CN108250278B

CN108250278B - L-glutamic acid-producing strain and method for producing L-glutamic acid

Info

Publication number: CN108250278B
Application number: CN201611248605.8A
Authority: CN
Inventors: 陈江坡; 胡丹; 刁刘洋; 毛贤军
Original assignee: Langfang Meihua Bio Technology Development Co Ltd
Current assignee: Langfang Meihua Bio Technology Development Co Ltd
Priority date: 2016-12-29
Filing date: 2016-12-29
Publication date: 2021-06-22
Anticipated expiration: 2036-12-29
Also published as: CN108250278A

Abstract

The invention relates to the technical field of food industry, in particular to a strain for producing L-glutamic acid and a method for producing the L-glutamic acid. The invention discovers that 3 different mutations occur in the glutamic acid export protein coding gene yggB, and the three mutations are introduced into wild type ATCC13032, and the result shows that the yggB protein becomes an activated state, thereby improving the yield of L-glutamic acid. The production of L-glutamic acid was further improved by introducing yggB mutation into ATCC13032 in which the odhA gene was inactivated.

Description

L-glutamic acid-producing strain and method for producing L-glutamic acid

Technical Field

The invention relates to the technical field of food industry, in particular to a strain for producing L-glutamic acid and a method for producing the L-glutamic acid.

Background

Glutamic acid (Glutamic acid), known by the chemical name 2-amino-5-carboxypentanoic acid, is one of the 20 common amino acids that make up proteins. L-glutamic acid is widely used in the food industry, for example, as a raw material in the production of flavors. Corynebacterium glutamicum is biotin deficient and requires supplementation with biotin for growth. The production of L-glutamic acid by coryneform bacteria is therefore usually carried out under conditions of a sub-optimal amount of biotin. In addition, the addition of certain surfactants such as, for example, Tween40 in the case of excess biotin can also induce the C.glutamicum to synthesize glutamate in excess.

The prior art adds a sub-proper amount of biotin and a surfactant such as Tween40 to a culture medium for producing glutamic acid, which not only increases the production cost, but also tends to lower the yield. Nakamura, J (AEM,73.14(2007):4491-8) found that a major role in the export of glutamate is a mechanosensitive channel (mechanosensitive channel) protein YggB. The YggB protein is normally in a closed state, but if a surfactant or biotin is added in a limited manner to a culture medium in the cell culture process, the tension of a cell membrane is changed, so that the conformation of the YggB protein is changed, and glutamic acid can be secreted out of cells.

The alpha-ketoglutarate dehydrogenase complex (ODHC) is capable of catalyzing the conversion of alpha-ketoglutarate to succinyl-coa, a major competing pathway for glutamate anabolism. If the encoding gene odhA of the Elo subunit of ODHC is inactivated and modified, corynebacteria can accumulate a large amount of glutamic acid in cells, and the metabolic pressure of the corynebacterium can induce the conformation of YggB protein to mutate, so that a strain which can produce the glutamic acid without adding a surfactant or limiting biotin is obtained, and the cost of fermentation production of the glutamic acid is reduced.

The YggB protein and odhA are further modified, and the effect of further improving the yield of the glutamic acid can be achieved.

Disclosure of Invention

In view of the above, the technical problems to be solved by the present invention are to provide an L-glutamic acid-producing strain and a method for producing L-glutamic acid; the strain provided by the invention is fermented for 24 hours, and the yield of glutamic acid can reach 25 g/L.

The invention provides a mutant YggB protein, and the amino acid sequence of the mutant YggB protein is shown as SEQ ID NO.1, SEQ ID NO. 2 or SEQ ID NO. 3.

The amino acid sequence of the wild-type YggB protein from ATCC13032 is shown in SEQ ID NO. 7.

The mutation refers to the change in genetic material, which may be a point mutation or a fragment mutation. Specifically, the addition, deletion or substitution of amino acids or bases. The mutation is in SEQ ID NO:7, in particular:

in the amino acid sequence of the YggB protein shown in SEQ ID NO.1, valine at position 419 is mutated into aspartic acid which is shown as V419D.

In the amino acid sequence of the YggB protein shown in SEQ ID NO. 2, methionine at position 154 is mutated into leucine, which is represented as M154L.

In the amino acid sequence of the YggB protein shown in SEQ ID NO. 3, 5 amino acids of valine-asparagine-threonine-glycine-phenylalanine are inserted between amino acids 23 and 24, and the amino acid sequence is represented by 23Phe-Val-Asp-Thr-Gly-Phe-24 Asp.

The invention also provides a DNA molecule for coding the mutant YggB protein.

Due to the degeneracy of the codons, there may be a wide variety of nucleotide sequences capable of encoding the mutated YggB proteins of the present invention. In order to enable better expression of the DNA molecule encoding the mutant YggB protein in a host, codon optimization is performed.

The nucleotide sequence of the DNA molecule for coding the mutant YggB protein provided by the invention is shown as SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.

The DNA molecule for coding the mutant YggB protein can be obtained by adopting an artificial synthesis mode and can also be obtained by an in vitro amplification method. The invention is obtained by adopting a mode of artificial synthesis. The present invention introduced a DNA molecule encoding a mutant YggB protein into wild-type ATCC13032, and then performed fermentation to determine the concentration of L-glutamic acid accumulated in the medium. The result shows that the yield of the L-glutamic acid of the wild type ATCC13032 introduced with the mutation is obviously improved from 0.3g/L to 20 g/L. It shows that the dynamic sensitive channel protein YggB has a key role in the process of producing L-glutamic acid by corynebacterium glutamicum. After mutation occurs to the yggB gene at a specific position, the protein is caused to generate conformational change, so that the protein is changed into an activated state, and the constitutive export of glutamic acid can be realized. However, the research of the invention shows that only the mutation of the specific site provided by the invention can change the YggB protein into an activated state.

The invention also provides a recombinant strain expressing the DNA molecule encoding the mutant YggB protein.

The starting strain was ATCC13032, or ATCC13032 in which the odhA gene was inactivated.

ATCC13032 is a strain of Corynebacterium glutamicum deposited at the American Type Culture Collection (ATCC). The wild type Corynebacterium glutamicum ATCC13032 produced substantially no glutamate prior to the transformation. When the mutation site of the invention is introduced into wild type Corynebacterium glutamicum ATCC13032 or ATCC13032 with the odhA gene knocked out, the yield of glutamic acid can reach 25g/L in the strains with a large amount of glutamic acid accumulated in fermentation broth, yggB mutation and insertion inactivation of the odhA gene.

The accession number of ATCC13032 into which the inactivated odhA gene was inserted was CGMCC NO. 13401.

Homologous exchange is used for inserting the inactivated odhA gene. The specific method comprises the following steps:

step 1: synthesizing a fragment of the odhA base deletion site, inserting the fragment into a vector pK18mobsacB, and preparing a plasmid pK18-odhA int;

step 2: pK18-odhA int was introduced into ATCC13032 competent cells by electroporation, and after culturing, kanamycin positive clones were picked up as strains in which the odhA gene was inactivated.

The method for in vitro amplification of the segment of the synthetic odhA base deletion site comprises the following steps: a fragment of the odhA base deletion site was prepared by amplifying a chromosomal DNA of Corynebacterium glutamicum ATCC13032 strain as a template with primers having sequences represented by SEQ ID NOS: 8 to 9.

The amplification employs Phusion ultra-fidelity polymerase.

The procedure for the amplification was: heat storage is carried out for 5 minutes at 98 ℃ for one cycle; denaturation at 98 ℃ for 30 seconds, renaturation at 55 ℃ for 20 seconds and extension at 72 ℃ for 30 seconds, for 30 cycles.

The site of the inserted vector pK18mobsacB is BamH I/Hind III.

The culture medium adopted by the culture is a CM-Dex culture medium containing 15ug/L kanamycin. The temperature of the culture is 30 ℃, and the culture is inverted.

During the culture, the odhA base-deleted sequence is integrated into the genome by homologous recombination with the endogenous odhA gene together with the recombinant vector to form a single crossover recombinant.

The positive clone is verified by adopting a colony PCR mode, and the primer sequence of the PCR is shown as SEQ ID NO. 10-11.

Colony PCR was performed using Fast TaqDNA polymerase (TransGen Biotech) using the PCR program: heat storage is carried out for 5 minutes at 98 ℃ for one cycle; 30 cycles of denaturation at 98 ℃ for 30 seconds, renaturation at 55 ℃ for 20 seconds and extension at 72 ℃ for 30 seconds.

The construction method of the recombinant strain comprises the following steps: artificially synthesizing a DNA molecule for coding the mutant YggB protein, constructing a vector pK18mobsacB, and then transforming into ATCC13032 to obtain a recombinant strain.

The recombinant strain of the present invention may be constructed by inserting the inactivated odhA gene of ATCC13032 and then subjecting to high-sugar pressure mutagenesis to obtain a recombinant strain carrying a yggB mutation.

The construction method of the recombinant strain can also be as follows: a DNA molecule encoding the mutated YggB protein was artificially synthesized, constructed into a vector pK18mobsacB, and then transformed into ATCC13032 in which the inactivated odhA gene was inserted, to obtain a recombinant strain.

The recombinant strain provided by the invention is applied to the production of L-glutamic acid.

The invention also provides a production method of the L-glutamic acid, and the recombinant strain provided by the invention is fermented.

In some embodiments, the fermentation temperature is 30 ℃, the rotation speed is 220rpm/min, and the time is 24 h.

In some embodiments, the medium of the fermentation comprises water and:

in the invention, activation and seed culture steps are also carried out before fermentation.

The activated medium comprises water and:

the culture medium for seed culture comprises water and:

in the fermentation, the inoculation amount of the seed liquid is 10%.

The invention discovers that the glutamic acid export protein coding gene yggB has 3 different mutations: the V419D mutation (MHZ-0113-1-008): valine at amino acid position 419 is mutated to aspartic acid; M154L mutation (MHZ-0113-1-266), wherein the methionine of the 154 th amino acid is mutated into leucine; ③ 23^Phe-Val-Asp-Thr-Gly-Phe-24^AspInsertion mutation (MHZ-0113-1-313): valine-asparagine-threonine-glycine-phenylalanine is inserted between amino acids 23 and 24. The results of introducing these three mutations into wild-type ATCC13032 revealed that the YggB protein became activated, thereby increasing the production of L-glutamic acid. The production of L-glutamic acid was further improved by introducing yggB mutation into ATCC13032 having the insertion-inactivated odhA gene.

Biological preservation Instructions

Biomaterial MHZ-0113-1, classification name: corynebacterium glutamicum, deposited in the China general microbiological culture Collection center at 2016, 11, 30 days, addresses: the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, and the preservation number is CGMCC NO. 13401.

Detailed Description

The invention provides a strain for producing L-glutamic acid and a method for producing L-glutamic acid, and a person skilled in the art can take the contents into consideration and appropriately improve the process parameters. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

The invention is further illustrated by the following examples:

example 1: construction of vector for Gene disruption carrying sacB Gene

As is known from the glutamate anabolic pathway, in the tricarboxylic acid cycle, alpha-ketoglutarate can be catalyzed by alpha-ketoglutarate dehydrogenase complex (ODHC) to convert to succinyl-CoA, which is a main competitive pathway for glutamate anabolism. In order to reduce the ODHC activity, the gene odhA coding for the Elo subunit needs to be inactivated and modified.

The nucleotide sequence of the odhA gene of Corynebacterium glutamicum (Corynebacterium glutamicum ATCC13032) was obtained in the NCBI GenBank database, and 2 primers were synthesized based on the odhA nucleotide sequence and the selected deletion positions (as shown in table 1). A fragment of the odhA base deletion site was prepared using Phusion ultra-fidelity polymerase (New England BioLabs) with 1f/2r as a primer and chromosomal DNA of Corynebacterium glutamicum ATCC13032 strain as a template. The PCR procedure was: heat storage is carried out for 5 minutes at 98 ℃ for one cycle; 30 cycles of denaturation at 98 ℃ for 30 seconds, renaturation at 55 ℃ for 20 seconds and extension at 72 ℃ for 30 seconds. The resulting fragment was purified with an agarose gel recovery kit (Tiangen), digested with BamHI/HindIII, while pK18-mobsacB empty vector was digested with BamHI/HindIII and the fragment was ligated to the vector with T4DNA ligase (TransGenBiotech), Trans1T1 competent cells (TransGenBiotech) were transformed, kanamycin resistant clones were picked up, positive clones of the PCR fragment insert vector pK18mobsacB were identified by BamHI/HindIII double digestion, the inserted fragment was further identified by sequencing (Wada) as a fragment of the site of the odhA gene to be deleted, and the resulting plasmid was named pK18-odhA int.

TABLE 1 primers for construction of vector for Gene disruption carrying sacB Gene

Primer name	Sequence of	Remarks for note
			odhAint-1f	cgGGATCCtggcggagtccatcagtggg	BamHI
odhAint-2r	cccAAGCTTacgcaatgaacgttccttac	HindIII

Example 2: construction of odhA Gene-disrupted Strain from Corynebacterium glutamicum ATCC13032 Strain

pK18-odhA int was introduced into ATCC13032 competent cells by the electric pulse method. And the transformed bacterial cells were plated on CM-Dex medium containing 15. mu.g/L kanamycin. After the 30 ℃ inversion culture, PCR was performed using each chromosome extracted from the emerging strains to confirm that these strains were single cross-over recombinants (single cross-over recombinants) in which the sequence of the odhA base deletion was integrated into the genome by homologous recombination with the endogenous odhA gene together with the recombinant vector. KanR clones were identified by colony PCR using Fast TaqDNA polymerase (TransGen Biotech) with the primer pair P82/odhAit-2 r, P84/odhAit-1 f, the PCR program being: heat storage is carried out for 5 minutes at 98 ℃ for one cycle; 30 cycles of denaturation at 98 ℃ for 30 seconds, renaturation at 55 ℃ for 20 seconds and extension at 72 ℃ for 30 seconds. Transformants with the target fragments amplified by both primer pairs are positive clones. 1 purpose positive clone is obtained by the method and is named MHZ-0113-1, and the preservation number is CGMCC NO. 13401.

TABLE 2 primers used for construction of odhA Gene disrupted Strain

Primer name	Sequence of	Remarks for note
			P82	ttttgctcacatgttctttc
P84	tagcttatcgccattcgcca

Example 3: screening yggB spontaneous mutant strain with glutamic acid production capacity under high-sugar pressure condition

MHZ-0113-1 is inoculated to a slant culture medium (yeast powder 5g/L, beef extract 10g/L, peptone 10g/L, sodium chloride 10g/L, agar powder 2.5g/L, Km 25ug/L, pH 7.0-7.2) for activation, and inverted culture is carried out at 30 ℃. Selecting thallus Porphyrae from fresh activated slant, inoculating to fermentation medium (glucose 60g/L, ammonium sulfate 15g/L, KH)₂PO₄ 1g/L，MgSO₄·7H₂0 0.4g/L，FeSO₄·7H₂O 10mg/L，MnSO₄·H₂O10 mg/L, VB 1200. mu.g/L, biotin 300. mu.g/L, 0.48g/L soybean hydrolysate, adjusted to pH 7.2-7.5 with NaOH, sterilized at 121 ℃ under 0.1MPa for 15min, and then added with 1.0g of heat-sterilized calcium carbonate), and cultured with shaking at 30 ℃ and 220 rpm/mim. Subculture 4-6 times in this way and dilution plating was performed in order to obtain pure cultures carrying the yggB mutation. Randomly picking a single clone to carry out acid production test, and the test method is the same as the above. After the sugar was completely consumed, the concentration of L-glutamic acid accumulated in the medium was measured. As a result, of the 354 positive clones, 3 had different degrees of L-glutamic acid-producing ability and were designated MHZ-0113-1-008, MHZ-0113-1-266, and MHZ-0113-1-313, respectively. The acid production results are shown in Table 3, (OD)₅₆₂Is a medium diluted to 100 times at 562nm turbidityRepresents the amount of cells, and Glu (g/L) represents the amount of accumulated L-glutamic acid).

Table 3: the amount of L-glutamic acid produced by 3 yggB spontaneous mutant strains

	OD562(×100)	Glu(g/L)
			MHZ-0113-1	0.75	0.3
MHZ-0113-1-008	0.55	22
			MHZ-0113-1-266	0.37	25
MHZ-0113-1-313	0.40	18

Sequencing the yggB gene of 3 acid-producing strains to find that the glutamic acid export protein coding gene yggB has 3 different mutations: the V419D mutation (MHZ-0113-1-008): valine at amino acid position 419 is mutated to aspartic acid; M154L mutation (MHZ-0113-1-266), wherein the methionine of the 154 th amino acid is mutated into leucine; ③ 23Phe-Val-Asp-Thr-Gly-Phe-24Asp insertion mutation (MHZ-0113-1-313): valine-asparagine-threonine-glycine-phenylalanine is inserted between amino acids 23 and 24.

Example 4: evaluation of glutamic acid production capacity of yggB spontaneous mutant strain

In order to further evaluate the glutamic acid producing ability of the yggB spontaneous mutant strains, mutant-type yggB genes of each strain are introduced into wild-type ATCC13032 by a gene recombination method through a vector pK18mobsacB and are respectively named as MHZ-0113-2, MHZ-0113-3 and MHZ-0113-4. Wild type ATCC13032, MHZ-0113-1 and 3 yggB mutant strains which produce L-glutamic acid are inoculated in the slant culture medium for activation and are inversely cultured at the temperature of 30 ℃. Selecting thallus Porphyrae of the above strains from fresh activated slant, inoculating to seed culture medium (glucose 25g/L, urea 3g/L, K)₂HPO₄·3H₂O 2.2g/L，MgSO₄·7H₂00.9 g/L, 33mL/L of corn steep liquor, 22mL/L of soybean cake hydrolysate, 7.0-7.2 of pH, and sterilizing at 121 ℃ under 0.1MPa for 15 min; ) Performing shake culture at 30 deg.C and 220rpm/min to middle and late logarithmic growth stage (about 12 h) to obtain seed solution; the seed solution was inoculated at an inoculum size of 10% into a 500ml shake flask containing 20ml of a fermentation medium and cultured with shaking at 30 ℃. After the sugar was completely consumed, the concentration of L-glutamic acid accumulated in the medium was measured. The results are shown in Table 4 (OD)₅₆₂100-fold of the culture broth was at 562nm in turbidity and expressed in terms of cell amount, and Glu (g/L) was expressed in terms of the amount of accumulated L-glutamic acid).

Table 4: amount of L-glutamic acid produced by control and 3 yggB spontaneous mutant strains

	OD₅₆₂(×100)	Glu(g/L)
			ATCC13032	0.75	0.1
MHZ-0113-1	0.49	0.3
			MHZ-0113-2	0.54	18
MHZ-0113-3	0.42	20
			MHZ-0113-4	0.48	15

The results showed that the wild-type Corynebacterium glutamicum ATCC13032 produced substantially no glutamic acid before the transformation, the mutant strain of ATCC13032 having only odhA inactivation produced no glutamic acid, and the mutant strain of ATCC13032 carrying the yggB mutation had a certain level of L-glutamic acid-producing ability. It shows that the dynamic sensitive channel protein YggB has a key role in the process of producing L-glutamic acid by corynebacterium glutamicum. After mutation occurs to the yggB gene at a specific position, the protein is caused to generate conformational change, so that the protein is changed into an activated state, and the constitutive export of glutamic acid can be realized.

Example 5: evaluation of glutamic acid production capacity of yggB spontaneous mutant strain

The mutant type yggB genes are introduced into MHZ-0113-1 and are named MHZ-0113-5, MHZ-0113-6 and MHZ-0113-7 respectively. Wild-type ATCC13032, MHZ-0113-1 and 3L-glutamic acid-producing yggB mutant, odhA-inactivated strains were inoculated in slant culture as described in example 1The medium was activated and cultured in an inverted state at 30 ℃. Selecting thallus Porphyrae of the above strains from fresh activated slant, inoculating to seed culture medium (glucose 25g/L, urea 3g/L, K)₂HPO₄·3H₂O 2.2g/L，MgSO₄7 H200.9 g/L, 33mL/L of corn steep liquor, 22mL/L of bean cake hydrolysate, pH 7.0-7.2, and sterilization at 121 ℃ and 0.1MPa for 15 min; ) Performing shake culture at 30 deg.C and 220rpm/min to middle and late logarithmic growth stage (about 12 h) to obtain seed solution; the seed solution was inoculated at an inoculum size of 10% into a 500ml shake flask containing 20ml of a fermentation medium and cultured with shaking at 30 ℃. After the sugar was completely consumed, the concentration of L-glutamic acid accumulated in the medium was measured. The results are shown in Table 5 (OD)₅₆₂The turbidity of the culture broth diluted 100-fold at 562nm and expressed the amount of cells, and Glu (g/L) expressed the amount of accumulated L-glutamic acid).

Table 5: amount of L-glutamic acid produced by control and 3 strains of odhA-inactivated, yggB-mutant Strain

	OD₅₆₂(×100)	Glu(g/L)
			ATCC13032	0.60	0.1
MHZ-0113-1	0.53	0.2
			MHZ-0113-5	0.46	20
MHZ-0113-6	0.44	23
			MHZ-0113-7	0.40	14

As a result, it was revealed that the wild-type Corynebacterium glutamicum ATCC13032 and the ATCC13032 mutant strain having only odhA inactivation did not produce glutamic acid, whereas the ATCC13032 mutant strain carrying the yggB mutation had a certain level of L-glutamic acid-producing ability. It shows that the dynamic sensitive channel protein YggB has a key role in the process of producing L-glutamic acid by corynebacterium glutamicum. After mutation occurs to the yggB gene at a specific position, the protein is caused to generate conformational change, so that the protein is changed into an activated state, and the constitutive export of glutamic acid can be realized.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

SEQUENCE LISTING

<110> Gallery plum blossom Biotechnology development Co., Ltd

<120> L-glutamic acid-producing strain and method for producing L-glutamic acid

<130> MP1623782

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 533

<212> PRT

<213> Artificial sequence

<400> 1

Met Ile Leu Gly Val Pro Ile Gln Tyr Leu Leu Tyr Ser Leu Trp Asn

1 5 10 15

Trp Ile Val Asp Thr Gly Phe Asp Val Ala Ile Ile Leu Val Leu Ala

20 25 30

Phe Leu Ile Pro Arg Ile Gly Arg Leu Ala Met Arg Ile Ile Lys Arg

35 40 45

Arg Val Glu Ser Ala Ala Asp Ala Asp Thr Thr Lys Asn Gln Leu Ala

50 55 60

Phe Ala Gly Val Gly Val Tyr Ile Ala Gln Ile Val Ala Phe Phe Met

65 70 75 80

Leu Ala Val Ser Ala Met Gln Ala Phe Gly Phe Ser Leu Ala Gly Ala

85 90 95

Ala Ile Pro Ala Thr Ile Ala Ser Ala Ala Ile Gly Leu Gly Ala Gln

100 105 110

Ser Ile Val Ala Asp Phe Leu Ala Gly Phe Phe Ile Leu Thr Glu Lys

115 120 125

Gln Phe Gly Val Gly Asp Trp Val Arg Phe Glu Gly Asn Gly Ile Val

130 135 140

Val Glu Gly Thr Val Ile Glu Ile Thr Met Arg Ala Thr Lys Ile Arg

145 150 155 160

Thr Ile Ala Gln Glu Thr Val Ile Ile Pro Asn Ser Thr Ala Lys Val

165 170 175

Cys Ile Asn Asn Ser Asn Asn Trp Ser Arg Ala Val Val Val Ile Pro

180 185 190

Ile Pro Met Leu Gly Ser Glu Asn Ile Thr Asp Val Ile Ala Arg Ser

195 200 205

Glu Ala Ala Thr Arg Arg Ala Leu Gly Gln Glu Lys Ile Ala Pro Glu

210 215 220

Ile Leu Gly Glu Leu Asp Val His Pro Ala Thr Glu Val Thr Pro Pro

225 230 235 240

Thr Val Val Gly Met Pro Trp Met Val Thr Met Arg Phe Leu Val Gln

245 250 255

Val Thr Ala Gly Asn Gln Trp Leu Val Glu Arg Ala Ile Arg Thr Glu

260 265 270

Ile Ile Ser Glu Phe Trp Glu Glu Tyr Gly Ser Ala Thr Thr Thr Ser

275 280 285

Gly Thr Leu Ile Asp Ser Leu His Val Glu His Glu Glu Pro Lys Thr

290 295 300

Ser Leu Ile Asp Ala Ser Pro Gln Ala Leu Lys Glu Pro Lys Pro Glu

305 310 315 320

Ala Ala Ala Thr Val Ala Ser Leu Ala Ala Ser Ser Asn Asp Asp Ala

325 330 335

Asp Asn Ala Asp Ala Ser Val Ile Asn Ala Gly Asn Pro Glu Lys Glu

340 345 350

Leu Asp Ser Asp Val Leu Glu Gln Glu Leu Ser Ser Glu Glu Pro Glu

355 360 365

Glu Thr Ala Lys Pro Asp His Ser Leu Arg Gly Phe Phe Arg Thr Asp

370 375 380

Tyr Tyr Pro Asn Arg Trp Gln Lys Ile Leu Ser Phe Gly Gly Arg Val

385 390 395 400

Arg Met Ser Thr Ser Leu Leu Leu Gly Ala Leu Leu Leu Leu Ser Leu

405 410 415

Phe Lys Asp Met Thr Val Glu Pro Ser Glu Asn Trp Gln Asn Ser Ser

420 425 430

Gly Trp Leu Ser Pro Ser Thr Ala Thr Ser Thr Ala Val Thr Thr Ser

435 440 445

Glu Thr Ser Ala Pro Val Ser Thr Pro Ser Met Thr Val Pro Thr Thr

450 455 460

Val Glu Glu Thr Pro Thr Met Glu Ser Asn Val Glu Thr Gln Gln Glu

465 470 475 480

Thr Ser Thr Pro Ala Thr Ala Thr Pro Gln Arg Ala Asp Thr Ile Glu

485 490 495

Pro Thr Glu Glu Ala Thr Ser Gln Glu Glu Thr Thr Ala Ser Gln Thr

500 505 510

Gln Ser Pro Ala Val Glu Ala Pro Thr Ala Val Gln Glu Thr Val Ala

515 520 525

Pro Thr Ser Thr Pro

530

<210> 2

<211> 533

<212> PRT

<213> Artificial sequence

<400> 2

Met Ile Leu Gly Val Pro Ile Gln Tyr Leu Leu Tyr Ser Leu Trp Asn

1 5 10 15

Trp Ile Val Asp Thr Gly Phe Asp Val Ala Ile Ile Leu Val Leu Ala

20 25 30

Phe Leu Ile Pro Arg Ile Gly Arg Leu Ala Met Arg Ile Ile Lys Arg

35 40 45

Arg Val Glu Ser Ala Ala Asp Ala Asp Thr Thr Lys Asn Gln Leu Ala

50 55 60

Phe Ala Gly Val Gly Val Tyr Ile Ala Gln Ile Val Ala Phe Phe Met

65 70 75 80

Leu Ala Val Ser Ala Met Gln Ala Phe Gly Phe Ser Leu Ala Gly Ala

85 90 95

Ala Ile Pro Ala Thr Ile Ala Ser Ala Ala Ile Gly Leu Gly Ala Gln

100 105 110

Ser Ile Val Ala Asp Phe Leu Ala Gly Phe Phe Ile Leu Thr Glu Lys

115 120 125

Gln Phe Gly Val Gly Asp Trp Val Arg Phe Glu Gly Asn Gly Ile Val

130 135 140

Val Glu Gly Thr Val Ile Glu Ile Thr Leu Arg Ala Thr Lys Ile Arg

145 150 155 160

Thr Ile Ala Gln Glu Thr Val Ile Ile Pro Asn Ser Thr Ala Lys Val

165 170 175

Cys Ile Asn Asn Ser Asn Asn Trp Ser Arg Ala Val Val Val Ile Pro

180 185 190

Ile Pro Met Leu Gly Ser Glu Asn Ile Thr Asp Val Ile Ala Arg Ser

195 200 205

Glu Ala Ala Thr Arg Arg Ala Leu Gly Gln Glu Lys Ile Ala Pro Glu

210 215 220

Ile Leu Gly Glu Leu Asp Val His Pro Ala Thr Glu Val Thr Pro Pro

225 230 235 240

Thr Val Val Gly Met Pro Trp Met Val Thr Met Arg Phe Leu Val Gln

245 250 255

Val Thr Ala Gly Asn Gln Trp Leu Val Glu Arg Ala Ile Arg Thr Glu

260 265 270

Ile Ile Ser Glu Phe Trp Glu Glu Tyr Gly Ser Ala Thr Thr Thr Ser

275 280 285

Gly Thr Leu Ile Asp Ser Leu His Val Glu His Glu Glu Pro Lys Thr

290 295 300

Ser Leu Ile Asp Ala Ser Pro Gln Ala Leu Lys Glu Pro Lys Pro Glu

305 310 315 320

Ala Ala Ala Thr Val Ala Ser Leu Ala Ala Ser Ser Asn Asp Asp Ala

325 330 335

Asp Asn Ala Asp Ala Ser Val Ile Asn Ala Gly Asn Pro Glu Lys Glu

340 345 350

Leu Asp Ser Asp Val Leu Glu Gln Glu Leu Ser Ser Glu Glu Pro Glu

355 360 365

Glu Thr Ala Lys Pro Asp His Ser Leu Arg Gly Phe Phe Arg Thr Asp

370 375 380

Tyr Tyr Pro Asn Arg Trp Gln Lys Ile Leu Ser Phe Gly Gly Arg Val

385 390 395 400

Arg Met Ser Thr Ser Leu Leu Leu Gly Ala Leu Leu Leu Leu Ser Leu

405 410 415

Phe Lys Val Met Thr Val Glu Pro Ser Glu Asn Trp Gln Asn Ser Ser

420 425 430

Gly Trp Leu Ser Pro Ser Thr Ala Thr Ser Thr Ala Val Thr Thr Ser

435 440 445

Glu Thr Ser Ala Pro Val Ser Thr Pro Ser Met Thr Val Pro Thr Thr

450 455 460

Val Glu Glu Thr Pro Thr Met Glu Ser Asn Val Glu Thr Gln Gln Glu

465 470 475 480

Thr Ser Thr Pro Ala Thr Ala Thr Pro Gln Arg Ala Asp Thr Ile Glu

485 490 495

Pro Thr Glu Glu Ala Thr Ser Gln Glu Glu Thr Thr Ala Ser Gln Thr

500 505 510

Gln Ser Pro Ala Val Glu Ala Pro Thr Ala Val Gln Glu Thr Val Ala

515 520 525

Pro Thr Ser Thr Pro

530

<210> 3

<211> 538

<212> PRT

<213> Artificial sequence

<400> 3

Met Ile Leu Gly Val Pro Ile Gln Tyr Leu Leu Tyr Ser Leu Trp Asn

1 5 10 15

Trp Ile Val Asp Thr Gly Phe Val Asp Thr Gly Phe Asp Val Ala Ile

20 25 30

Ile Leu Val Leu Ala Phe Leu Ile Pro Arg Ile Gly Arg Leu Ala Met

35 40 45

Arg Ile Ile Lys Arg Arg Val Glu Ser Ala Ala Asp Ala Asp Thr Thr

50 55 60

Lys Asn Gln Leu Ala Phe Ala Gly Val Gly Val Tyr Ile Ala Gln Ile

65 70 75 80

Val Ala Phe Phe Met Leu Ala Val Ser Ala Met Gln Ala Phe Gly Phe

85 90 95

Ser Leu Ala Gly Ala Ala Ile Pro Ala Thr Ile Ala Ser Ala Ala Ile

100 105 110

Gly Leu Gly Ala Gln Ser Ile Val Ala Asp Phe Leu Ala Gly Phe Phe

115 120 125

Ile Leu Thr Glu Lys Gln Phe Gly Val Gly Asp Trp Val Arg Phe Glu

130 135 140

Gly Asn Gly Ile Val Val Glu Gly Thr Val Ile Glu Ile Thr Met Arg

145 150 155 160

Ala Thr Lys Ile Arg Thr Ile Ala Gln Glu Thr Val Ile Ile Pro Asn

165 170 175

Ser Thr Ala Lys Val Cys Ile Asn Asn Ser Asn Asn Trp Ser Arg Ala

180 185 190

Val Val Val Ile Pro Ile Pro Met Leu Gly Ser Glu Asn Ile Thr Asp

195 200 205

Val Ile Ala Arg Ser Glu Ala Ala Thr Arg Arg Ala Leu Gly Gln Glu

210 215 220

Lys Ile Ala Pro Glu Ile Leu Gly Glu Leu Asp Val His Pro Ala Thr

225 230 235 240

Glu Val Thr Pro Pro Thr Val Val Gly Met Pro Trp Met Val Thr Met

245 250 255

Arg Phe Leu Val Gln Val Thr Ala Gly Asn Gln Trp Leu Val Glu Arg

260 265 270

Ala Ile Arg Thr Glu Ile Ile Ser Glu Phe Trp Glu Glu Tyr Gly Ser

275 280 285

Ala Thr Thr Thr Ser Gly Thr Leu Ile Asp Ser Leu His Val Glu His

290 295 300

Glu Glu Pro Lys Thr Ser Leu Ile Asp Ala Ser Pro Gln Ala Leu Lys

305 310 315 320

Glu Pro Lys Pro Glu Ala Ala Ala Thr Val Ala Ser Leu Ala Ala Ser

325 330 335

Ser Asn Asp Asp Ala Asp Asn Ala Asp Ala Ser Val Ile Asn Ala Gly

340 345 350

Asn Pro Glu Lys Glu Leu Asp Ser Asp Val Leu Glu Gln Glu Leu Ser

355 360 365

Ser Glu Glu Pro Glu Glu Thr Ala Lys Pro Asp His Ser Leu Arg Gly

370 375 380

Phe Phe Arg Thr Asp Tyr Tyr Pro Asn Arg Trp Gln Lys Ile Leu Ser

385 390 395 400

Phe Gly Gly Arg Val Arg Met Ser Thr Ser Leu Leu Leu Gly Ala Leu

405 410 415

Leu Leu Leu Ser Leu Phe Lys Val Met Thr Val Glu Pro Ser Glu Asn

420 425 430

Trp Gln Asn Ser Ser Gly Trp Leu Ser Pro Ser Thr Ala Thr Ser Thr

435 440 445

Ala Val Thr Thr Ser Glu Thr Ser Ala Pro Val Ser Thr Pro Ser Met

450 455 460

Thr Val Pro Thr Thr Val Glu Glu Thr Pro Thr Met Glu Ser Asn Val

465 470 475 480

Glu Thr Gln Gln Glu Thr Ser Thr Pro Ala Thr Ala Thr Pro Gln Arg

485 490 495

Ala Asp Thr Ile Glu Pro Thr Glu Glu Ala Thr Ser Gln Glu Glu Thr

500 505 510

Thr Ala Ser Gln Thr Gln Ser Pro Ala Val Glu Ala Pro Thr Ala Val

515 520 525

Gln Glu Thr Val Ala Pro Thr Ser Thr Pro

530 535

<210> 4

<211> 1602

<212> DNA

<213> Artificial sequence

<400> 4

cactacatcg ggaaccctca ttgattcctt acacgttgag catgaagagc caaagacctc 60

gcttatcgac gcctcccccc aggctcttaa ggaaccgaag ccggaggctg cggcgacggt 120

tgcatcgcta gctgcatcct ctaacgacga tgcagacaat gcagacgcct cggtgatcaa 180

tgcaggcaat ccagagaagg aacttgattc cgatgtgctg gaacaagaac tctccagcga 240

agaaccggaa gaaacagcaa aaccagatca ctctctccga ggcttcttcc gcactgatta 300

ctacccaaat cggtggcaga agatcctgtc gtttggcgga cgtgtccgca tgagcacgtc 360

cctgttgttg ggtgcgctgc tcttgctgtc actatttaag gacatgactg tggaaccaag 420

tgagaattgg caaaactcca gtggatggct gtcaccaagc actgccacct caactgcggt 480

gaccacctcc gaaacttccg cgccagtaag cacgccttcg atgacagtgc ccactacggt 540

ggaggagacc ccaacgatgg aatctaacgt cgaaacgcag caggaaacct caacccctgc 600

aaccgcaacg ccccagcgag ccgacaccat cgaaccgacc gaggaagcca cgtcgcagga 660

ggaaacgact gcgtcgcaga cgcagtctcc agcagtggaa gcaccaaccg cggtccaaga 720

gacagttgcg ccgacgtcca ccccttagat gattttaggc gtacccattc aatatttgct 780

ctattcattg tggaattgga ttgtcgatac cggttttgat gtagcaatta tcctggtctt 840

ggcgtttttg attccacgta tcggccgact ggccatgcgt attatcaagc gccgagtgga 900

gtctgcagcc gatgcggaca ccactaagaa ccagctcgcg ttcgccggcg ttggcgttta 960

tatcgcgcaa attgtggcgt ttttcatgct tgccgtctcc gcgatgcagg cttttggttt 1020

ctctctcgcg ggcgctgcga ttccggcaac cattgcgtca gctgccattg gccttggtgc 1080

gcagtcgatt gttgcggact tcttggccgg atttttcatc ctgacggaaa agcaattcgg 1140

cgtgggtgac tgggtgcgtt ttgagggcaa cggcatcgtt gtcgaaggca ccgtcattga 1200

gatcaccatg cgcgcgacca aaattcgcac gattgcacaa gagaccgtga tcatccccaa 1260

ctccacggcg aaagtgtgca tcaacaattc taataactgg tcgcgtgcgg ttgtcgttat 1320

tccgatcccc atgttgggtt ctgaaaacat cacagatgtc atcgcgcgct ctgaagctgc 1380

gactcgtcgc gcacttggcc aggagaaaat cgcaccggaa atcctcggtg aactcgatgt 1440

gcacccagcc acggaagtca cgccgccaac ggtggtcggc atgccgtgga tggtcaccat 1500

gcgtttcctc gtgcaagtca ccgccggcaa tcaatggctg gtcgaacgcg ccatccgcac 1560

agaaatcatc agcgaattct gggaagaata cggcagcgca ac 1602

<210> 5

<211> 1602

<212> DNA

<213> Artificial sequence

<400> 5

atgattttag gcgtacccat tcaatatttg ctctattcat tgtggaattg gattgtcgat 60

accggttttg atgtagcaat tatcctggtc ttggcgtttt tgattccacg tatcggccga 120

ctggccatgc gtattatcaa gcgccgagtg gagtctgcag ccgatgcgga caccactaag 180

aaccagctcg cgttcgccgg cgttggcgtt tatatcgcgc aaattgtggc gtttttcatg 240

cttgccgtct ccgcgatgca ggcttttggt ttctctctcg cgggcgctgc gattccggca 300

accattgcgt cagctgccat tggccttggt gcgcagtcga ttgttgcgga cttcttggcc 360

ggatttttca tcctgacgga aaagcaattc ggcgtgggtg actgggtgcg ttttgagggc 420

aacggcatcg ttgtcgaagg caccgtcatt gagatcaccc tgcgcgcgac caaaattcgc 480

acgattgcac aagagaccgt gatcatcccc aactccacgg cgaaagtgtg catcaacaat 540

tctaataact ggtcgcgtgc ggttgtcgtt attccgatcc ccatgttggg ttctgaaaac 600

atcacagatg tcatcgcgcg ctctgaagct gcgactcgtc gcgcacttgg ccaggagaaa 660

atcgcaccgg aaatcctcgg tgaactcgat gtgcacccag ccacggaagt cacgccgcca 720

acggtggtcg gcatgccgtg gatggtcacc atgcgtttcc tcgtgcaagt caccgccggc 780

aatcaatggc tggtcgaacg cgccatccgc acagaaatca tcagcgaatt ctgggaagaa 840

tacggcagcg caaccactac atcgggaacc ctcattgatt ccttacacgt tgagcatgaa 900

gagccaaaga cctcgcttat cgacgcctcc ccccaggctc ttaaggaacc gaagccggag 960

gctgcggcga cggttgcatc gctagctgca tcctctaacg acgatgcaga caatgcagac 1020

gcctcggtga tcaatgcagg caatccagag aaggaacttg attccgatgt gctggaacaa 1080

gaactctcca gcgaagaacc ggaagaaaca gcaaaaccag atcactctct ccgaggcttc 1140

ttccgcactg attactaccc aaatcggtgg cagaagatcc tgtcgtttgg cggacgtgtc 1200

cgcatgagca cgtccctgtt gttgggtgcg ctgctcttgc tgtcactatt taaggtcatg 1260

actgtggaac caagtgagaa ttggcaaaac tccagtggat ggctgtcacc aagcactgcc 1320

acctcaactg cggtgaccac ctccgaaact tccgcgccag taagcacgcc ttcgatgaca 1380

gtgcccacta cggtggagga gaccccaacg atggaatcta acgtcgaaac gcagcaggaa 1440

acctcaaccc ctgcaaccgc aacgccccag cgagccgaca ccatcgaacc gaccgaggaa 1500

gccacgtcgc aggaggaaac gactgcgtcg cagacgcagt ctccagcagt ggaagcacca 1560

accgcggtcc aagagacagt tgcgccgacg tccacccctt ag 1602

<210> 6

<211> 1617

<212> DNA

<213> Artificial sequence

<400> 6

atgattttag gcgtacccat tcaatatttg ctctattcat tgtggaattg gattgtcgat 60

accggttttg tcgataccgg ttttgatgta gcaattatcc tggtcttggc gtttttgatt 120

ccacgtatcg gccgactggc catgcgtatt atcaagcgcc gagtggagtc tgcagccgat 180

gcggacacca ctaagaacca gctcgcgttc gccggcgttg gcgtttatat cgcgcaaatt 240

gtggcgtttt tcatgcttgc cgtctccgcg atgcaggctt ttggtttctc tctcgcgggc 300

gctgcgattc cggcaaccat tgcgtcagct gccattggcc ttggtgcgca gtcgattgtt 360

gcggacttct tggccggatt tttcatcctg acggaaaagc aattcggcgt gggtgactgg 420

gtgcgttttg agggcaacgg catcgttgtc gaaggcaccg tcattgagat caccatgcgc 480

gcgaccaaaa ttcgcacgat tgcacaagag accgtgatca tccccaactc cacggcgaaa 540

gtgtgcatca acaattctaa taactggtcg cgtgcggttg tcgttattcc gatccccatg 600

ttgggttctg aaaacatcac agatgtcatc gcgcgctctg aagctgcgac tcgtcgcgca 660

cttggccagg agaaaatcgc accggaaatc ctcggtgaac tcgatgtgca cccagccacg 720

gaagtcacgc cgccaacggt ggtcggcatg ccgtggatgg tcaccatgcg tttcctcgtg 780

caagtcaccg ccggcaatca atggctggtc gaacgcgcca tccgcacaga aatcatcagc 840

gaattctggg aagaatacgg cagcgcaacc actacatcgg gaaccctcat tgattcctta 900

cacgttgagc atgaagagcc aaagacctcg cttatcgacg cctcccccca ggctcttaag 960

gaaccgaagc cggaggctgc ggcgacggtt gcatcgctag ctgcatcctc taacgacgat 1020

gcagacaatg cagacgcctc ggtgatcaat gcaggcaatc cagagaagga acttgattcc 1080

gatgtgctgg aacaagaact ctccagcgaa gaaccggaag aaacagcaaa accagatcac 1140

tctctccgag gcttcttccg cactgattac tacccaaatc ggtggcagaa gatcctgtcg 1200

tttggcggac gtgtccgcat gagcacgtcc ctgttgttgg gtgcgctgct cttgctgtca 1260

ctatttaagg tcatgactgt ggaaccaagt gagaattggc aaaactccag tggatggctg 1320

tcaccaagca ctgccacctc aactgcggtg accacctccg aaacttccgc gccagtaagc 1380

acgccttcga tgacagtgcc cactacggtg gaggagaccc caacgatgga atctaacgtc 1440

gaaacgcagc aggaaacctc aacccctgca accgcaacgc cccagcgagc cgacaccatc 1500

gaaccgaccg aggaagccac gtcgcaggag gaaacgactg cgtcgcagac gcagtctcca 1560

gcagtggaag caccaaccgc ggtccaagag acagttgcgc cgacgtccac cccttag 1617

<210> 7

<211> 533

<212> PRT

<213> ATCC13032

<400> 7

Met Ile Leu Gly Val Pro Ile Gln Tyr Leu Leu Tyr Ser Leu Trp Asn

1 5 10 15

Trp Ile Val Asp Thr Gly Phe Asp Val Ala Ile Ile Leu Val Leu Ala

20 25 30

Phe Leu Ile Pro Arg Ile Gly Arg Leu Ala Met Arg Ile Ile Lys Gln

35 40 45

Arg Val Glu Ser Ala Ala Asp Ala Asp Thr Thr Lys Asn Gln Leu Ala

50 55 60

Phe Ala Gly Val Gly Val Tyr Ile Ala Gln Ile Val Ala Phe Phe Met

65 70 75 80

Leu Ala Val Ser Ala Met Gln Ala Phe Gly Phe Ser Leu Ala Gly Ala

85 90 95

Ala Ile Pro Ala Thr Ile Ala Ser Ala Ala Ile Gly Leu Gly Ala Gln

100 105 110

Ser Ile Val Ala Asp Phe Leu Ala Gly Phe Phe Ile Leu Thr Glu Lys

115 120 125

Gln Phe Gly Val Gly Asp Trp Val Arg Phe Glu Gly Asn Gly Ile Val

130 135 140

Val Glu Gly Thr Val Ile Glu Ile Thr Met Arg Ala Thr Lys Ile Arg

145 150 155 160

Thr Ile Ala Gln Glu Thr Val Ile Ile Pro Asn Ser Thr Ala Lys Val

165 170 175

Cys Ile Asn Asn Ser Asn Asn Trp Ser Arg Ala Val Val Val Ile Pro

180 185 190

Ile Pro Met Leu Gly Ser Glu Asn Ile Thr Asp Val Ile Ala Arg Ser

195 200 205

Glu Ala Ala Thr Arg Arg Ala Leu Gly Gln Glu Lys Ile Ala Pro Glu

210 215 220

Ile Leu Gly Glu Leu Asp Val His Pro Ala Thr Glu Val Thr Pro Pro

225 230 235 240

Thr Val Val Gly Met Pro Trp Met Val Thr Met Arg Phe Leu Val Gln

245 250 255

Val Thr Ala Gly Asn Gln Trp Leu Val Glu Arg Ala Ile Arg Thr Glu

260 265 270

Ile Ile Asn Glu Phe Trp Glu Glu Tyr Gly Ser Ala Thr Thr Thr Ser

275 280 285

Gly Thr Leu Ile Asp Ser Leu His Val Glu His Glu Glu Pro Lys Thr

290 295 300

Ser Leu Ile Asp Ala Ser Pro Gln Ala Leu Lys Glu Pro Lys Pro Glu

305 310 315 320

Ala Ala Ala Thr Val Ala Ser Leu Ala Ala Ser Ser Asn Asp Asp Ala

325 330 335

Asp Asn Ala Asp Ala Ser Ala Ile Asn Ala Gly Asn Pro Glu Lys Glu

340 345 350

Leu Asp Ser Asp Val Leu Glu Gln Glu Leu Ser Ser Glu Glu Pro Glu

355 360 365

Glu Thr Ala Lys Pro Asp His Ser Leu Arg Gly Phe Phe Arg Thr Asp

370 375 380

Tyr Tyr Pro Asn Arg Trp Gln Lys Ile Leu Ser Phe Gly Gly Arg Val

385 390 395 400

Arg Met Ser Thr Ser Leu Leu Leu Gly Ala Leu Leu Leu Leu Ser Leu

405 410 415

Phe Lys Val Met Thr Val Glu Pro Ser Glu Asn Trp Gln Asn Ser Ser

420 425 430

Gly Trp Leu Ser Pro Ser Thr Ala Thr Ser Thr Ala Val Thr Thr Ser

435 440 445

Glu Thr Ser Ala Pro Ala Ser Thr Pro Ser Met Thr Val Pro Thr Thr

450 455 460

Val Glu Glu Thr Pro Thr Met Glu Ser Ser Val Glu Thr Gln Gln Glu

465 470 475 480

Thr Ser Thr Pro Ala Thr Ala Thr Pro Gln Arg Ala Asp Thr Ile Glu

485 490 495

Pro Thr Glu Glu Ala Thr Ser Gln Glu Glu Thr Thr Ala Ser Gln Thr

500 505 510

Gln Ser Pro Ala Val Glu Ala Pro Thr Ala Val Gln Glu Thr Val Ala

515 520 525

Pro Thr Ser Thr Pro

530

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence

<400> 8

cgggatcctg gcggagtcca tcagtggg 28

<210> 9

<211> 29

<212> DNA

<213> Artificial sequence

<400> 9

cccaagctta cgcaatgaac gttccttac 29

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<400> 10

ttttgctcac atgttctttc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

tagcttatcg ccattcgcca 20

Claims

1. The amino acid sequence of the mutant YggB protein is shown as SEQ ID NO.1, SEQ ID NO. 2 or SEQ ID NO. 3.

2. A DNA molecule encoding the mutant YggB protein of claim 1.

3. The DNA molecule of claim 2, characterized in that its nucleotide sequence is as shown in SEQ ID NO 4, SEQ ID NO 5 or SEQ ID NO 6.

4. A recombinant strain expressing the DNA molecule of claim 2 or 3.

5. The recombinant strain according to claim 4, wherein the starting strain of the recombinant strain is ATCC13032 or ATCC13032 in which the odhA gene is knocked out.

6. The recombinant strain according to claim 5, wherein the knockdown odhA gene has a deposit number of ATCC13032 of CGMCC No. 13401.

7. Use of the recombinant strain of any one of claims 4 to 6 for the production of L-glutamic acid.

8. A method for producing L-glutamic acid by fermenting the recombinant strain according to any one of claims 4 to 6.

9. The production method according to claim 8, wherein the fermentation temperature is 30 ℃, the rotation speed is 220rpm/min, and the time is 24 h.

10. The production method according to claim 8, wherein the culture medium for fermentation comprises water and: