CN111406712A - Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 - Google Patents
Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 Download PDFInfo
- Publication number
- CN111406712A CN111406712A CN202010441774.3A CN202010441774A CN111406712A CN 111406712 A CN111406712 A CN 111406712A CN 202010441774 A CN202010441774 A CN 202010441774A CN 111406712 A CN111406712 A CN 111406712A
- Authority
- CN
- China
- Prior art keywords
- feather
- colored
- white
- slow
- babcock
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 210000003746 feather Anatomy 0.000 title claims abstract description 165
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 79
- 235000013601 eggs Nutrition 0.000 title claims abstract description 71
- 238000000034 method Methods 0.000 title claims abstract description 42
- 238000009395 breeding Methods 0.000 claims abstract description 44
- 230000001488 breeding effect Effects 0.000 claims abstract description 43
- 235000013372 meat Nutrition 0.000 claims abstract description 19
- 235000013330 chicken meat Nutrition 0.000 claims description 67
- 238000010187 selection method Methods 0.000 claims description 17
- 238000009396 hybridization Methods 0.000 claims description 14
- 206010048245 Yellow skin Diseases 0.000 claims description 12
- 239000003147 molecular marker Substances 0.000 claims description 9
- 238000000746 purification Methods 0.000 claims description 9
- 230000008030 elimination Effects 0.000 claims description 8
- 238000003379 elimination reaction Methods 0.000 claims description 8
- 230000017448 oviposition Effects 0.000 claims description 8
- 238000009402 cross-breeding Methods 0.000 claims description 7
- 230000037396 body weight Effects 0.000 claims description 5
- 238000000926 separation method Methods 0.000 claims description 2
- 230000008901 benefit Effects 0.000 abstract description 5
- 230000000737 periodic effect Effects 0.000 abstract description 4
- 230000008569 process Effects 0.000 abstract description 3
- 238000001514 detection method Methods 0.000 description 28
- 235000011777 Corchorus aestuans Nutrition 0.000 description 10
- 235000010862 Corchorus capsularis Nutrition 0.000 description 10
- 240000000491 Corchorus aestuans Species 0.000 description 9
- 239000000463 material Substances 0.000 description 9
- 239000008280 blood Substances 0.000 description 7
- 210000004369 blood Anatomy 0.000 description 7
- 238000004519 manufacturing process Methods 0.000 description 6
- 108700028369 Alleles Proteins 0.000 description 4
- 241000519995 Stachys sylvatica Species 0.000 description 4
- 230000006872 improvement Effects 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- KEQXNNJHMWSZHK-UHFFFAOYSA-L 1,3,2,4$l^{2}-dioxathiaplumbetane 2,2-dioxide Chemical compound [Pb+2].[O-]S([O-])(=O)=O KEQXNNJHMWSZHK-UHFFFAOYSA-L 0.000 description 3
- 244000144977 poultry Species 0.000 description 3
- 235000013594 poultry meat Nutrition 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 230000009467 reduction Effects 0.000 description 3
- 238000011895 specific detection Methods 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 210000003323 beak Anatomy 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 244000025254 Cannabis sativa Species 0.000 description 1
- 235000012766 Cannabis sativa ssp. sativa var. sativa Nutrition 0.000 description 1
- 235000012765 Cannabis sativa ssp. sativa var. spontanea Nutrition 0.000 description 1
- 240000004792 Corchorus capsularis Species 0.000 description 1
- 241000191398 Kalanchoe blossfeldiana Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 241000255969 Pieris brassicae Species 0.000 description 1
- BQCADISMDOOEFD-UHFFFAOYSA-N Silver Chemical compound [Ag] BQCADISMDOOEFD-UHFFFAOYSA-N 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 210000000436 anus Anatomy 0.000 description 1
- 235000009120 camo Nutrition 0.000 description 1
- 235000005607 chanvre indien Nutrition 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000013065 commercial product Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000000875 corresponding effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000037213 diet Effects 0.000 description 1
- 235000005911 diet Nutrition 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000036750 egg laying performance Effects 0.000 description 1
- 230000008014 freezing Effects 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 239000011487 hemp Substances 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 229910052709 silver Inorganic materials 0.000 description 1
- 239000004332 silver Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000010257 thawing Methods 0.000 description 1
- 239000010331 tianhuang Substances 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for cultivating high-quality chicken with colored feather and eggs by using babcock B380, which comprises the following steps: step 1, hybridizing a black-tail fast-feather babcock B380 with a recessive white locus as a heterozygote as a female parent and a fast-feather individual of a local variety with recessive white feather as a male parent to breed a fast-feather white-feather line; step 2, hybridizing by taking a slow-feather babcock B380 with a recessive white locus as a wild homozygote as a female parent and taking a slow-feather colored-feather local variety with the recessive white locus as the wild homozygote as a male parent to breed a colored-feather slow-feather line; and 3, selecting the bred white feather fast feather line as a male parent and the bred colored feather slow feather line as a female parent, and hybridizing to produce the high-quality commercial chicken fry with colored feathers and eggs. Compared with the existing breeding of high-yield laying hens, the method has the advantages that the process is accelerated, and the bred commercial seedlings can distinguish male and female; compared with local varieties, the egg yield is improved, the quality is good, the meat and eggs can be used simultaneously, and the uncertainty or periodic risk brought by specialized laying hen and broiler chicken consumption markets is avoided.
Description
Technical Field
The invention relates to the technical field of poultry breeding methods, in particular to a method for breeding high-quality chickens with both colored feather and eggs by using babcock B380.
Background
The babcock B380 is a high-yield laying hen of medium body type, cultivated by Isa France, and has no nesting property. The body weight of the egg laying machine is 1800 grams at 140 days, the egg laying number is 152 at 300 days, the body weight is 1900g at 300 days, and the egg laying number is 325 at 72 weeks. Simultaneously, the method also has other germplasm characteristics: 50% of the commercial generations are white tail red feathers, and 50% are black tail red feathers; 50% of fast-feather individuals and 50% of slow-feather individuals are sold in the commercial generation. The two characteristics are convenient for the breeding of the target strain.
Chinese people like to eat chicken, the diet culture in this aspect is long-flowing, and the chicken consumption pays attention to the appearance of chicken besides paying attention to the delicious taste. Generally, people prefer colored feather chickens such as red feather, yellow feather, hemp feather and the like, so that a market foundation is provided for the development of B380. Firstly, babcock B380 (hereinafter referred to as B380) is a high-yield layer variety, the feather color is red, brown shell eggs are produced, and excellent egg laying performance is a basic condition that B380 can stand in the Chinese market. At present, the varieties of the brown shell layer chicken market competing with the B380 in China comprise the kalanchoe, the Jinghong Yisha, the Roman and the like.
However, with the improvement of the requirements of people on the quality of eggs and the quality of chicken, the existing specialized varieties of laying hens and broilers are influenced by the supply demand of the markets for the eggs and the chicken, and have uncertain or periodic risks. Moreover, for breeding enterprises or farmers, the risk undoubtedly causes economic uncertain loss, and how to combine laying hens and broilers improves specialized broilers or laying hens in the prior art so as to meet the requirements of people on high-quality eggs and high-quality chicken, and avoid the market-oriented uncertain risk for the breeding enterprises or farmers, which becomes a problem to be faced and solved urgently in the breeding industry.
Disclosure of Invention
The invention aims to provide a method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380. The method fully utilizes the germplasm advantages of the babcock B380, accelerates the breeding process, cultures male and female commercial seedlings which can be self-distinguished by fast and slow feathers, obviously improves the egg yield compared with local varieties, has good egg quality, and can effectively avoid the uncertain or periodic risks brought by specialized laying hen and broiler chicken consumption markets.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a method for cultivating high-quality chicken with colored feather and eggs by using babcock B380, which comprises the following steps:
step 1, selecting a white feather fast feather system: carrying out hybridization by taking a black-tail fast-feather babcock B380 individual taking a recessive white locus as a heterozygote as a female parent and a colored-feather local variety fast-feather individual taking a recessive white feather as a male parent to generate an F0 generation, carrying out cross-breeding on the F0 generation, selecting and reserving white-feather, yellow-foot and yellow-skin individuals as an F1 generation, and carrying out continuous breeding to obtain a white-feather fast-feather line;
step 2, selecting a colored feather slow feather system: carrying out hybridization by taking a slow-feather babcock B380 individual with a recessive white locus as a wild homozygote as a female parent and taking a slow-feather colored-feather local variety with the recessive white locus as the wild homozygote as a male parent to generate an F0 generation, carrying out cross breeding on the F0 generation, selecting and reserving the individual according with the local variety characteristics as an F1 generation, and breeding continuously to obtain a colored-feather slow-feather line;
step 3, hybridization matching: and (3) selecting the white feather fast feather line bred in the step (1) as a male parent and the colored feather slow feather line bred in the step (2) as a female parent, and hybridizing to produce the high-quality commercial chicken fry with colored feather and meat and eggs.
Preferably, the F0 selected in step 1 is replaced by white feather individuals.
Preferably, the F0 passage selected in step 2 is according with local breed characteristics, and slow-feather cocks are selected by the aid of molecular markers, and heterozygote individuals are eliminated.
Preferably, the local variety is a variety with recessive white feather separation in the local variety, and specifically, the local variety can be Guangfeng white-ear yellow chicken, Hainan Wenchang chicken or Xinjiang Hotan black chicken.
Preferably, egg-laying traits are selected in step 1 and step 2 according to a family selection method, and the family selection and independent elimination selection method is used for purification and fixing appearance traits, and continuous breeding of 3 or more generations is carried out.
Preferably, in the step 3, the commercial seedlings are identified into male and female seedlings according to the feather speed, the female seedlings are fast feathers, and the male seedlings are slow feathers.
Preferably, the stock seedlings of the commercial seedlings lay eggs 115 at 300-day-old, average egg weight 50g (average egg weight about 50g), and 300-day-old body weight 1.6-2.0kg (300-day-old body weight about 1.6-2.0 kg).
The invention discloses the following technical effects:
the babcock B380 disclosed by the invention has the following characteristics: 1) black and white tail individuals in the offspring each account for 50%: by utilizing the method for removing the white tail and selecting and reserving the black tail, the individuals carrying dominant white sites of the babcock B380 are removed, convenience is provided for subsequent feather color purification, and the feather color character breeding can be completed at least one generation in advance; 2) slow and fast feather individuals account for 50% each: the characteristic is utilized to quickly establish a fast feather line and a slow feather line with high yield, and compared with the prior art that high-yield laying hens such as the harlan brown, the white Lairan, the Roman and the like are utilized, the establishment of a pure fast-slow feather line is completed at least 1 generation ahead of time; 3) babcock B38050% is recessive white feather heterozygote, and the black tail individuals carry neither dominant white mutant gene nor silver feather mutant gene, and the recessive white feather line can be conveniently cultivated by utilizing the characteristic. According to the invention, the germplasm advantages of babcock B380 are fully utilized, the breeding process is accelerated, and male and female can be automatically distinguished according to the breeding speed of the bred commercial seedling, wherein the male line is fast-feather white-feather, and the female line is colored-feather slow-feather, which is an advantage that other high-yield laying hens cannot have.
And (II) identifying male and female feather speeds. The invention carries out male-female self-discrimination through feather speed, can effectively avoid the problem of horizontal spread of diseases caused by anus turning discrimination, and the like, and can effectively improve the quality of commercial seedlings.
And (III) the recessive white allele carried by the commercial generation is not easy to be stolen. The commodity surrogate parent is the recessive white feather, so that the risk of seed source embezzlement can be effectively avoided.
And (IV) effectively avoiding market risks. The high-quality chicken with meat and eggs cultivated by the method disclosed by the invention can provide high-quality eggs and high-quality chicken for consumers, and particularly the high-quality eggs are high in price, the price is basically not influenced by market fluctuation, and the profitability is strong; the production of high-quality eggs and high-quality broilers is combined, so that the comprehensive benefit of cultivation is improved, and the guarantee can be provided for effectively avoiding the uncertain risk brought by the market.
And fifthly, the defect of meat quality reduction caused by introducing high-yield laying hens in the prior art is overcome by improving the feeding age. Research shows that the feeding age is positively correlated with the meat quality, but the cost is increased. The invention compensates for the loss of meat quality reduction brought by introducing high-yield laying hens by improving the marketing day age, and compensates for the economic cost generated by the feeding day age by improving the egg production of commodity generations before marketing.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
Example 1
The method for cultivating high-quality chickens with both colored feathers and eggs by using the babcock B380 (particularly for cultivating high-quality chickens with both meat and eggs by using Guangfeng white-eared yellow chickens and the babcock B380) comprises the following steps:
step 1: cultivation of fast white feather line
(1) Selection of babcock B380 hens
Firstly, fast-feather black-tail Buckock B380 is selected, and then a recessive white point is selected and reserved as a heterozygote (Cc) through a molecular detection method to serve as a breeding material.
The method for detecting leucoderma in the reference document of the molecular detection method (identification and frequency distribution of appearance character related mutation of Xuefeng silky fowl, Gao Xinfeng, etc., Chinese poultry, 2016, volume 2) is different in the treatment of the template in the embodiment, and the embodiment adopts the direct PCR of simply treated blood, thereby omitting the step of extracting DNA, quickening the detection period and reducing the detection cost.
The method comprises the following specific steps:
blood sample collection, blood sample collection of 0.5m L from the infrawinged vein of each individual, was immediately shaken up in a centrifuge tube containing an anticoagulant with a concentration of 2% at 70. mu. L and stored at-20 ℃.
b, diluting by 200 times, namely drawing anticoagulated blood by 1 mu L, adding 199 mu L double distilled water, and shaking up.
c, repeated freezing and thawing: the diluted blood samples were freeze-thawed repeatedly in liquid nitrogen 3 times.
d, PCR system, taking 10 mu L blood sample treated in step c as DNA template, adding 0.2 mu L primer and adding PCR mix to 20 mu L system.
The subsequent PCR reaction procedure and determination method are the same as those of the above-mentioned reference.
(2) Selection of white-ear yellow chickens
Selecting a fast-feather cock with recessive white feather and white ear yellow chicken.
(3) Hybridization of
And (3) hybridizing the fast-feather white feather cocks, the white-ear cocks and the yellow-chicken cocks in the step (2) with the babcock B380 selected and remained in the step (1), and selecting and remaining white-feather individuals as a breeding basic group F0 generation.
(4) Transverse crossing propagation
The F0 generation was cross-bred, and individuals with white feather, yellow feet and yellow skin were selected as the F1 generation.
(5) Continuous breeding
Through continuous breeding of 3 or more generations (egg production character selection according to family selection method, family selection and independent elimination selection method purification and fixed appearance character), the white-feather fast-feathering strain with stable performance is bred.
The main indexes of the selected new strain comprise: white feather, fast feather and yellow feet, about 120 eggs are laid in 300 days, and 300 days old hens weigh 3.0 jin.
Step 2: cultivation of slow yellow feather line
(1) Babucock B380 hen selection
Firstly, selecting slow-feather black-tail Buckock B380, then removing heterozygote individuals carrying recessive white by a molecular detection method, and selecting and reserving recessive white loci (C) as wild homozygote (CC) individuals as breeding materials. The specific molecular detection method is the same as the molecular detection method in the step 1.
(2) Selection of yellow feather, white ear and yellow chicken
Selecting yellow-feather slow-feather white-ear yellow chickens, carrying out recessive white locus molecular detection, removing heterozygote individuals carrying recessive white, and selecting and reserving recessive white loci (C) as wild homozygote individuals (CC). The specific molecular detection method is the same as that in step 1.
(3) Hybridization of
The selected cock with yellow feather, slow feather, white ear and yellow chicken is hybridized with the selected slow feather black tail Buckick B380, and individuals with slow feather, yellow beak and yellow foot are selected as a breeding basic group F0 generation.
(4) F0 generation cock slow feather character molecular marker assisted selection. And (3) carrying out molecular marker-assisted selection on the slow feather character of the F0 cock, and eliminating heterozygote individuals.
The molecular marking method refers to the patent "a method for detecting slow-feather mutation genotype of cock", application number: 2016105787633.
(5) transverse crossing propagation
The F0 generation was cross-bred, and individuals with slow feather, yellow feet and yellow skin were selected as the F1 generation.
(6) Continuous breeding
Through continuous breeding of 3 or more generations (egg laying character selection according to family selection method, family selection and independent elimination selection method purification and fixed appearance character), the yellow-feather slow-feather strain with stable performance is bred.
The main indexes of the selected new strain comprise: yellow feather, slow feather and yellow feet, 110 eggs are laid in 300 days, and 300-day-old hens weigh 3.4 jin.
Step 3, hybridization matching (white feather fast feather line male parent × yellow feather slow feather line female parent)
And (3) producing high-quality meat and egg dual-purpose chickens by using the white feather fast feather line obtained by selection in the step (1) as a male parent and the yellow feather slow feather line obtained by selection in the step (2) as a female parent, wherein commercial seedlings can identify male and female parents according to feather speed, female seedlings are fast feathers, and male seedlings are slow feathers.
The main indexes of the meat and egg dual-purpose high-quality chicken bred by the embodiment comprise: the eggs laid by the chickens are about 115 eggs in 300 days, the average weight of the eggs in 300 days is about 50g, the weight of the eggs in 300 days is eliminated by 3.2 jin, yellow feather, yellow feet and yellow skin are generated, and the chickens can self identify male and female according to the feather speed.
Example 2
The method for cultivating the high-quality chicken with both colored feather and eggs by using the babcock B380 (specifically, cultivating the high-quality chicken with both jute feather and eggs by using Hainan Wenchang chicken and the babcock B380) comprises the following steps:
step 1: cultivation of fast white feather line
(1) Selection of babcock B380 hens
Firstly, fast-feathering black tail Buckock B380 is selected, and then recessive white spots are selected and reserved as heterozygotes through a molecular detection method to serve as breeding materials.
The selection method was the same as in example 1.
(2) Wenchang chicken selection
Selecting a fast-feather cock of recessive white-feather Wenchang chicken.
And detecting the E allele, and rejecting individuals carrying the E allele. The specific detection method refers to a detection method in the reference (identification and frequency distribution of appearance character related mutation of Xuefeng silky fowl, Gao Xinfeng, etc., China poultry, 2016, volume 2), and is different in that a template is processed in the embodiment, and the embodiment adopts direct PCR of simply processed blood, so that a step of extracting DNA is omitted, the detection period is shortened, and the detection cost is reduced.
The sequences and reference primers were as follows:
E/E genotype molecular detection: PCR amplification is carried out in a laboratory, the PCR product is sent to Shanghai Czert Biotechnology limited company for sequencing, and individuals of which the positions of the SNP sites 668bp, 730bp, 854bp, 883bp, 1093bp and 1100bp are CC, AA, TT and AA simultaneously in the PCR product (the sequence is shown as SEQ ID NO: 1) are eliminated according to the sequencing result.
Wherein, the PCR primers are as follows:
EF：5′-ATCCCAAGGTACACAGTGAC-3′；
ER：5′-GGGCACCCAGGGGACACC-3′。
PCR product (SEQ ID NO: 1, "[ ]" is the SNP site at the above-mentioned 6)
atcccaaggtacacagtgacccgctgtgcacggtgccccagcatggctcagcccccagctaccggggcacaggctgtcatgtgcgtgcccacccttctcaggaggaggagccgagggagccagctttaaatcaggacagagaaagggccctttcttccccatcaccgccgctgagccctctctgagctccggatacgccgggcagtgccggtggggagggcggccgagacagcggagtccccgcgctgctgcccagagggctcccgggtgggggaccgcttccccatccttgtgcctggggtgcagaggtgcccacatcccctctgcctcgtgaccgcgtgctgcgggagcactggtggggctggttgggcgcacgggggctttgtaggtgctgcagttgtgcctcggggccacggcctccagccagggcggtccctgggggctgaggccggggccatgtcgatgctggcccccctgcgcctcgtgcgcgagccctggaacgccagtgagggcaaccagagcaatgccacggccggggccggaggtgcctggtgccaggggctggacatccccaatgagctcttcctgacgctggggctggtgagcctggtggagaacctgctggtggtggccgccatcctcaagaacaggaatctgcactcgccca[c/t]gtactacttcatctgctgcctggccgtctccgacatgctggtgagcgtcagcaacctggcc[a/g]agacgctcttcatgctgctgatggagcacggcgtgctggtgatccgcgccagcatcgtccgccacatggacaatgtcatcgacatgctcatctgcagctccgtcgtgtcctccctctccttcc[t/c]gggggtcatcgccgtggaccgctacatc[a/g]ccatcttctatgcgctgcgctaccacagcatcatgacgctgcagcgcgccgtggtcaccatggccagcgtctggctggccagcaccgtctccagcaccgtcttaatcacctactaccgcaacaacgccatcctgctctgcctcattggcttcttcctcttcatgctggtcctcatgctggtgctctacattcacatgttcgcgctggcg[t/c]gccacc[a/c]cgtgcgcagcatctccagccagcagaagcagcccaccatctaccgcaccagcagcctgaagggagccgtcacgctcaccatcctgctgggagtcttcttcatctgctgggggcccttcttcttccacctcatcctcatcgtcacctgccccaccaaccccttctgcacctgcttcttcagctatttcaacctcttcctcatcctcatcatctgcaattcagtggtcgatcccctgatctatgccttccggagccaggagctccggcggacgctgcgggaggtggtgctgtgctcctggtaggaggcggcacagacaggaggatggatggatggatggatggacggatggacggatggatggatggacaaacagatgggtggatggacagatgggtggatggacaaacagacgcaccgcggggtgtcccctgggtgccc
(3) Hybridization of
And (3) hybridizing the fast-feather white-feather Wenchang cock in the step (2) with the babucock B380 hen selected and remained in the step (1), and selecting and remaining a white-feather individual as a breeding basic group F0 generation.
(4) Transverse crossing propagation
The F0 generation was cross-bred, and individuals with white feather, yellow feet and yellow skin were selected as the F1 generation.
(5) Continuous breeding
Through continuous breeding of 3 or more generations (egg production character selection according to family selection method, family selection and independent elimination selection method purification and fixed appearance character), the white-feather fast-feathering strain with stable performance is bred.
The main indexes of the selected new strain comprise: white feather, fast feather and yellow feet, about 120 eggs are laid in 300 days of age, and 300 days of age of hens weigh 3.0 kg.
Step 2: cultivation of slow-feather strain of jute feather
(1) Babucock B380 hen selection
Firstly, selecting slow-feather black-tail Buckock B380, then removing heterozygote individuals carrying recessive white by a molecular detection method, and selecting and reserving recessive white loci (C) as wild homozygote (CC) individuals as breeding materials. The specific detection method was the same as the molecular detection method of example 1.
(2) Selection of Jute feather Wenchang chickens
Selecting slow-feather and jute-feather Wenchang chickens, carrying out recessive white locus molecule detection, eliminating heterozygote individuals carrying recessive white, and selecting and reserving recessive white loci (C) as wild homozygote individuals (CC). The specific detection method was the same as the molecular detection method in example 1.
(3) Hybridization of
Selected cock of Wenchang chicken with slow feather is hybridized with selected cock B380 with slow feather and black tail, and individuals conforming to the feather, yellow beak and yellow foot of jute are selected and kept as breeding basic group F0.
(4) Molecular marker-assisted selection of slow-feather character of F0-generation cock
And (3) carrying out molecular marker-assisted selection on the slow feather character of the F0 cock, and eliminating heterozygote individuals.
Molecular marker method refer to the patent- "a method for detecting slow-feather mutation genotype of cock", application number: 2016105787633.
(5) transverse crossing propagation
F0 generation cross breeding, selecting jute feather, yellow foot and yellow skin as F1 generation.
(6) Continuous breeding
Through continuous breeding of 3 or more generations (egg laying character selection according to a family selection method, family selection and independent elimination selection method purification and appearance character fixation), the jute feather slow-feather line with stable performance is bred.
The main indexes of the selected new strain comprise: jute feather, slow feather and yellow foot, wherein 110 eggs are laid at 300 days of age, and 300-day-old hens weigh 3.4 jin.
Step 3, crossbreeding (white feather fast feather line, male feather, × jute feather slow feather line, female feather)
And (3) producing high-quality chickens with meat and eggs by using the white feather fast-feather line obtained by selection in the step (1) as a male parent and the jute feather slow-feather line obtained by selection in the step (2) as a female parent, wherein commercial seedlings can identify male and female parents according to feather speed, female seedlings are fast feathers, and male seedlings are slow feathers.
The main indexes of the meat and egg dual-purpose high-quality chicken bred by the embodiment comprise: the eggs laid by the chickens are 115 eggs at 300 days old, the average weight of the eggs at 300 days old is about 50g, the eliminated weight at 300 days old is about 3.2kg, the jute feather, the yellow feet and the yellow skin are adopted, and the chickens can self-identify sexes according to the feather speed.
Example 3
The method for cultivating the high-quality chicken with both colored feather and eggs by using the babcock B380 (specifically, the high-quality chicken with both black feather and eggs by using the Xinjiang Hotan black chicken and the babcock B380) comprises the following steps:
step 1: cultivation of fast white feather line
(1) Selection of babcock B380 hens. Firstly, fast-feather black-tail Buckock B380 is selected, and then individuals with recessive white spots as heterozygotes (Cc) are selected as breeding materials by a molecular detection method. The molecular detection method was the same as that of example 1.
(2) Hetian black chicken selection
Molecular detection selects recessive white feather line and fast-feather cocks of Tianhuang chicken. The molecular detection method was the same as that of example 1.
(3) Hybridization of
And (3) hybridizing the fast-feather and white-feather cocks and the black-field cocks in the step (2) with the babcock B380 selected and reserved in the step (1), and selecting and reserving white-feather individuals as a breeding basic group F0 generation.
(4) Transverse crossing propagation
The F0 generation was cross-bred, and individuals with white feather, yellow feet and yellow skin were selected as the F1 generation.
(5) Continuous breeding
Through continuous breeding of 3 or more generations (egg production character selection according to family selection method, family selection and independent elimination selection method purification and fixed appearance character), the white-feather fast-feathering strain with stable performance is bred.
The main indexes of the selected new strain comprise: white feather, fast feather and yellow feet, about 120 eggs are laid in 300 days, and 300-day-old hens weigh 3.8 jin.
Step 2: cultivation of black feather and slow feather line
(1) Babucock B380 hen selection
Firstly, selecting slow-feather black-tail Buckock B380, then removing heterozygote individuals carrying recessive white by a molecular detection method, and selecting and reserving recessive white loci (C) as wild homozygote (CC) individuals as breeding materials. The molecular detection method was the same as that of example 1.
(2) Selection of Hetian black chicken
Selecting black feather and black chicken, carrying out molecular detection on recessive white spots, eliminating heterozygote individuals carrying recessive white, and selecting and reserving the recessive white spots (C) as wild homozygote individuals (CC). The molecular detection method was the same as that of example 1.
(3) Hybridization of
The selected black feather and black chicken cock are hybridized with the selected slow feather and black tail Buckick B380, and individuals with black feather, green yellow feet and yellow skin color are selected and kept as a breeding basic group F0 generation.
(4) Molecular marker-assisted selection of slow-feather character of F0-generation cock
And (3) carrying out molecular marker-assisted selection on the slow feather character of the F0 cock, and eliminating heterozygote individuals.
Method reference patent- "a method for detecting slow-feather mutant genotype of cock", application No.: 2016105787633.
(5) transverse crossing propagation
The F0 generation was cross-bred, and individuals with black feather, green-yellow feet and yellow skin were selected as the F1 generation.
(6) Molecular marker assisted selection generation F1
Individuals with homozygous (E/E) E allele were selected. Molecular detection method the molecular detection method in example 2 was referred to.
(7) Continuous breeding
Through continuous breeding of 3 or more generations (egg laying character selection according to family selection method, family selection and independent elimination selection method purification and fixed appearance character), the black feather slow-feather line with stable performance is bred.
The main indexes of the selected new strain comprise: black feather, slow feather, green and yellow feet, laying 110 eggs at 300 days of age, and the 300-day-old hens weigh 4.2 jin.
Step 3, crossbreeding (white feather fast feather line, male feather, × black feather and female feather lines)
And (3) producing the meat and egg dual-purpose high-quality chicken by using the white feather fast feather line obtained by the selection in the step (1) as a male parent and the black feather slow feather line obtained by the selection in the step (2) as a female parent. The commercial seedlings can identify the male and female seedlings according to the feather speed, the female seedlings are fast feathers, and the male seedlings are slow feathers.
The main indexes of the meat and egg dual-purpose high-quality chicken bred by the embodiment comprise: the eggs laid by the chickens are 115 eggs in 300 days, the average weight of the eggs in 300 days is about 50g, the weight of the eggs in 300 days is eliminated by 4.0 jin, the eggs are black, yellow and green, and yellow skin, and the chickens can self identify sexes according to the feather speed.
The results of comparing the high-quality chicken line bred by the method for breeding both the colored feather and the egg by using the babcock B380 disclosed by the invention in the above examples 1-3 with the commercial generation multiple performances of the corresponding local variety are shown in the following table 1.
TABLE 1 improvement of the commercial product performance in each example
As can be seen from table 1, when babcock B380 is used to breed high-quality chickens with both colored feather and eggs, compared with local breeds, the commercial generation has obvious improvement in meat quality and egg production, the germplasm characteristics of babcock B380 are fully exerted, the defect of meat quality reduction caused by hybridization with local breeds of laying hens is avoided, the requirements of the market on chickens with both meat and eggs can be met, and the uncertainty/periodic risk of markets of specialized laying hens (such as high-yield laying hens such as helan brown, beige, haian ash, and white laihang) and broilers (mainly fast large white feather and the mainstream colored feather in the market) is avoided.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> south Chang college of teachers and colleges
<120> method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1544
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atcccaaggt acacagtgac ccgctgtgca cggtgcccca gcatggctca gcccccagct 60
accggggcac aggctgtcat gtgcgtgccc acccttctca ggaggaggag ccgagggagc 120
cagctttaaa tcaggacaga gaaagggccc tttcttcccc atcaccgccg ctgagccctc 180
tctgagctcc ggatacgccg ggcagtgccg gtggggaggg cggccgagac agcggagtcc 240
ccgcgctgct gcccagaggg ctcccgggtg ggggaccgct tccccatcct tgtgcctggg 300
gtgcagaggt gcccacatcc cctctgcctc gtgaccgcgt gctgcgggag cactggtggg 360
gctggttggg cgcacggggg ctttgtaggt gctgcagttg tgcctcgggg ccacggcctc 420
cagccagggc ggtccctggg ggctgaggcc ggggccatgt cgatgctggc ccccctgcgc 480
ctcgtgcgcg agccctggaa cgccagtgag ggcaaccaga gcaatgccac ggccggggcc 540
ggaggtgcct ggtgccaggg gctggacatc cccaatgagc tcttcctgac gctggggctg 600
gtgagcctgg tggagaacct gctggtggtg gccgccatcc tcaagaacag gaatctgcac 660
tcgcccactg tactacttca tctgctgcct ggccgtctcc gacatgctgg tgagcgtcag 720
caacctggcc agagacgctc ttcatgctgc tgatggagca cggcgtgctg gtgatccgcg 780
ccagcatcgt ccgccacatg gacaatgtca tcgacatgct catctgcagc tccgtcgtgt 840
cctccctctc cttcctcggg ggtcatcgcc gtggaccgct acatcagcca tcttctatgc 900
gctgcgctac cacagcatca tgacgctgca gcgcgccgtg gtcaccatgg ccagcgtctg 960
gctggccagc accgtctcca gcaccgtctt aatcacctac taccgcaaca acgccatcct 1020
gctctgcctc attggcttct tcctcttcat gctggtcctc atgctggtgc tctacattca 1080
catgttcgcg ctggcgtcgc caccaccgtg cgcagcatct ccagccagca gaagcagccc 1140
accatctacc gcaccagcag cctgaaggga gccgtcacgc tcaccatcct gctgggagtc 1200
ttcttcatct gctgggggcc cttcttcttc cacctcatcc tcatcgtcac ctgccccacc 1260
aaccccttct gcacctgctt cttcagctat ttcaacctct tcctcatcct catcatctgc 1320
aattcagtgg tcgatcccct gatctatgcc ttccggagcc aggagctccg gcggacgctg 1380
cgggaggtgg tgctgtgctc ctggtaggag gcggcacaga caggaggatg gatggatgga 1440
tggatggacg gatggacgga tggatggatg gacaaacaga tgggtggatg gacagatggg 1500
tggatggaca aacagacgca ccgcggggtg tcccctgggt gccc 1544
Claims (7)
1. A method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 is characterized by comprising the following steps:
step 1, selecting a white feather fast feather system: carrying out hybridization by taking a black-tail fast-feather babcock B380 individual taking a recessive white locus as a heterozygote as a female parent and a colored-feather local variety fast-feather individual taking a recessive white feather as a male parent to generate an F0 generation, carrying out cross-breeding on the F0 generation, selecting and reserving white-feather, yellow-foot and yellow-skin individuals as an F1 generation, and carrying out continuous breeding to obtain a white-feather fast-feather line;
step 2, selecting a colored feather slow feather system: carrying out hybridization by taking a slow-feather babcock B380 individual with a recessive white locus as a wild homozygote as a female parent and taking a slow-feather colored-feather local variety with the recessive white locus as the wild homozygote as a male parent to generate an F0 generation, carrying out cross breeding on the F0 generation, selecting and reserving the individual according with the local variety characteristics as an F1 generation, and breeding continuously to obtain a colored-feather slow-feather line;
step 3, hybridization matching: and (3) selecting the white feather fast feather line bred in the step (1) as a male parent and the colored feather slow feather line bred in the step (2) as a female parent, and hybridizing to produce the high-quality commercial chicken fry with colored feather and meat and eggs.
2. The method for breeding both colored feather meat and eggs and high-quality chickens by using babcock B380 as claimed in claim 1, wherein F0 remained in step 1 is white feather individual.
3. The method for cultivating both colored feather chickens and eggs and high-quality chickens by using babcock B380 as claimed in claim 1, wherein F0 generation selected in step 2 is in accordance with local breed characteristics, and slow-feather cocks are selected by molecular marker assistance, and heterozygote individuals are eliminated.
4. The method for breeding both colored feather broiler and egg quality chicken using babcock B380 as claimed in claim 1, wherein said local variety is a variety with recessive white feather separation in local variety.
5. The method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 as claimed in claim 1, wherein the egg-laying traits are selected in step 1 and step 2 according to a family selection method, the family selection and independent elimination selection method are used for purification and fixing appearance traits, and continuous breeding is performed for 3 or more than 3 generations.
6. The method for cultivating both colored feather broiler and laying high-quality chickens with babcock B380 as claimed in claim 1, wherein in step 3, said commercial seedlings are identified as male and female according to feather speed, female seedlings are fast feather, male seedlings are slow feather.
7. The method for cultivating colored feather meat and egg dual-purpose high-quality chickens by using babcock B380 as claimed in claim 6, wherein the female seedlings of the commercial seedlings lay 115 eggs at 300 days of age, the average egg weight is 50g, and the body weight is 1.6-2.0kg at 300 days of age.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010441774.3A CN111406712B (en) | 2020-05-22 | 2020-05-22 | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010441774.3A CN111406712B (en) | 2020-05-22 | 2020-05-22 | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111406712A true CN111406712A (en) | 2020-07-14 |
| CN111406712B CN111406712B (en) | 2021-08-27 |
Family
ID=71486137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010441774.3A Active CN111406712B (en) | 2020-05-22 | 2020-05-22 | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111406712B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114667965A (en) * | 2022-02-17 | 2022-06-28 | 江苏省家禽科学研究所科技创新有限公司 | Method for breeding high-reproduction, high-efficiency and high-quality dual-purpose black-feather chickens |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104604794A (en) * | 2015-01-08 | 2015-05-13 | 北京市农林科学院 | Recessive white feather Beijing fatty chicken breeding method |
| CN110129453A (en) * | 2019-05-07 | 2019-08-16 | 中国农业大学 | Identify the method for chicken Feathering type genotype |
| CN110419506A (en) * | 2019-07-31 | 2019-11-08 | 北京市华都峪口禽业有限责任公司 | Red plumage chicken produces the corss combination method of rouge and powder shell egg |
| CN111134082A (en) * | 2019-12-30 | 2020-05-12 | 南昌师范学院 | Method for breeding white feather high-quality broiler chicken by utilizing Wuhua Sanhuang chicken |
-
2020
- 2020-05-22 CN CN202010441774.3A patent/CN111406712B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104604794A (en) * | 2015-01-08 | 2015-05-13 | 北京市农林科学院 | Recessive white feather Beijing fatty chicken breeding method |
| CN110129453A (en) * | 2019-05-07 | 2019-08-16 | 中国农业大学 | Identify the method for chicken Feathering type genotype |
| CN110419506A (en) * | 2019-07-31 | 2019-11-08 | 北京市华都峪口禽业有限责任公司 | Red plumage chicken produces the corss combination method of rouge and powder shell egg |
| CN111134082A (en) * | 2019-12-30 | 2020-05-12 | 南昌师范学院 | Method for breeding white feather high-quality broiler chicken by utilizing Wuhua Sanhuang chicken |
Non-Patent Citations (1)
| Title |
|---|
| 蔡超等: "隐性白羽鸡的利用与研究进展", 《广东畜牧兽医科技》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114667965A (en) * | 2022-02-17 | 2022-06-28 | 江苏省家禽科学研究所科技创新有限公司 | Method for breeding high-reproduction, high-efficiency and high-quality dual-purpose black-feather chickens |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111406712B (en) | 2021-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019128350A1 (en) | Identification of white leghorns red plumage mutagenic mutant genotype and cultivation method for supporting system of red plumage pink shell layer chickens | |
| CN111226869B (en) | Breeding method of slaughter type high-quality spotted-brown chickens with high uniformity | |
| CN111910008B (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN110129455B (en) | Application of growth-related molecular marker in genetic breeding of litopenaeus vannamei | |
| CN104962634B (en) | For detecting the kit of chicken body measurement trait and the molecular breeding method of chicken | |
| CN104823919B (en) | The breeding method of southeast of Guizhou Province Fructus Foeniculi chicken recessive white feather new lines and application | |
| CN114941033A (en) | Method for breeding local high-quality white-feather chicken high-egg-yield strain based on SNP locus assistance | |
| CN109554486A (en) | SNP marker relevant to grass carp character and its application | |
| CN107779516A (en) | A kind of SNP marker for influenceing pig birth weight character and its application | |
| CN111213614A (en) | Method for molecular marker-assisted cultivation of fishy smell-free green-leg pockmarked-feather green-shell laying hens | |
| CN114214432A (en) | Molecular marker for identifying melanin diffusion gene locus of chicken and application of molecular marker in assisted breeding | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN111406712B (en) | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 | |
| JP2019041695A (en) | Quantitative trait loci involved in shearing force value of chicken breast meat and methods of use thereof | |
| CN108251418B (en) | SNP molecular marker related to growth speed of broiler chicken and application thereof | |
| KR101757619B1 (en) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same | |
| CN107858440A (en) | A kind of SNP marker related to pig birth weight character and application thereof | |
| CN115251004B (en) | Cultivation method of green-shank yellow-feather high-quality broilers | |
| CN109439763B (en) | Molecular marker for identifying 817 broiler chickens and yellow-leg free-range chickens and application | |
| CN113249442B (en) | Method for screening oyster unsaturated fatty acid content-related methylation modifying gene | |
| CN109439771A (en) | A method of hybridization porgy family is identified using microsatellite marker | |
| CN115851987A (en) | SNP molecular marker of chicken NCAPG gene, detection primer, kit, breeding method and application | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| CN112322756B (en) | SNP locus linked with growth trait of fugu rubripes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |