CN113373213B - DNA methylation marker and application thereof - Google Patents
DNA methylation marker and application thereof Download PDFInfo
- Publication number
- CN113373213B CN113373213B CN202110674405.3A CN202110674405A CN113373213B CN 113373213 B CN113373213 B CN 113373213B CN 202110674405 A CN202110674405 A CN 202110674405A CN 113373213 B CN113373213 B CN 113373213B
- Authority
- CN
- China
- Prior art keywords
- cerebral apoplexy
- methylation
- dna methylation
- risk
- hypertension
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a DNA methylation marker, which is a methylation site Chr1:11908353 of an NPPA gene promoter region, and the methylation degree of the DNA methylation marker indicates the risk of hypertension or cerebral apoplexy. The DNA methylation marker provided by the invention can be used for predicting the risk of cerebral apoplexy, provides a basis for screening high risk groups of cerebral apoplexy, and can also be used as an intervention target for preventing and controlling hypertension and cerebral apoplexy. The invention is not only helpful for explaining the molecular mechanism of the atrial natriuretic peptide acting on hypertension and cerebral apoplexy, but also provides important epidemiological evidence for NPPA gene methylation as a drug target for preventing and controlling hypertension and cerebral apoplexy.
Description
Technical Field
The invention relates to the technical field of bioengineering, in particular to a DNA methylation marker and application thereof.
Background
Hypertension is an important risk factor for not only cardiovascular disease but also various other cardiovascular and cerebrovascular diseases. There are 67% of heart diseases worldwide, 54% of strokes are caused by hypertension, and 13.5% of deaths are due to hypertension. Wherein, cerebral apoplexy is a global health problem, and is now the first disease threatening the life and health of residents in China, and huge disease burden and economic loss are brought to the residents in China every year. The result of the Chinese stroke report issued by the Chinese stroke Association for the first time in 2015 shows that about 270 ten thousand new patients with cerebrovascular diseases in China die from the cerebrovascular diseases every year, about 130 ten thousand patients with cerebrovascular diseases every year, one person can generate stroke every 12 seconds, and one person dies from the stroke every 21 seconds. Therefore, how to effectively prevent and control cerebral apoplexy is a great public health challenge facing China at present, and searching and finding more potential risk factors and intervention targets of cerebral apoplexy is urgent.
The natriuretic peptide axis is an important cardiac endocrine regulating system of the body for coping with external environmental stimulus, and plays an important role in maintaining the water-sodium balance, the blood pressure stability and the energy metabolism balance of the body. The natriuretic peptide axis is mainly composed of Atrial Natriuretic Peptide (ANP), brain Natriuretic Peptide (BNP), C-type natriuretic peptide (CNP) and their receptors. When blood volume increases, cardiomyocytes secrete and release large amounts of non-bioactive atrial natriuretic peptide precursors (pro-ANP) and brain natriuretic peptide precursors (pro-BNP), and pro-ANP and pro-NNP are further activated to active ANP and BNP and bind to their receptors to activate the natriuretic peptide axis, thereby promoting sodium metabolism, reducing blood volume, dilating blood vessels, and promoting energy metabolism, thus maintaining cardiovascular homeostasis.
At present, no research report on DNA methylation of the NPPA coding gene of ANP and hypertension and cerebral apoplexy is seen, and no proper methylation marker is reported to be used as an intervention target for preventing and controlling the hypertension and the cerebral apoplexy.
Disclosure of Invention
In order to solve the technical problems, the invention provides the DNA methylation marker related to the hypertension and the cerebral apoplexy through researching the correlation between the DNA methylation and the hypertension and the cerebral apoplexy, provides a basis for predicting the risk of cerebral apoplexy and screening the high risk group of cerebral apoplexy, and is also expected to be used as an intervention target for preventing and controlling the hypertension and the cerebral apoplexy.
The first object of the present invention is to provide a DNA methylation marker which is the methylation site Chr1:11908353 of the NPPA gene promoter region, and the methylation degree is related to the incidence risk degree of hypertension or cerebral apoplexy.
The detection method of the NPPA gene DNA methylation marker related to hypertension and cerebral apoplexy comprises the following steps:
(1) Extracting a DNA sample, and performing bisulfite treatment on the DNA sample;
(2) Amplifying the bisulfite treated sample of step (1) with a suitable primer pair to obtain an amplified product;
(3) Carrying out transcription and enzyme digestion on the amplified product in the step (2) to obtain a transcription and enzyme digestion product;
(4) Detecting the transcription and enzyme digestion products of the step (3) to obtain the methylation degree in the sample sequence.
The application of the DNA methylation marker in preparing reagents for predicting or detecting the risk of developing hypertension or cerebral apoplexy.
The DNA methylation marker is applied to preparation of a reagent for screening high risk groups of cerebral apoplexy.
The DNA methylation marker is applied to preparation of medicines for treating hypertension or cerebral apoplexy.
Furthermore, DNA methylation is repairable, and the therapeutic drug is a targeting drug designed based on the DNA methylation site of the NPPA gene or the NPPA gene, so that the expression of the NPPA gene and the secretion of ANP can be regulated and controlled, and the purposes of reducing blood pressure and treating cerebral apoplexy are achieved.
The second object of the present invention is to provide a kit for predicting risk of cerebral apoplexy, comprising a reagent for detecting the methylation degree of the DNA methylation marker.
Further, the kit comprises a primer pair for amplifying the DNA methylation site Chr1: 11908353.
Further, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2, specifically:
F：TTTTGTTTTGAGGTTAGAGGTTTGTTTA
R：AAAAATCCTTAATTATCTCACCRCC
the primer pair is applied to preparation of reagents for predicting or detecting risk of hypertension or cerebral apoplexy.
The primer pair is applied to preparation of a reagent for screening high risk groups of cerebral apoplexy.
The third object of the present invention is to provide a method for detecting risk of cerebral apoplexy, wherein the detection threshold is set according to the methylation degree of the NPPA gene DNA methylation marker, when the methylation degree of the methylation site Chr1:11908353 of the subject is higher than the detection threshold, the subject is normal, and when the methylation degree is lower than the detection threshold, the subject has risk of cerebral apoplexy.
Further, NPPA is derived from blood, and sampling is convenient.
By means of the scheme, the invention has at least the following advantages:
(1) The NPPA gene DNA methylation marker provided by the invention can be used for predicting the risk of hypertension and cerebral apoplexy, provides a basis for screening of cerebral apoplexy high risk groups, and can also be used as an intervention target for preventing and controlling hypertension and cerebral apoplexy.
(2) The invention is not only helpful for explaining the molecular mechanism of NPPA deficiency acting on hypertension and cerebral apoplexy, but also provides important epidemiological evidence for NPPA gene methylation as a drug target for preventing and controlling hypertension and cerebral apoplexy.
The foregoing description is only an overview of the present invention, and is presented in terms of preferred embodiments of the present invention and the following detailed description of the invention in conjunction with the accompanying drawings.
Drawings
In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings.
FIG. 1 is a schematic representation of a DNA methylation marker of the present invention;
FIG. 2 is a schematic diagram of 9 CpG sites in the NPPA gene promoter region in the example, wherein site 1 is the methylation marker of the present invention.
Detailed Description
The present invention will be further described with reference to the accompanying drawings and specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it.
Examples
In two independent populations, a discovery study (incorporating 2498, including 1109 hypertension and 1389 normotensive) and a validation study (incorporating 1771, including 995 hypertension and 776 normotensive) were performed separately. Extracting whole blood DNA samples of each study object, detecting the methylation level of each CpG site in the NPPA gene promoter region by using a target region sequencing technology, namely, inquiring the promoter region of the human NPPA gene (gene number: ENSG 00000175206) by using an ENSEMBL database, wherein the region is a chromoname 1:11908117-11908380 (GRCH 37.P13, distance from TSS: 540bp to 277 bp), intercepting the nucleic acid sequence of the region on NCBI, introducing the nucleic acid sequence into EMBOSS Cpgplot software to predict CpG islands, then performing primer design on the CpG islands and CpG dense region sequences by using an Epidesign program, and selecting proper primers for DNA methylation detection (the primer sequence information is shown in Table 1). The methylation level of 9 CpG sites was obtained in total, and 9 CpG sites are shown in FIG. 2.
TABLE 1 DNA methylation detection primer sequence of NPPA gene promoter region
The specific detection method of DNA methylation comprises the following steps:
first, DNA samples were subjected to bisulfite treatment using EZ-96DNA methylation kit (Zymo Research, orange, calif.) to convert all of the cytosine C in the sample DNA that was not methylation-modified to uracil U. Then, multiplex PCR amplification was performed using the primers shown in Table 1 and the sample genome treated with bisulfite as a template. To distinguish between different samples, specific tag sequences compatible with the illuminea platform were introduced into the library ends by PCR amplification using primers with Index sequences. Finally, all sample Index PCR amplification products were mixed in equal amounts, and high throughput sequencing was performed in a double-ended sequencing mode of 2X 150 bp/2X 250bp on an Illumina Hiseq/Miseq platform to obtain FastQ data. The methylation level of each CpG site is quantified as the number of reads methylated at that site (i.e., the number of reads for which base C is detected)/the total number of reads at that site. Times.100%.
The results of the study are as follows:
1. clinical characteristics of study subjects
In both populations, hypertensive patients have more traditional risk factors than normotensive ones, such as smoking, drinking, obesity, hyperglycemia, hyperlipidemia (all P < 0.05).
Table 1 clinical characteristics of subjects
2. Methylation site most strongly related to hypertension
As shown in Table 2, the DNA methylation levels of the 9 CpG sites detected were higher in patients with hypertension than in normotensive patients. After further adjustment of the traditional risk factors, only CpG1 was found to be significantly correlated with blood pressure and hypertension in the study, with P values <0.05 after multiple test correction (table 3), with 13% decrease in risk of hypertension for every 5% increase in methylation level at this site. Similarly, the same study results were found in the validation study, with only CpG1 significantly correlated with blood pressure and hypertension after correction multiplex assays (P values <0.05 after all corrections), with 18% decrease in risk of hypertension for every 5% increase in methylation level at this site (table 4).
TABLE 2 DNA methylation level of NPPA Gene
TABLE 3 discovery of the relationship of NPPA gene DNA methylation to blood pressure and hypertension disease in the study
Table 4 verifies the relationship between NPPA gene DNA methylation and blood pressure and hypertension disease in the study
3. Methylation site capable of independently predicting future cerebral apoplexy incidence risk
Further, 2498 in the above finding study was followed for 10 years to obtain a stroke event, and the relationship between the NPPA gene DNA methylation level at the baseline and the stroke event was analyzed to find methylation sites capable of independently predicting the future stroke risk. The results are shown in Table 5, only CpG1 is significantly correlated with risk of developing cerebral apoplexy after correction multiplex test (P value <0.05 after correction), and methylation level of the locus is increased by 5% and risk of developing cerebral apoplexy is reduced by 21% after adjustment of traditional risk factors.
TABLE 5 relationship of baseline NPPA Gene DNA methylation and risk of developing cerebral apoplexy
4. Construction of methylation detection kit
Based on the above study, it can be known that: as shown in FIG. 1, after methylation occurs at CpG1 sites in the promoter region, NPPA gene expression and pro-ANP protein secretion can be inhibited, and the promoter region is involved in the onset of hypertension and cerebral apoplexy, and can be used as a predictive marker and a potential drug target of the onset risk of cerebral apoplexy. Therefore, the methylation detection kit based on CpG1 sites is constructed.
The specific detection method comprises the following steps:
(1) whole blood DNA extraction and quality control
a. Agarose gel electrophoresis to detect genomic DNA integrity: the electrophoresis band is clear and visible, no obvious degradation and no RNA pollution.
Nanodrop 2000 detection of genomic DNA quality: the concentration is more than or equal to 20 ng/. Mu.L, the total amount is more than or equal to 1. Mu.g, OD 260/280=1.7-2.0, and OD260/230 is more than or equal to 1.8.
(2) Sulfite treatment
The DNA sample that was qualified for quality control was sulfite-treated with EZ-96DNA methylation kit (Zymo Research, orange, calif.) to convert all unmethylated cytosine C in the sample DNA to uracil U.
(3) Multiplex PCR amplification
The sulfite-treated samples were then subjected to DNA amplification using the designed primers (F: TTTTGTTTTGAGGTTAGAGGTTTGTTTA; R: AAAAATCCTTAATTATCTCACCRCC) to give amplified products with the T7 RNA polymerase promoter sequence.
(4) CpG fragment cleavage
The amplified DNA product was then transcribed into RNA fragments using T7 RNA polymerase and the resulting RNA fragments were cleaved with RNase A into small fragments with CpG.
(5) Flight mass spectrometry
Finally, within each small RNA fragment, the unmethylated CpG end-product was CpA and the methylated CpG end-product was CpG, and the molecular weight of this end-product was detected using the Agena MassArray mass spectrometry system.
(6) Methylation level calculation and stroke risk prediction
The methylation level of the CpG sites is quantized into the product quality CpG/(CpG+CpA) multiplied by 100 percent, and the methylation level of <50 percent indicates that the risk of cerebral apoplexy is higher, and the prevention and treatment measures are closely taken.
Based on the above study, it can be seen that: as shown in figure 1, after methylation of the Chr1:11908353CpG site in the promoter region, NPPA gene expression and pro-ANP protein secretion can be inhibited, and the gene can further participate in the onset of hypertension and cerebral apoplexy, and can be used as a prediction marker and a potential drug target of the onset risk of hypertension and cerebral apoplexy.
It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations and modifications of the present invention will be apparent to those of ordinary skill in the art in light of the foregoing description. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.
Sequence listing
<110> university of Suzhou
<120> a DNA methylation marker and use thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 28
<212> DNA
<213> (Synthesis)
<400> 1
ttttgttttg aggttagagg tttgttta 28
<210> 2
<211> 25
<212> DNA
<213> (Synthesis)
<400> 2
aaaaatcctt aattatctca ccrcc 25
Claims (4)
1. The application of a primer pair for amplifying a DNA methylation marker in preparation of a reagent for predicting the risk of cerebral apoplexy is characterized in that the DNA methylation marker is a methylation site Chr1:11908353 of an NPPA gene promoter region, and the methylation degree of the DNA methylation marker indicates the risk degree of cerebral apoplexy.
2. The application of a primer pair for amplifying a DNA methylation marker in preparation of a reagent for screening a high risk group of cerebral apoplexy is characterized in that the DNA methylation marker is a methylation site Chr1:11908353 of an NPPA gene promoter region, and the methylation degree of the DNA methylation marker indicates the incidence risk degree of cerebral apoplexy.
3. A kit for predicting risk of stroke, comprising a reagent for detecting the methylation degree of a DNA methylation marker, said kit comprising a primer pair for amplifying the methylation site chr1:11908353 of the NPPA gene promoter region.
4. A kit according to claim 3, wherein the nucleotide sequences of the primer pairs are shown in SEQ ID No.1 and SEQ ID No. 2.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110674405.3A CN113373213B (en) | 2021-06-17 | 2021-06-17 | DNA methylation marker and application thereof |
| PCT/CN2021/114684 WO2022262118A1 (en) | 2021-06-17 | 2021-08-26 | Dna methylation marker and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110674405.3A CN113373213B (en) | 2021-06-17 | 2021-06-17 | DNA methylation marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113373213A CN113373213A (en) | 2021-09-10 |
| CN113373213B true CN113373213B (en) | 2023-05-12 |
Family
ID=77577535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110674405.3A Active CN113373213B (en) | 2021-06-17 | 2021-06-17 | DNA methylation marker and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113373213B (en) |
| WO (1) | WO2022262118A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113373213B (en) * | 2021-06-17 | 2023-05-12 | 苏州大学 | DNA methylation marker and application thereof |
| CN114774536A (en) * | 2022-04-29 | 2022-07-22 | 苏州大学 | DNA (deoxyribonucleic acid) hydroxymethylation marker for predicting ischemic stroke incidence risk and kit |
| CN114807355A (en) * | 2022-05-19 | 2022-07-29 | 苏州大学 | DNA methylation marker for evaluating stroke onset risk, primer and application thereof |
| CN114807356A (en) * | 2022-05-19 | 2022-07-29 | 苏州大学 | NPPB gene DNA hydroxymethylation marker, primer and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367479B (en) * | 2016-08-25 | 2018-10-30 | 杭州百迈生物股份有限公司 | Instruct detection combination object and application, the kit and detection method of hypertension medication |
| CN111286534B (en) * | 2019-08-06 | 2023-05-16 | 苏州大学 | CORIN gene DNA methylation marker and application thereof |
| CN112322725B (en) * | 2020-11-27 | 2023-03-24 | 苏州大学 | DNA methylation marker of FURIN gene and detection kit thereof |
| CN113373213B (en) * | 2021-06-17 | 2023-05-12 | 苏州大学 | DNA methylation marker and application thereof |
-
2021
- 2021-06-17 CN CN202110674405.3A patent/CN113373213B/en active Active
- 2021-08-26 WO PCT/CN2021/114684 patent/WO2022262118A1/en active Application Filing
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022262118A1 (en) | 2022-12-22 |
| CN113373213A (en) | 2021-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113373213B (en) | DNA methylation marker and application thereof | |
| CN111286534B (en) | CORIN gene DNA methylation marker and application thereof | |
| IL272226A (en) | Diagnostic, prognostic and therapeutic uses of long noncoding rnas for heart disease and regenerative medicine | |
| US20220364183A1 (en) | Gene Panels for Molecular Subtype and Survival Risk Assessment of Lung Adenocarcinoma and Diagnostic Products and Applications Thereof | |
| CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
| CN108291261A (en) | Method for the response for predicting confrontation TNF treatments | |
| CN112048556B (en) | Molecular typing and survival risk gene group of primary hepatocellular carcinoma, diagnosis product and application | |
| CN106399553B (en) | Human mitochondrial whole genome high-throughput sequencing method based on multiple PCR | |
| KR102459214B1 (en) | Composition for prediction prognosis of cancer and kit comprising the same | |
| CN114214402B (en) | Primer group, kit and detection method for detecting blood hypercoagulability or venous thrombosis risk gene polymorphism and application | |
| CN114672556A (en) | Colorectal cancer molecular typing and survival risk gene group, diagnosis product and application | |
| KR20190059017A (en) | Method for providing information of prediction and diagnosis of hypertension using methylation level of GNAS gene and composition therefor | |
| CN115058543A (en) | Primer group and kit for identifying Delta variant strain and Omicron variant strain | |
| CN112011612B (en) | Biomarker and kit for prognosis classification of glioma patient survival prediction | |
| CN110846399A (en) | Cardiovascular disease individualized medication gene detection system kit and application thereof | |
| Chen et al. | Comprehensive analysis of lncRNA expression profiles in postmenopausal osteoporosis | |
| WO2023206854A1 (en) | Dna hydroxymethylation marker and kit for predicting attack risk of cerebral ischemic stroke | |
| CN112322725B (en) | DNA methylation marker of FURIN gene and detection kit thereof | |
| KR20220060198A (en) | Method for Predicting Survival Prognosis of Pancreatic Cancer Patients Using Gene Copy Number Variation Profile | |
| WO2023221309A1 (en) | Dna methylation marker for evaluating onset risk of cerebral stroke, primer, and use thereof | |
| JP2008531033A (en) | Method for prognosis of response to treatment | |
| CN103374759A (en) | Method for detecting symbolic SNP (Single Nucleotide Polymorphism) of lung cancer metastasis and application thereof | |
| CN114807356A (en) | NPPB gene DNA hydroxymethylation marker, primer and application thereof | |
| CN112048555B (en) | Prognosis classification system for survival prediction of glioma patients | |
| KR101597811B1 (en) | Gene relating to anti-cancer drug resistance and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |