CN111286534B

CN111286534B - CORIN gene DNA methylation marker and application thereof

Info

Publication number: CN111286534B
Application number: CN201910722403.XA
Authority: CN
Inventors: 彭浩
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2019-08-06
Filing date: 2019-08-06
Publication date: 2023-05-16
Anticipated expiration: 2039-08-06
Also published as: CN111286534A

Abstract

The invention discloses a group of CORIN gene DNA methylation markers and application thereof in preparation of a kit for predicting cerebral apoplexy incidence risk. The cornin gene DNA methylation marker comprises 2 DNA methylation sites with the cornin gene promoter region: chr4:47841408 and Chr4:47841314. The kit comprises an upstream primer and a downstream primer for amplifying 2 DNA methylation sites simultaneously. The CORIN gene DNA methylation marker can provide important epidemiological evidence for drug targets for preventing and controlling cerebral apoplexy.

Description

CORIN gene DNA methylation marker and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a group of CORIN gene DNA methylation markers and application thereof in preparation of a kit for predicting cerebral apoplexy incidence risk.

Background

The world health organization of 1984-2003 investigated the prevalence of cardiovascular and cerebrovascular diseases such as cerebral apoplexy and coronary heart disease in 40 research centers in 28 countries worldwide according to the national cardiovascular disease trend and determinant monitoring scheme (WHO monitor scheme for short). The WHO monitor protocol defines stroke as: the rapidly developed focal or global brain dysfunction lasts for more than 24 hours, including subarachnoid hemorrhage, cerebral thrombosis and cerebral embolism, excluding transient cerebral ischemia, cerebral apoplexy onset is calculated as onset event, 1 or more times within 28 days, 1 new onset event is calculated after 28 days.

Cerebral apoplexy is a global health problem, is a primary disease threatening the life and health of residents in China, and brings great disease burden and economic loss to the residents in China every year. The result of the Chinese stroke report issued by the Chinese stroke Association for the first time in 2015 shows that about 270 ten thousand new patients with cerebrovascular diseases in China die from the cerebrovascular diseases every year, about 130 ten thousand patients with cerebrovascular diseases every year, one person can generate stroke every 12 seconds, and one person dies from the stroke every 21 seconds. Therefore, how to effectively prevent and control cerebral apoplexy is a great public health challenge facing China at present, and searching and finding more potential risk factors and intervention targets of cerebral apoplexy is urgent.

The natriuretic peptide axis is an important cardiac endocrine regulating system of the body for coping with external environmental stimulus, and plays an important role in maintaining the water-sodium balance, the blood pressure stability and the energy metabolism balance of the body. The natriuretic peptide axis is mainly composed of atrial natriuretic peptide (atrial natriureticpeptide, ANP), brain natriuretic peptide (brain natriuretic peptide, BNP), C-type natriuretic peptide (C-typenatriuretic peptide, CNP) and their receptors. When blood volume increases, cardiomyocytes secrete and release a large amount of non-bioactive atrial natriuretic peptide precursor (pro-atrial natriuretic peptide, pro-ANP), which further activates active ANP and binds to its receptor activating the natriuretic peptide axis, thereby promoting sodium metabolism, reducing blood volume, dilating blood vessels, promoting energy metabolism, and thus maintaining cardiovascular homeostasis. There is a great deal of epidemiological evidence that the natriuretic peptide axes, in particular ANP and BNP, play an important role in the development of stroke and its risk factors (obesity, hyperglycemia, hypertension, atherosclerosis, thrombosis, etc.).

Proteases which convert inactive pro-ANP and pro-BNP into active ANP and BNP are critical for regulating the function of the natriuretic peptide axis. Over several decades of effort scientists have eventually found the invertase pro-ANP, corin, in 1999. Up to now, several studies have reported the effect of corin on cardiovascular metabolism. Both basic and crowd studies suggest that corin may be a potential intervention target for the prevention and control of stroke. As a medium for connecting genes and environments, DNA methylation regulates the expression and the function of the genes, and can be used as a potential and intervened drug target, and a great deal of evidence exists for indicating that the DNA methylation of a promoter region of the genes can influence the transcription of the genes and inhibit the expression of the genes. Thus, DNA methylation of the promoter region of the CORIN gene, which is a gene encoding CORIN, may inhibit CORIN expression, and cause CORIN deficiency, thereby participating in the stroke pathogenesis.

Disclosure of Invention

The invention aims to provide a group of CORIN gene DNA methylation markers for predicting cerebral apoplexy incidence risk and application thereof in predicting cerebral apoplexy incidence risk.

In order to achieve the above object, the present invention adopts the following technical scheme:

application of a group of CORIN gene DNA methylation markers in preparation of a kit for predicting cerebral apoplexy incidence risk, wherein the CORIN gene DNA methylation markers comprise 2 DNA methylation sites corresponding to a CORIN gene promoter region: chr4:47841408 and Chr4:47841314.

Further, the kit includes an upstream primer and a downstream primer that amplify 2 DNA methylation sites simultaneously.

Further, the sequence of the upstream primer is shown as SEQ ID No. 1.

Further, the sequence of the downstream primer is shown as SEQ ID No. 2.

Further, the methylation level of the 2 DNA methylation sites is increased by more than 80% in cerebral apoplexy cases.

The beneficial effects are that: the CORIN gene DNA methylation marker provided by the invention can be used for predicting the risk of cerebral apoplexy, provides a basis for further deep examination by a clinician, and achieves the effect of rapidly and accurately grasping the disease state and the disease severity of a patient. Meanwhile, support is provided for the next step of timely taking more personalized control schemes, and disease progression is delayed and prevented. The invention is not only helpful for explaining the molecular mechanism of CORIN deficiency acting on cerebral apoplexy, but also provides important epidemiological evidence for the methylation of the CORIN gene as a drug target for preventing and controlling cerebral apoplexy.

Drawings

FIG. 1 is a schematic representation of methylation of two CpG sites in the promoter region of the CORIN gene of example 1.

Detailed Description

The technical scheme of the invention is further described below.

Example 1

According to one previous case control study (597 cases of stroke and 2498 community health controls), it was found that the serum levels of corin protein in stroke patients were significantly lower than the health control (stoke.2015; 46:1758-1763), with a 2-5 fold increase in risk of stroke in the lowest quartile level group compared to the highest quartile level group. The research result suggests that the corin protein deficiency may be the cause of cerebral apoplexy, however, the molecular mechanism associated with cerebral apoplexy is not clear, but the research on the molecular mechanism of the corin participating in the cerebral apoplexy pathogenesis is helpful to discover the medicine target aiming at the corin deficiency, thereby promoting the prevention and control of cerebral apoplexy. As a medium for connecting genes and environment, DNA methylation regulates the expression and the function of the genes, and can be used as a potential and intervened drug target. Therefore, the invention further researches the effect of the DNA methylation of the CORIN gene in the stroke pathogenesis.

Using frequency matching, selecting 853 cerebral apoplexy patients and 918 healthy controls as study objects, extracting whole blood DNA samples of each study object, detecting methylation level of each CpG site of a CORIN gene promoter region by using a target region sequencing technology, namely, inquiring a promoter region of a human CORIN gene (gene number: ENSG 00000145244) by using an ENSEMBL database, wherein the region is a nucleic acid sequence of the region, which is Chr4:47838400-47841966 (GRCh 37/hg19, distance from TSS-2000 to +1566 bp), intercepting the NCBI, introducing the nucleic acid sequence into EMBOSS Cpgplot software to predict CpG islands, and then using an epidemic signer program to design primers for the CpG islands and CpG dense region sequences, and selecting proper primers for DNA methylation detection. Through selection, the methylation detection is carried out on 2 fragments of the promoter region of the CORIN gene, and the methylation level of 11 CpG sites is obtained.

The fragment to be detected and the primer sequences are listed in Table 1:

TABLE 1 DNA methylation detection fragment of promoter region of CORIN gene

The specific detection method comprises the following steps:

first, DNA samples were subjected to bisulfite treatment using EZ-96DNA methylation kit (Zymo Research, orange, calif.) to convert all of the cytosine C in the sample DNA that was not methylation-modified to thymine U. And then performing multiplex PCR amplification by using the designed primer and the sample genome treated by the bisulfite as a template. Specific tag sequences compatible with the illuminea platform were then introduced into the library ends by PCR amplification using primers with Index sequences. Finally, all sample Index PCR amplification products were mixed in equal amounts, and high throughput sequencing was performed in a double-ended sequencing mode of 2X 150 bp/2X 250bp on an Illumina Hiseq/Miseq platform to obtain FastQ data. The methylation level of each CpG site is quantified as the number of reads methylated at that site (i.e., the number of reads for which base C is detected)/the total number of reads at that site. Times.100%.

The results of the study are as follows:

1. clinical characteristics of study subjects

As shown in table 2, stroke patients are older and have more traditional risk factors for stroke, such as hypertension, diabetes, obesity, and hyperlipidemia, than healthy controls.

Table 2 subject clinical characteristics

2. Methylation site with strongest relation to cerebral apoplexy

The methylation level of 11 CpG sites is detected in total, and after traditional risk factors of cerebral apoplexy such as age, sex, educational degree, smoking, drinking, obesity, blood pressure, blood sugar and blood fat are adjusted, 2 CpG sites are still obviously related to cerebral apoplexy and are all located in the promoter region of the CORIN gene. As shown in table 3, the risk of developing stroke increases by 12% and 24% for each 5% increase in methylation level at these two sites. Higher methylation levels mean lower corin expression, i.e. lower serum corin protein levels, and it can be seen that the results of this study are consistent with the results previously found that lack of serum corin levels is associated with increased risk of stroke. Accordingly, these two methylation sites can be used to predict the risk of developing stroke.

TABLE 3 methylation sites strongly associated with cerebral stroke

^* Every 5% increase in methylation levels, the risk of stroke increases by a factor of more.

3. Construction of methylation detection kit

Based on the above study, it can be known that: as shown in figure 1, after methylation of the continuous CpG sites in the promoter region, the CORIN gene expression and the CORIN protein secretion can be inhibited, so that the marker is involved in the onset of cerebral apoplexy, and can be used as a predictive marker and a potential drug target of the onset risk of cerebral apoplexy. Therefore, the methylation detection kit based on the two CpG sites is constructed.

The specific detection method comprises the following steps:

(1) whole blood DNA extraction and quality control

a. Agarose gel electrophoresis to detect genomic DNA integrity: the electrophoresis band is clear and visible, no obvious degradation and no RNA pollution.

Nanodrop 2000 detection of genomic DNA quality: the concentration is more than or equal to 20 ng/. Mu.L, the total amount is more than or equal to 1. Mu.g, OD 260/280=1.7-2.0, and OD260/230 is more than or equal to 1.8.

(2) Sulfite treatment

The DNA sample that was qualified for quality control was sulfite-treated with EZ-96DNA methylation kit (Zymo Research, orange, calif.) to convert all unmethylated cytosine C in the sample DNA to uracil U.

(3) Multiplex PCR amplification

Then, the sulfite-treated specimen was subjected to DNA amplification using a designed primer (F: GTAGATTTAGGGAGTTGAAGTGAAGTAA, SEQ ID No.1; R: ACCTTAACAATTAAATCCAACCCTTAT, SEQ ID No. 2) to obtain an amplified product having a T7 RNA polymerase promoter sequence.

(4) CpG fragment cleavage

The amplified DNA product was then transcribed into RNA fragments using T7 RNA polymerase and the resulting RNA fragments were cleaved with RNase A into small fragments with CpG.

(5) Flight mass spectrometry

Finally, within each small RNA fragment, the unmethylated CpG end-product was CpA and the methylated CpG end-product was CpG, and the molecular weights of both end-products were detected using an Agena MassArray mass spectrometry system.

(6) Methylation level calculation and stroke risk prediction

Methylation levels at each CpG site were quantified as product mass CpG/(CpG+CpA). Times.100%. Methylation level of any CpG site >80% suggests that the risk of cerebral apoplexy is high, and close attention should be paid and preventive treatment measures should be taken.

Sequence listing

<120> a group of CORIN gene DNA methylation markers and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gtagatttag ggagttgaag tgaagtaa 28

<210> 2

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

accttaacaa ttaaatccaa cccttat 27

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gtagatttag ggagttgaag tgaagtaa 28

<210> 4

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

accttaacaa ttaaatccaa cccttat 27

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gggtgggatt tgtagagtag ataa 24

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

actttaaaaa cccractcta cracaa 26

Claims

1. The application of a group of detection primers of a CORIN gene DNA methylation marker in preparing a kit for predicting the risk of cerebral apoplexy is characterized in that: the DNA methylation marker of the CORIN gene is 2 DNA methylation sites of a promoter region of the CORIN gene: chr4:47841408 and Chr4:47841314.

2. The use according to claim 1, characterized in that: the detection primer includes an upstream primer and a downstream primer that amplify 2 DNA methylation sites simultaneously.

3. The use according to claim 2, characterized in that: the sequence of the upstream primer is shown as SEQ ID No. 1.

4. A use according to claim 3, characterized in that: the sequence of the downstream primer is shown as SEQ ID No. 2.

5. The use according to claim 1, characterized in that: the methylation level of the 2 DNA methylation sites in cerebral apoplexy cases is obviously increased by more than 80 percent.