Ala Pro Leu Ser Ser Ala Ala

705 710 715 720

Ala Ala Gly Ile Ala Tyr Glu Val Gln Arg Arg Thr Lys Lys Leu Ala

725 730 735

Ser Leu Gly Ser Leu Ala Val Ala Pro Asn Ile His Ser Glu Ala Tyr

740 745 750

Arg Asn Gly Cys Leu Ile Val Ala Asp Trp Val Pro Gly Ser Ser Leu

755 760 765

Ser Ala Val Ala Glu Ser Gly Ala Asp Pro Arg Ala Ala Ala Phe Ala

770 775 780

Leu Ala Glu Leu Thr Glu Thr Ile Gly Glu Ala His Glu Met Gly Ile

785 790 795 800

Pro Ala Gly Leu Asp Asn Lys Cys Arg Ile Arg Ile Asn Thr Asp Gly

805 810 815

His Ala Val Leu Ala Phe Pro Ala Ile Leu Pro Asp Ala Ser Glu Leu

820 825 830

Arg Asp Ala Lys Ser Leu Ala Ser Ala Thr Glu Met Leu Ile Asp Ala

835 840 845

Thr Leu Ala Pro Ser Asp Val Lys Ala Met Val Thr Glu Ala Gln Gly

850 855 860

Leu Ala Thr Glu Asp Asn Pro Asp Tyr Ala Ser Leu Ala Met Ala Met

865 870 875 880

Arg Thr Cys Gly Leu Phe Thr Glu Glu Pro Thr His Leu Val Val Lys

885 890 895

Lys Glu Lys Thr Pro Lys Pro Ala Lys Arg Asp Gly Phe Gly Ala Ser

900 905 910

Asp Tyr Thr Val Lys Gly Met Ala Ala Ile Ala Ala Val Val Ile Ile

915 920 925

Leu Val Ser Leu Val Ala Ala Gly Thr Ala Phe Leu Thr Ser Phe Phe

930 935 940

Gly Ser Ser Thr Asn Glu Gln Ser Pro Leu Ala Ser Val Glu Ala Thr

945 950 955 960

Thr Ser Ala Thr Pro Glu Pro Val Gly Pro Pro Val Tyr Leu Asp Leu

965 970 975

Asp Gln Ala Arg Thr Trp Asp Asp Gly Ala Gly Thr Asp Val Thr Asp

980 985 990

Val Thr Asp Gly Asn Thr Ser Thr Ala Trp Thr Ser Thr Gly Gly Asp

995 1000 1005

Gly Leu Leu Val Asp Leu Ser Thr Pro Ala Arg Leu Asp Arg Val Ile

1010 1015 1020

Leu Thr Thr Gly Thr Gly Ser Asp Ser Asn Val Thr Ser Thr Val Lys

1025 1030 1035 1040

Ile Tyr Ala Phe Asn Asp Ala Ser Pro His Ser Leu Ser Glu Gly Ile

1045 1050 1055

Glu Ile Gly Thr Val Asp Tyr Ser Gly Arg Ser Leu Ser His Ser Ile

1060 1065 1070

Arg Asp Ser Ser Lys Leu Pro Gly Gln Val Glu Ser Val Val Ile Leu

1075 1080 1085

Val Asp Glu Val His Ser Ser Gln Thr Ser Asp Thr Asn Pro Gln Met

1090 1095 1100

Gln Ile Ala Glu Val Gln Leu Val Gly Trp

1105 1110

<210> 5

<211> 3345

<212> DNA

<213> Corynebacterium

<400> 5

atgaatggtc aacaagtgag ttcttcgctt tcgaataatt cggagcagtc cggcctgcgt 60

ggcaggatcg ttgctccagc accgccggcg cctgtgcccg aggcgcgcaa gaaggctgtc 120

gcacgcacgg atggtgatcg ctcgagtttg aaaaactcgc ctacggcatc cgccacccag 180

gcagcccaga cgcgtctggc agaaccggaa ccagaaaagc acacctccga ttctgatgtg 240

gtgcgctcga ctggctccat ggcaatagcc acgctgctga gtcgtatcac cggtttcctg 300

cgcaccgtga tgattggtgc ggcgctgtcg ccggctatcg cgtcggcgtt caacactgcc 360

aacacgctgc ccaacctgat cactgagatc gtgttgggtg cggtgctgac atcgctggtt 420

attccggtgc ttacccgcgc ggaaaaagaa gacgccgacg gcggttccgg gttcttcagg 480

cggctgctca ccctgtcggt gacgctgctg ggcggtgtca ccatcctgtc gattatcggc 540

gcgccgctgc tgacacggat gatgctgtcc tctgagggac aagtcaacgt ggtcatgtcc 600

acggcctttg cgtattggct gctgccacag attttcttct acggcctgtt tgccctgttc 660

atggctgtgt tgaacacccg tgaagtgttc aaacccggcg cgtgggcacc tgttgtcaac 720

aatgtgatca ccttgaccgt gctgggcgtg tacatggtgc tgcctgcgcg tttgcacccg 780

catgagcagg tgggcatttt tgatccgcag atcattttcc tcggcgtggg caccaccctt 840

ggtgtggttg cacagtgtct aatcatgatt ccgtacctgc gtcgcgcggg cattgatatg 900

cgccctctgt ggggtatcga tgcgcgtttg aagcagttcg gtggcatggc catggcgatc 960

atcgtgtacg tggcgatctc ccagttcggt tacatcatca ccactcgcat tgcgtcgatt 1020

gcagacgatg ctgcgccgtt tatttatcag cagcactgga tgttgctgca agttccttat 1080

ggcatcattg gcgtcacctt gctcaccgcg attatgccgc gactgtcccg caacgcggca 1140

gacggcgacg atagggcagt agtctctgac cttcagttgg gttccaagct gaccttcatc 1200

gcactgatcc ccatcgtggt gttcttcacc gccttcggtg tccctattgc caatggcctt 1260

tttgcctacg gccaattcga tgccaacgcc gccaacatcc ttggttggac tctgagcttc 1320

tctgctttca cgctgattcc ttacgctttg gtgctgctac atctgcgtgt gttttatgcg 1380

cgtgaagagg tctggacccc aaccttcatc atcgccggca tcaccgccac caaggtcgtg 1440

ctgtccctgt tggcaccgct gctgtcgagc tccccggagc gtgtggtggt gcttcttggt 1500

gcggccaacg gtttcagttt catcaccggc gcggtcatcg gcgcgtatct gttgcgcaag 1560

aaactcggcc tgttgggtat gcgctctttg gctaaaacct ccctgtgggc gttgggctct 1620

gcggcggttg gtgcagcagc agcatgggcg ttggggtggc tgattcaagc cgtcgtgggc 1680

gatttcttgc tgggcactct aagctccgta ggctacttgt tgtacctggc tgtgttgggt 1740

gtcttcttca tcatcatcac cggcatcgtg ctgtcacgtt ctggtctgcc agaggtccaa 1800

aacttaggcc aggcactgac ccgcatcccg ggtatgagtc gctttattcg cccgaacacc 1860

aagatctctt tggatgtcgg cgaagtctcc cagcaagatt tctccaccca gctggtcgcg 1920

ccaagcgagt tctccgcaac ccctgttccg ccaccaatgt ccgccggtat tgtccgcgga 1980

cctcgcctgg ttcccggcgc cccagtcggc gacggtcgct tccgcttgct tgccgatcac 2040

ggcggcgtcc agggtgcacg tttctggcag gcccgcgaga tcgccaccgg caaggaagtc 2100

gcgctgatct tcgtggatac ttccggcaac gccccatttg cgccactgtc ttcggcagcc 2160

gcagcgggca tcgcctacga ggtgcagcgc cgcaccaaga agctggccag cttgggcagc 2220

ttggcggtgg cccccaatat ctactccgag gcgtaccgca acggttgcct cattgtggcc 2280

gattgggtgc ctggctccag cttgagcgcc gtcgcggaat ccggtgccga tccccgcgcc 2340

gccgcgttcg cgctcgcgga actaactgaa accatcggcg aggcccacga gatgggtatc 2400

ccggccggct tggacaacaa gtgccgcatc cgcatcaaca ccgacggcca tgccgtcctc 2460

gccttcccgg cgattttgcc cgatgcctca gagctccgcg acgccaagtc cctggcctcg 2520

gccgccgaga tgcttatcga cgcgaccctc gctcccagcg acgtcaaggc aatggtcact 2580

gaagcccagg ggctagctac agaagacaat cccgattacg catcacttgc catggcgatg 2640

cgcacctgcg gactgttcac cgaggaacca acccaccttg tggtgaagaa ggaaaagaca 2700

ccaaagcctg cgacacgtga tggtttcggt gcctccgact acaccgtcaa gggcatggca 2760

gccatcgccg ctgtggtgat catcttggtt tccctggtgg ctgccggtac cgcgttcctc 2820

accagcttct tcggcagcag caccaacgaa caatccccat tggcttctgt tgaagccacc 2880

acttctgcaa caccagaacc tgtggggcca ccggtctacc tggatctgga tcaagcccgc 2940

acgtgggatg acggtgcagg aacagatgtc accgacgtca ccgacggcaa cacctccacc 3000

gcatggacct ccaccggcgg cgacggcctc ctagttgacc tgtccacgcc tgcccgcctc 3060

gaccgcgtca tcttgaccac cggcaccggc tctgacagca acgtgacctc gaccgtgaag 3120

atctacgcat tcaacgacgc ctcaccacac tccctgtcgg aaggcatcga gatcggcacc 3180

gtggattatt ccggccgcag cctcagccac agcatccgcg attcctccaa gcttccgggt 3240

caggtggaat ccatggtgat tctggtcgat gaggttcatt cctcacaaac ctcagacacc 3300

aatccacaga tgcagatcgc tgaagtacaa ctcgttggtt ggtaa 3345

<210> 6

<211> 1114

<212> PRT

<213> Corynebacterium

<400> 6

Met Asn Gly Gln Gln Val Ser Ser Ser Leu Ser Asn Asn Ser Glu Gln

1 5 10 15

Ser Gly Leu Arg Gly Arg Ile Val Ala Pro Ala Pro Pro Ala Pro Val

20 25 30

Pro Glu Ala Arg Lys Lys Ala Val Ala Arg Thr Asp Gly Asp Arg Ser

35 40 45

Ser Leu Lys Asn Ser Pro Thr Ala Ser Ala Thr Gln Ala Ala Gln Thr

50 55 60

Arg Leu Ala Glu Pro Glu Pro Glu Lys His Thr Ser Asp Ser Asp Val

65 70 75 80

Val Arg Ser Thr Gly Ser Met Ala Ile Ala Thr Leu Leu Ser Arg Ile

85 90 95

Thr Gly Phe Leu Arg Thr Val Met Ile Gly Ala Ala Leu Ser Pro Ala

100 105 110

Ile Ala Ser Ala Phe Asn Thr Ala Asn Thr Leu Pro Asn Leu Ile Thr

115 120 125

Glu Ile Val Leu Gly Ala Val Leu Thr Ser Leu Val Ile Pro Val Leu

130 135 140

Thr Arg Ala Glu Lys Glu Asp Ala Asp Gly Gly Ser Gly Phe Phe Arg

145 150 155 160

Arg Leu Leu Thr Leu Ser Val Thr Leu Leu Gly Gly Val Thr Ile Leu

165 170 175

Ser Ile Ile Gly Ala Pro Leu Leu Thr Arg Met Met Leu Ser Ser Glu

180 185 190

Gly Gln Val Asn Val Val Met Ser Thr Ala Phe Ala Tyr Trp Leu Leu

195 200 205

Pro Gln Ile Phe Phe Tyr Gly Leu Phe Ala Leu Phe Met Ala Val Leu

210 215 220

Asn Thr Arg Glu Val Phe Lys Pro Gly Ala Trp Ala Pro Val Val Asn

225 230 235 240

Asn Val Ile Thr Leu Thr Val Leu Gly Val Tyr Met Val Leu Pro Ala

245 250 255

Arg Leu His Pro His Glu Gln Val Gly Ile Phe Asp Pro Gln Ile Ile

260 265 270

Phe Leu Gly Val Gly Thr Thr Leu Gly Val Val Ala Gln Cys Leu Ile

275 280 285

Met Ile Pro Tyr Leu Arg Arg Ala Gly Ile Asp Met Arg Pro Leu Trp

290 295 300

Gly Ile Asp Ala Arg Leu Lys Gln Phe Gly Gly Met Ala Met Ala Ile

305 310 315 320

Ile Val Tyr Val Ala Ile Ser Gln Phe Gly Tyr Ile Ile Thr Thr Arg

325 330 335

Ile Ala Ser Ile Ala Asp Asp Ala Ala Pro Phe Ile Tyr Gln Gln His

340 345 350

Trp Met Leu Leu Gln Val Pro Tyr Gly Ile Ile Gly Val Thr Leu Leu

355 360 365

Thr Ala Ile Met Pro Arg Leu Ser Arg Asn Ala Ala Asp Gly Asp Asp

370 375 380

Arg Ala Val Val Ser Asp Leu Gln Leu Gly Ser Lys Leu Thr Phe Ile

385 390 395 400

Ala Leu Ile Pro Ile Val Val Phe Phe Thr Ala Phe Gly Val Pro Ile

405 410 415

Ala Asn Gly Leu Phe Ala Tyr Gly Gln Phe Asp Ala Asn Ala Ala Asn

420 425 430

Ile Leu Gly Trp Thr Leu Ser Phe Ser Ala Phe Thr Leu Ile Pro Tyr

435 440 445

Ala Leu Val Leu Leu His Leu Arg Val Phe Tyr Ala Arg Glu Glu Val

450 455 460

Trp Thr Pro Thr Phe Ile Ile Ala Gly Ile Thr Ala Thr Lys Val Val

465 470 475 480

Leu Ser Leu Leu Ala Pro Leu Leu Ser Ser Ser Pro Glu Arg Val Val

485 490 495

Val Leu Leu Gly Ala Ala Asn Gly Phe Ser Phe Ile Thr Gly Ala Val

500 505 510

Ile Gly Ala Tyr Leu Leu Arg Lys Lys Leu Gly Leu Leu Gly Met Arg

515 520 525

Ser Leu Ala Lys Thr Ser Leu Trp Ala Leu Gly Ser Ala Ala Val Gly

530 535 540

Ala Ala Ala Ala Trp Ala Leu Gly Trp Leu Ile Gln Ala Val Val Gly

545 550 555 560

Asp Phe Leu Leu Gly Thr Leu Ser Ser Val Gly Tyr Leu Leu Tyr Leu

565 570 575

Ala Val Leu Gly Val Phe Phe Ile Ile Ile Thr Gly Ile Val Leu Ser

580 585 590

Arg Ser Gly Leu Pro Glu Val Gln Asn Leu Gly Gln Ala Leu Thr Arg

595 600 605

Ile Pro Gly Met Ser Arg Phe Ile Arg Pro Asn Thr Lys Ile Ser Leu

610 615 620

Asp Val Gly Glu Val Ser Gln Gln Asp Phe Ser Thr Gln Leu Val Ala

625 630 635 640

Pro Ser Glu Phe Ser Ala Thr Pro Val Pro Pro Pro Met Ser Ala Gly

645 650 655

Ile Val Arg Gly Pro Arg Leu Val Pro Gly Ala Pro Val Gly Asp Gly

660 665 670

Arg Phe Arg Leu Leu Ala Asp His Gly Gly Val Gln Gly Ala Arg Phe

675 680 685

Trp Gln Ala Arg Glu Ile Ala Thr Gly Lys Glu Val Ala Leu Ile Phe

690 695 700

Val Asp Thr Ser Gly Asn Ala Pro Phe Ala Pro Leu Ser Ser Ala Ala

705 710 715 720

Ala Ala Gly Ile Ala Tyr Glu Val Gln Arg Arg Thr Lys Lys Leu Ala

725 730 735

Ser Leu Gly Ser Leu Ala Val Ala Pro Asn Ile Tyr Ser Glu Ala Tyr

740 745 750

Arg Asn Gly Cys Leu Ile Val Ala Asp Trp Val Pro Gly Ser Ser Leu

755 760 765

Ser Ala Val Ala Glu Ser Gly Ala Asp Pro Arg Ala Ala Ala Phe Ala

770 775 780

Leu Ala Glu Leu Thr Glu Thr Ile Gly Glu Ala His Glu Met Gly Ile

785 790 795 800

Pro Ala Gly Leu Asp Asn Lys Cys Arg Ile Arg Ile Asn Thr Asp Gly

805 810 815

His Ala Val Leu Ala Phe Pro Ala Ile Leu Pro Asp Ala Ser Glu Leu

820 825 830

Arg Asp Ala Lys Ser Leu Ala Ser Ala Ala Glu Met Leu Ile Asp Ala

835 840 845

Thr Leu Ala Pro Ser Asp Val Lys Ala Met Val Thr Glu Ala Gln Gly

850 855 860

Leu Ala Thr Glu Asp Asn Pro Asp Tyr Ala Ser Leu Ala Met Ala Met

865 870 875 880

Arg Thr Cys Gly Leu Phe Thr Glu Glu Pro Thr His Leu Val Val Lys

885 890 895

Lys Glu Lys Thr Pro Lys Pro Ala Thr Arg Asp Gly Phe Gly Ala Ser

900 905 910

Asp Tyr Thr Val Lys Gly Met Ala Ala Ile Ala Ala Val Val Ile Ile

915 920 925

Leu Val Ser Leu Val Ala Ala Gly Thr Ala Phe Leu Thr Ser Phe Phe

930 935 940

Gly Ser Ser Thr Asn Glu Gln Ser Pro Leu Ala Ser Val Glu Ala Thr

945 950 955 960

Thr Ser Ala Thr Pro Glu Pro Val Gly Pro Pro Val Tyr Leu Asp Leu

965 970 975

Asp Gln Ala Arg Thr Trp Asp Asp Gly Ala Gly Thr Asp Val Thr Asp

980 985 990

Val Thr Asp Gly Asn Thr Ser Thr Ala Trp Thr Ser Thr Gly Gly Asp

995 1000 1005

Gly Leu Leu Val Asp Leu Ser Thr Pro Ala Arg Leu Asp Arg Val Ile

1010 1015 1020

Leu Thr Thr Gly Thr Gly Ser Asp Ser Asn Val Thr Ser Thr Val Lys

1025 1030 1035 1040

Ile Tyr Ala Phe Asn Asp Ala Ser Pro His Ser Leu Ser Glu Gly Ile

1045 1050 1055

Glu Ile Gly Thr Val Asp Tyr Ser Gly Arg Ser Leu Ser His Ser Ile

1060 1065 1070

Arg Asp Ser Ser Lys Leu Pro Gly Gln Val Glu Ser Met Val Ile Leu

1075 1080 1085

Val Asp Glu Val His Ser Ser Gln Thr Ser Asp Thr Asn Pro Gln Met

1090 1095 1100

Gln Ile Ala Glu Val Gln Leu Val Gly Trp

1105 1110

<210> 7

<211> 3345

<212> DNA

<213> Corynebacterium

<400> 7

atgaatggtc aacaagtgag ttcttcgctt tcgaataatt cggagcagtc cggcctgcgt 60

ggcaggatcg ttgctccagc accgccggcg cctgtgcccg aggcgcgcaa gaaggctgtc 120

gcacgcacgg atggtgatcg ctcgagtttg aaaaactcgc ctacggcatc cgccacccag 180

gcagcccaga cgcgcccggc agaaccggaa ccagaaaagc acacctccga ttctgatgtg 240

gtgcgctcga ctggctccat ggcaatagcc acgctgctga gtcgtatcac cggtttcctg 300

cgcaccgtga tgattggtgc ggcgctgtcg ccggccatcg cttcggcgtt caacactgcc 360

aacacgctgc ccaacctgat cactgaaatc gtgttgggtg cggtgctgac atcgctggtt 420

attccggtcc ttacccgcgc ggaaaaagaa gacgccgacg gcggttccgg gttcttcagg 480

cggctgctca ccctgtcggt gacgctgctg ggtggtgtca ccatcctgtc gattatcggc 540

gcgccgctgc tgacacggat gatgctgtcc tctgagggac aagtcaacgt ggtcatgtcc 600

acggcctttg cgtattggct gctgccacag attttcttct acggcctgtt tgccctgttc 660

atggctgtgt tgaacacccg tgaagtgttc aaacccggcg cgtgggcacc tgttgtcaac 720

aatgtgatca ccttgaccgt gctgggcgtg tacatggtgc tgcctgcgcg tttgcacccg 780

catgagcagg tgggcatttt tgatccgcag atcattttcc tcggcgtggg caccaccctt 840

ggtgtggttg cacagtgtct aatcatgatt ccgtacctgc gtcgcgcggg cattgatatg 900

cgccctctgt ggggtatcga tgcgcgtttg aagcaattcg gtggcatggc gatggcgatc 960

atcgtgtacg tggcaatctc ccagttcggt tacatcatca ccactcgcat tgcgtcgatt 1020

gcagacgatg ctgcgccgtt tatttatcag cagcactgga tgttgctgca agttccttat 1080

ggcatcatcg gcgtcacctt gctcaccgcg attatgccgc gactgtcccg caacgcggca 1140

gacggcgatg atagggcagt agtctctgac cttcagttgg gttccaagct aaccttcatc 1200

gcactgatcc ccatcgtggt gttcttcacc gccttcggtg tccctattgc caatggcctt 1260

tttgcctacg gccaattcga tgccaacgcc gccaacatcc ttggttggac tctgagcttc 1320

tctgctttca cgctgattcc ttacgctttg gtgctgctac atctgcgtgt gttttatgcg 1380

cgtgaagagg tctggacccc aaccttcatc atcgccggca tcaccgccac caaggtcgtg 1440

ctttccctgt tggcaccgct gctgtcgagc tccccggagc gtgtggtggt gcttcttggt 1500

gcggccaacg gtttcagttt catcaccggc gcggtcatcg gcgcgtatct gttgcgcaac 1560

aaactcggcc tgttgggtat gcgctctttg gctaaaacct ccctgtgggc gttgggctct 1620

gcggcggttg gtgcagcagc agcatgggcg ttggggtggc tgattcaagc cgtcgtgggc 1680

gatttcttgc tgggcactct aagctccgta ggctacttgt tgtacctggc tgtgttgggt 1740

gtcttcttca tcttcgtcac cggcatcgtg ttgtcacgtt ctggtttgcc ggaggtccaa 1800

aacttgggcc aggcactgac ccgcatccca ggtttgagcc ggtttattcg cccgaatacc 1860

aagatctctt tggatgtcgg cgaagtctcc gagcaggatt tctccaccca gctggtcgcg 1920

ccaagcgagt tcgcagcaac ccctgtgccg ccaccgatgt ccgccggtat tgtccgcgga 1980

cctcgcctgg ttcccggcgc cccagtcggc gacggtcgtt tccgtctgct cgccgatcac 2040

ggcggcgtcc aaggcgcgcg tttctggcag gcccgcgaga tcgccaccgg caaggaagtc 2100

gcgctgatct ttgtggatac ttccggcaac gccccatttg cgccactgtc ttcggcagcc 2160

gcagcgggca tcgcctacga ggtgcagcgc cgcaccaaga agctggccag cttgggcagc 2220

ttggcggtag cccccaacat ccactccgag gcgtaccgca acggttgcct cattgtggcc 2280

gattgggtgc ctggctccag cttgagcgcc gtcgcggaat ccggtgccga tccccgcgcc 2340

gccgcgttcg cgctcgcgga actaactgaa accatcggcg aggcccacga gatgggtatc 2400

ccggccggct tggacaacaa gtgccgcatc cgcatcaaca ccgacggcca tgccgtcctc 2460

gccttcccgg cgattttgcc cgatgcctca gagctccgcg acgccaagtc cctggcctcg 2520

gccgccgaga tgcttatcga cgcgaccctc gctcccagcg acgtcaaggc aatggtcact 2580

gaagcccagg ggctagctac agaagacaat cccgattacg catcacttgc catggcgatg 2640

cgcacctgcg gactgttcac cgaggaacca acccaccttg tggtgaagaa ggaaaagaca 2700

ccaaagcctg cgacacgtga tggtttcggt gcctccgact acaccgtcaa gggcatggca 2760

gccatcgccg ctgtggtgat catcttggtt tccctggtgg ccgccggtac cgcgttcctc 2820

accagcttct tcggcagcag caccaacgaa caatccccgt tggcctctgt tgaagccacc 2880

acctctgcaa caccagaacc tgtggggcca ccggtctacc tggatctgga tcaagcccgc 2940

acgtgggatg acggtgcagg aacagatgtc accgacgtca ccgacggcaa cacctccacc 3000

gcatggacct ccaccggcgg cgacggcctc ctagttgacc tgtccacgcc tgcccgcctc 3060

gaccgcgtca tcttgaccac cggcaccggc tccgacagca acgtgacctc gaccgtgaag 3120

atctacgcat tcaacgacgc ctcaccacac tccctgtcgg aaggcatcga gatcggcacc 3180

gtggattatt ccggccgcag tctcagccac agcatccgcg attcctccaa gcttccgggt 3240

caggtggaat ccgtggtgat tctggtcgat gaggttcgtt cctcacaaac ctcagacacc 3300

aatccacaga tgcagatcgc tgaagtacaa cttgttggtt ggtaa 3345

<210> 8

<211> 1114

<212> PRT

<213> Corynebacterium

<400> 8

Met Asn Gly Gln Gln Val Ser Ser Ser Leu Ser Asn Asn Ser Glu Gln

1 5 10 15

Ser Gly Leu Arg Gly Arg Ile Val Ala Pro Ala Pro Pro Ala Pro Val

20 25 30

Pro Glu Ala Arg Lys Lys Ala Val Ala Arg Thr Asp Gly Asp Arg Ser

35 40 45

Ser Leu Lys Asn Ser Pro Thr Ala Ser Ala Thr Gln Ala Ala Gln Thr

50 55 60

Arg Pro Ala Glu Pro Glu Pro Glu Lys His Thr Ser Asp Ser Asp Val

65 70 75 80

Val Arg Ser Thr Gly Ser Met Ala Ile Ala Thr Leu Leu Ser Arg Ile

85 90 95

Thr Gly Phe Leu Arg Thr Val Met Ile Gly Ala Ala Leu Ser Pro Ala

100 105 110

Ile Ala Ser Ala Phe Asn Thr Ala Asn Thr Leu Pro Asn Leu Ile Thr

115 120 125

Glu Ile Val Leu Gly Ala Val Leu Thr Ser Leu Val Ile Pro Val Leu

130 135 140

Thr Arg Ala Glu Lys Glu Asp Ala Asp Gly Gly Ser Gly Phe Phe Arg

145 150 155 160

Arg Leu Leu Thr Leu Ser Val Thr Leu Leu Gly Gly Val Thr Ile Leu

165 170 175

Ser Ile Ile Gly Ala Pro Leu Leu Thr Arg Met Met Leu Ser Ser Glu

180 185 190

Gly Gln Val Asn Val Val Met Ser Thr Ala Phe Ala Tyr Trp Leu Leu

195 200 205

Pro Gln Ile Phe Phe Tyr Gly Leu Phe Ala Leu Phe Met Ala Val Leu

210 215 220

Asn Thr Arg Glu Val Phe Lys Pro Gly Ala Trp Ala Pro Val Val Asn

225 230 235 240

Asn Val Ile Thr Leu Thr Val Leu Gly Val Tyr Met Val Leu Pro Ala

245 250 255

Arg Leu His Pro His Glu Gln Val Gly Ile Phe Asp Pro Gln Ile Ile

260 265 270

Phe Leu Gly Val Gly Thr Thr Leu Gly Val Val Ala Gln Cys Leu Ile

275 280 285

Met Ile Pro Tyr Leu Arg Arg Ala Gly Ile Asp Met Arg Pro Leu Trp

290 295 300

Gly Ile Asp Ala Arg Leu Lys Gln Phe Gly Gly Met Ala Met Ala Ile

305 310 315 320

Ile Val Tyr Val Ala Ile Ser Gln Phe Gly Tyr Ile Ile Thr Thr Arg

325 330 335

Ile Ala Ser Ile Ala Asp Asp Ala Ala Pro Phe Ile Tyr Gln Gln His

340 345 350

Trp Met Leu Leu Gln Val Pro Tyr Gly Ile Ile Gly Val Thr Leu Leu

355 360 365

Thr Ala Ile Met Pro Arg Leu Ser Arg Asn Ala Ala Asp Gly Asp Asp

370 375 380

Arg Ala Val Val Ser Asp Leu Gln Leu Gly Ser Lys Leu Thr Phe Ile

385 390 395 400

Ala Leu Ile Pro Ile Val Val Phe Phe Thr Ala Phe Gly Val Pro Ile

405 410 415

Ala Asn Gly Leu Phe Ala Tyr Gly Gln Phe Asp Ala Asn Ala Ala Asn

420 425 430

Ile Leu Gly Trp Thr Leu Ser Phe Ser Ala Phe Thr Leu Ile Pro Tyr

435 440 445

Ala Leu Val Leu Leu His Leu Arg Val Phe Tyr Ala Arg Glu Glu Val

450 455 460

Trp Thr Pro Thr Phe Ile Ile Ala Gly Ile Thr Ala Thr Lys Val Val

465 470 475 480

Leu Ser Leu Leu Ala Pro Leu Leu Ser Ser Ser Pro Glu Arg Val Val

485 490 495

Val Leu Leu Gly Ala Ala Asn Gly Phe Ser Phe Ile Thr Gly Ala Val

500 505 510

Ile Gly Ala Tyr Leu Leu Arg Asn Lys Leu Gly Leu Leu Gly Met Arg

515 520 525

Ser Leu Ala Lys Thr Ser Leu Trp Ala Leu Gly Ser Ala Ala Val Gly

530 535 540

Ala Ala Ala Ala Trp Ala Leu Gly Trp Leu Ile Gln Ala Val Val Gly

545 550 555 560

Asp Phe Leu Leu Gly Thr Leu Ser Ser Val Gly Tyr Leu Leu Tyr Leu

565 570 575

Ala Val Leu Gly Val Phe Phe Ile Phe Val Thr Gly Ile Val Leu Ser

580 585 590

Arg Ser Gly Leu Pro Glu Val Gln Asn Leu Gly Gln Ala Leu Thr Arg

595 600 605

Ile Pro Gly Leu Ser Arg Phe Ile Arg Pro Asn Thr Lys Ile Ser Leu

610 615 620

Asp Val Gly Glu Val Ser Glu Gln Asp Phe Ser Thr Gln Leu Val Ala

625 630 635 640

Pro Ser Glu Phe Ala Ala Thr Pro Val Pro Pro Pro Met Ser Ala Gly

645 650 655

Ile Val Arg Gly Pro Arg Leu Val Pro Gly Ala Pro Val Gly Asp Gly

660 665 670

Arg Phe Arg Leu Leu Ala Asp His Gly Gly Val Gln Gly Ala Arg Phe

675 680 685

Trp Gln Ala Arg Glu Ile Ala Thr Gly Lys Glu Val Ala Leu Ile Phe

690 695 700

Val Asp Thr Ser Gly Asn Ala Pro Phe Ala Pro Leu Ser Ser Ala Ala

705 710 715 720

Ala Ala Gly Ile Ala Tyr Glu Val Gln Arg Arg Thr Lys Lys Leu Ala

725 730 735

Ser Leu Gly Ser Leu Ala Val Ala Pro Asn Ile His Ser Glu Ala Tyr

740 745 750

Arg Asn Gly Cys Leu Ile Val Ala Asp Trp Val Pro Gly Ser Ser Leu

755 760 765

Ser Ala Val Ala Glu Ser Gly Ala Asp Pro Arg Ala Ala Ala Phe Ala

770 775 780

Leu Ala Glu Leu Thr Glu Thr Ile Gly Glu Ala His Glu Met Gly Ile

785 790 795 800

Pro Ala Gly Leu Asp Asn Lys Cys Arg Ile Arg Ile Asn Thr Asp Gly

805 810 815

His Ala Val Leu Ala Phe Pro Ala Ile Leu Pro Asp Ala Ser Glu Leu

820 825 830

Arg Asp Ala Lys Ser Leu Ala Ser Ala Ala Glu Met Leu Ile Asp Ala

835 840 845

Thr Leu Ala Pro Ser Asp Val Lys Ala Met Val Thr Glu Ala Gln Gly

850 855 860

Leu Ala Thr Glu Asp Asn Pro Asp Tyr Ala Ser Leu Ala Met Ala Met

865 870 875 880

Arg Thr Cys Gly Leu Phe Thr Glu Glu Pro Thr His Leu Val Val Lys

885 890 895

Lys Glu Lys Thr Pro Lys Pro Ala Thr Arg Asp Gly Phe Gly Ala Ser

900 905 910

Asp Tyr Thr Val Lys Gly Met Ala Ala Ile Ala Ala Val Val Ile Ile

915 920 925

Leu Val Ser Leu Val Ala Ala Gly Thr Ala Phe Leu Thr Ser Phe Phe

930 935 940

Gly Ser Ser Thr Asn Glu Gln Ser Pro Leu Ala Ser Val Glu Ala Thr

945 950 955 960

Thr Ser Ala Thr Pro Glu Pro Val Gly Pro Pro Val Tyr Leu Asp Leu

965 970 975

Asp Gln Ala Arg Thr Trp Asp Asp Gly Ala Gly Thr Asp Val Thr Asp

980 985 990

Val Thr Asp Gly Asn Thr Ser Thr Ala Trp Thr Ser Thr Gly Gly Asp

995 1000 1005

Gly Leu Leu Val Asp Leu Ser Thr Pro Ala Arg Leu Asp Arg Val Ile

1010 1015 1020

Leu Thr Thr Gly Thr Gly Ser Asp Ser Asn Val Thr Ser Thr Val Lys

1025 1030 1035 1040

Ile Tyr Ala Phe Asn Asp Ala Ser Pro His Ser Leu Ser Glu Gly Ile

1045 1050 1055

Glu Ile Gly Thr Val Asp Tyr Ser Gly Arg Ser Leu Ser His Ser Ile

1060 1065 1070

Arg Asp Ser Ser Lys Leu Pro Gly Gln Val Glu Ser Val Val Ile Leu

1075 1080 1085

Val Asp Glu Val Arg Ser Ser Gln Thr Ser Asp Thr Asn Pro Gln Met

1090 1095 1100

Gln Ile Ala Glu Val Gln Leu Val Gly Trp

1105 1110

<210> 9

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

cctcgaattc atgaatggtc aacaagtgag ttcttc 36

<210> 10

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

tctactgcag ttaccaacca acgagttgta cttcag 36

<210> 11

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

tctactgcag ttaccaacca acaagttgta cttcag 36

<210> 12

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

atgctgcgcc gtttatttat 20

<210> 13

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ataaataaac ggcgcagcat 20

<210> 14

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

tgatgctgca ccgtttattt 20

<210> 15

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

aaataaacgg tgcagcatca 20

<210> 16

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

tctgccagag gtccaaaact 20

<210> 17

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

agttttggac ctctggcaga 20

<210> 18

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

tttgccggag gtccaaaact 20

<210> 19

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

agttttggac ctccggcaaa 20

<210> 20

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

ctcgatggaa ttccgttaag gcgcgcactc gtacatgaat ggtc 44

<210> 21

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

cgcgggatcc ttaccaacca acgagttgta cttcagcgat c 41

Claims

1. a kind of membrane spanning lipids II flippase (MviN) protein mutant, which is characterized in that the amino acid of the protein mutant Sequence is only any shown corresponding to SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 346th proline of amino acid sequence is replaced by leucine, or is only corresponding to SEQ ID NO:2 or SEQ ID NO: 599th valine of amino acid sequence shown in 4 or SEQ ID NO:6 or SEQ ID NO:8 is any is replaced by phenylalanine.

2. the encoding gene of MviN protein mutant as described in claim 1.

3. including the expression vector of encoding gene as claimed in claim 2.

4. a kind of host cell, which is characterized in that the host cell expression MviN protein mutant described in claim 1, Or contain encoding gene as claimed in claim 2.

5. host cell according to claim 4, which is characterized in that the host cell contains the MviN protein mutation The expression vector of body encoding gene, or the coding MviN protein mutation is integrated in the genome of the host cell The gene of body.

6. host cell according to claim 4 or 5, which is characterized in that the host cell resources are in corynebacterium.

7. MviN protein mutant as described in claim 1, encoding gene as claimed in claim 2, as claimed in claim 3 Application of the host cell described in expression vector, claim 4 or claim 5 in production glutamic acid or lysine.

8. a kind of method for preparing glutamic acid or lysine, which comprises the following steps:

A) encoding gene of MviN protein mutant is imported into the Corynebacterium glutamicum for producing glutamic acid, or imported into production and relies In the Corynebacterium glutamicum of propylhomoserin, any host cell of building claim 4-6；

B) host cell of incubation step a building, is allowed to generate the culture solution containing glutamic acid or lysine；With

C) glutamic acid or lysine of generation are optionally separated from the culture solution of step b.