CN101838683B - Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene - Google Patents
Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene Download PDFInfo
- Publication number
- CN101838683B CN101838683B CN 200910177851 CN200910177851A CN101838683B CN 101838683 B CN101838683 B CN 101838683B CN 200910177851 CN200910177851 CN 200910177851 CN 200910177851 A CN200910177851 A CN 200910177851A CN 101838683 B CN101838683 B CN 101838683B
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- base
- extension
- codon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting the nucleotide mutation points of a KRAS gene and/or a BRAF gene, which comprises the following steps that: (1) the mutation points to be detected of the KRAS gene and/or the BRAF gene are determined; (2) according to the mutation points, an amplification primer and the extension primer of each mutation point are designed; (3) PCR amplification; (4) SAP enzyme treatment; (5) extension reaction; (6) resin is adopted to purify an extension reaction product; and (7) mass spectrometry detection, the mutant of the target sites of the KRAS gene and/or the BRAF gene to be detected is determined. The method solves the problems of low sensitivity, limited accuracy, low flux and high cost of a traditional detection method. In addition, the invention also provides a specific primer and a primer combination of the method and the purposes thereof for the detection method.
Description
Technical field
The invention belongs to organic-biological molecule field in genomics and the molecular biology, in particular to the detection method of the nucleotide mutant site of KRAS gene and/or BRAF gene.
Background technology
The genetic information of the most of organisms of nature all is included in the thymus nucleic acid (DNA), 3,000,000,000 bases in the human full genome, and approximately 40,000 genes are distributed on 24 pairs of karyomit(e)s.Each gene is by transcribing, translating, and the special protein of encoding is regulated and control specific biochemical reaction in the organism, brings into play special biological function.The change of dna sequence dna, i.e. transgenation can cause change or the disappearance of protein structure, function, and then causes relevant genetic diseases.Transgenation comprises insertion, disappearance and the change (point mutation) that base pair occurs in the dna molecular.
Studies show that the generation of numerous disease, closely related such as more than 3000 disease such as hemophilia, thalassemia, Du Shi type muscular dystrophy, Huntington chorea, senile dementia, diabetes, obesity, cardiovascular disorder and autoimmunization and transgenation.In addition, people recognize that gradually the genesis of cancer also is the result of gene accumulation sudden change in recent years.
In human genome, approximately 90% difference is that difference with the single core thuja acid embodies, mainly conversion (transition) or the transversion (transversion) by single base caused, such difference site is called single nucleotide polymorphism (single nucleotide polymorphism, SNP).In the crowd, the occurrence frequency of this variation is greater than 1% at least, otherwise is considered to point mutation.SNP site great majority are bifurcation, and two kinds of manifestation are namely only arranged on a site, and extensively exist in human genome, just have 1 in average every 500-1000 base pair, estimate that its sum can reach 3,000,000 even more.These differences very likely are to cause the inherited genetic factors of individual difference, find that therefore these sites can be widely used in the research fields such as the research of genetic marker, assessment idiogenetics relation, assessment spore.
The method that detects at present SNP and transgenation has many kinds, such as Direct PCR order-checking, RFLP, gene chip and quantitative fluorescent PCR etc.Wherein, the Direct PCR order-checking is least responsive, only has the medicament-resistant mutation strain to reach more than 20% and just can be detected; Be not suitable for Large-scale Screening yet; Rflp analysis can only detect in virus is overall mutant strain greater than 5%, but for each interested sudden change, must the independent endonuclease of special design.Specificity restriction endonuclease for some sudden change may not exist, so rflp analysis and be not suitable for all sudden changes.Biochip technology is utilized the oligonucleotide microarray, can detect newfound sudden change, but this method costs dearly, and is not used widely.In a word, above-mentioned these methods do not waste time and energy, and sensitivity is low, and accuracy is low, are exactly that cost is high, are not suitable for extensive examination.
KRAS gene and BRAF gene
Before entering individuation targeted therapy course for the treatment of as colorectal cancer patients, the KRAS detection in Gene Mutation needs the detection carried out, classified in " colorectal carcinoma clinical treatment guide " as requisite one by NCCN (american cancer integrated network), be used for the colorectal cancer patients that assist clinicians filters out specificss such as can benefiting from Cetuximab (Erbitux) and Panitumumab (Victibix).Studies show that the KRAS transgenation mainly occurs on coding 12 and 13 (being positioned at exon 2) position in the tumor tissues, occurrence frequency is about 25.4%, 9.2%, in addition, the small part sudden change occurs on coding 61 and 146 positions, and occurrence frequency is about 0.4% and 1.3%.The do not undergo mutation patient of (somatic mutation) takes relevant target therapeutic agent, can obtain obvious result for the treatment of, and the sudden change patient is to this type of targeted drug resistance.
The BRAF gene is as an important step in the MAPK path, and its mutation type is mainly V600E, but its sudden change inducing cell propagation stops apoptosis; The existence of wild-type BRAF gene is that colorectal cancer patients is used Erbitux and the effective essential condition of Victibix.
Therefore the detection of the resistance mutation in said mutation site had important clinical meaning.
The detection of the nucleotide mutant site of KRAS gene and BRAF gene
The method of using for the sudden change detection of KRAS gene and BRAF gene at present mainly contains the method for quantitative fluorescent PCR, method and the mass spectrometric detection method of direct Sequencing.
Quantitative fluorescent PCR detects mainly for 7 kinds of mutation types of BRAF gene V600E, KRAS gene 12,13 bit codons, judges that by the fluorescent signal of detected result described site has or not sudden change.The most frequently used probe type of quantitative fluorescent PCR is the Taqman probe, fluorophor commonly used has FAM, TET and VIC etc., when probe is complete, because the quenching of fluorescence group itself can cause background higher by the different fluorescence of emission wavelength when the fluorescent energy that the absorption reporter group is launched.
The method of direct Sequencing mainly obtains to contain the full length sequence in mutational site by order-checking.Carry out mainly for KRAS gene 12,13 and 61 bit codons at present, the method shortcoming is to need the content of mutant in the sample to be checked to reach higher proportion, and the 20-30% that generally needs the content of sudden change sample to account for whole sample sizes just can have and detects preferably effect.
No matter be fluorescent quantitation or direct Sequencing, all there is the not high problem of sensitivity.The detection limit of bibliographical information quantitative fluorescent PCR is about about 5% (be the ratio of mutant account for total sample ratio 5%), only is about 20% based on the detection limit of the detection method of order-checking.By comparison, mass-spectrometric technique can detect the sudden change that is low to moderate 1% ratio, and sensitivity is higher.
But mutational site and type that the mass spectrometry method that detects at present the KRAS gene can detect are less, cover incomplete.Because the mass spectroscopy cost is higher, therefore wish in a mass spectroscopy, to detect nucleotide mutant site as much as possible.
Therefore, need the method for the nucleotide mutant site of new detection KRAS gene and/or BRAF gene in this area badly, thereby realize a plurality of nucleotide mutant sites of KRAS gene and/or BRAF gene and the quick and easy detection of mutant.
Summary of the invention
The object of the present invention is to provide the detection method of the nucleotide mutant site of a kind of KRAS gene and/or BRAF gene, be intended to solve lower and the problem that cost is higher of existing detection method efficient.
In a first aspect of the present invention, a kind of detection method of nucleotide mutant site is provided, comprise the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change;
The employed amplimer of wherein said step (2) is to being the combination with polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ IDNO:2;
And the employed extension primer of wherein said step (5) comprises polynucleotide with SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each one or more.
In a preferred embodiment of the invention, employed amplimer is to also comprising the one or more pairs of SEQ of having ID NO:3 and SEQ ID NO:4, and the combination of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6, and employed extension primer also comprises the polynucleotide with sequence shown in SEQ IDNO:13 to the SEQ ID NO:18.
In another preferred embodiment of the present invention, employed amplimer is to also comprising the combination with polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8, and employed extension primer also comprises the polynucleotide with sequence shown in the SEQ ID NO:19.
In another preferred embodiment of the present invention, use nucleotide mutant site that method of the present invention detects to be in 12,13,61 and 146 bit codons of KRAS gene one or more.
In another preferred embodiment of the present invention, also detect simultaneously the sudden change of 600 bit codons of BRAF gene.
In addition, the present invention also provides Auele Specific Primer and the combination of primers that is used for above-mentioned detection method, and this primer and combination of primers are for detection of the purposes of the nucleotide mutant site of KRAS gene and/or BRAF gene.
The mass spectrometric detection method of using the combination of method of the present invention and primer to carry out has covered all hotspot location of present KRAS transgenation resistance, and the highly sensitive characteristics of utilizing mass spectrum itself to detect realize the KRAS detection in Gene Mutation of highly sensitive, all standing.
In addition, the mass spectrometric detection method of using the combination of method of the present invention and primer to carry out can detect the sudden change of KRAS gene and BRAF gene simultaneously, can cover all hotspot location of present KRAS gene and BRAF gene medicament-resistant mutation.Not only greatly improve accuracy rate and the detection efficiency of detection in Gene Mutation, also simplified schedule of operation, and saved time and cost.
Description of drawings
The result that Fig. 1 detects 12 and 13 codons of test sample book KRAS gene for use extending primer KRAS12c2, KRAS13c2.
The result that Fig. 2 detects 61 and 146 codons of test sample book KRAS gene for use extending primer KRAS61c2# 1, KRAS61c2# 2 and KRAS146c1.
Figure 3 shows that and use to extend the result that primer BRAF V600E detects 600 codons of test sample book BRAF gene.
The result that Fig. 4 detects 600 codons of 12,13 codons of the KRAS gene of test sample book and BRAF gene simultaneously for use extending primer KRAS12C1, KRAS12C2, KRAS13C1, KRAS13C2 and BRAF V600E.
The result that Fig. 5 detects 61 and 146 codons of the KRAS gene of test sample book simultaneously for use extending primer KRAS61c2# 1, KRAS61c2#2, KRAS61c 3, KRAS146c1 and KRAS146c2.
The result that Fig. 6 detects 61 codons of the KRAS gene of test sample book for use extending primer KRAS61c1.
Embodiment
In a first aspect of the present invention, a kind of detection method of nucleotide mutant site is provided, comprise the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change;
The employed amplimer of wherein said step (2) is to for having the combination of the polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ IDNO:2,
And the employed extension primer of wherein said step (5) comprises polynucleotide with SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each one or more.
The below specifically describes a plurality of preferred embodiments of the present invention, it should be understood that these embodiments are intended to describe in detail the present invention, and not in office where face consists of limitation of the scope of the invention.
Determining of mutational site
In the step (1) of the inventive method, for the mutational site that nucleotide sequence to be checked may exist, determine the position of mutational site in sequence to be checked.
In human genome, approximately 90% difference is that difference with the single core thuja acid embodies, mainly conversion (transition) or the transversion (transversion) by single base caused, such difference site is called single nucleotide polymorphism (single nucleotide polymorphism, SNP).In the crowd, the occurrence frequency of this variation is greater than 1% at least, otherwise is considered to point mutation.SNP site great majority are bifurcation, and two kinds of manifestation are namely only arranged on a site, and extensively exist in human genome, just have 1 in average every 500-1000 base pair, estimate that its sum can reach 3,000,000 even more.
For the KRAS gene, studies show that the KRAS transgenation mainly occurs on codon 12 and 13 (the being positioned at exon 2) position in the tumor tissues, occurrence frequency is about 25.4%, 9.2%, in addition, the small part sudden change occurs on codon 61 and 146 positions, and occurrence frequency is about 0.4% and 1.3%.The do not undergo mutation patient of (somatic mutation) takes relevant target therapeutic agent, can obtain obvious result for the treatment of, and the sudden change patient is to this type of targeted drug resistance.
KRAS gene 12 bit codon wild-types are GGT, and its common mutations type comprises CGT, AGT, TGT and GCT, GAT, GTT; KRAS gene 13 bit codon wild-types are GGC, and its common mutations type comprises CGC, AGC, TGC and GCC, GAC, GTC; KRAS gene 61 bit codon wild-types are CAA, and its common mutations type comprises AAA, GAA, CCA, CGA, CTA, CAC and CAT; KRAS gene 146 bit codon wild-types are GCA, and its common mutations type comprises ACA, CCA, GTA.
For the BRAF gene, BRAF is an important step in the MAPK path, and its mutation type is mainly V600E, but this sudden change inducing cell increment stops apoptosis.Therefore the existence of wild-type BRAF gene is that colorectal cancer patients is used Erbitux and the effective essential condition of Victibix.The wild-type of the 600th bit codon of BRAF gene is GTG, and its common mutations type comprises GAG, GCG.
Therefore, embodiment of the present invention are above-mentioned each the mutational site design primers for KRAS gene and/or BRAF gene.
Design of primers
In the step (2) of the inventive method, according to the Position Design primer in mutational site, comprising the pair for amplification primer, every primer length is 30bp at least, and its 5 ' end respectively contains the tag of 10bp; And the extension primer, its length is 17-28bp, just in time is positioned at the 5 ' end in mutational site, 3 ' must have 9 bases to mate fully.
In another preferred embodiment of the present invention, above-mentioned steps (2) can also comprise: according between primer, do not form dimer between primer and amplified production/extension products, primer self does not form hairpin structure, and the principle that mispairing does not occur between primer and template.
The extension primer that is used for mass spectrometric detection is greater than 30Da according to every mutual difference of molecular weight of extending primer, each molecular weight difference that extends between primer and each extension products is not less than 9Da, extends the principle that the molecular weight of primer and extension products will be between 4,500 one 8500Da.
The amplimer of a plurality of detection site is mixed with amplimer, extend primer and mix with the extension primer.Can detect simultaneously so a plurality of discrete SNP site, improve efficient, provide cost savings.
In another preferred embodiment of the present invention, continuous a plurality of mutational sites can also be marked at the same nucleotides sequence lists, and shared pair for amplification primer, to the left and right both sides design is taked in the mutational site at two ends, the extension primer in mutational site, left side is taked Top-Down Design, and the extension primer in mutational site, right side is taked reverse design; The extension primer in the mutational site in the middle of being positioned at has many, and comprises all Nucleotide situations that the mutational site of its upstream may exist.Like this, can detect simultaneously a plurality of sites of continuous mutation, provide cost savings, shorten the cycle, improve efficient.Specifically, can adopt following method to design the extension primer in continuous a plurality of mutational sites: if mutational site, described left side is Snp1, middle mutational site is Snp2, and the mutational site, right side is Snp3, and Snp1/Snp2/Snp3 place sequence is:
TCAGCGATAT[C/T] C[G/A] [T/G] AATTCGTACGATGATCGCTA GA ... Snp1[C/T then], SNP site, right side, Top-Down Design, the extension primer is: ... TCAGCGATATSnp3[T/G], SNP site, left side, reverse design, the extension primer is: ... TACGAATTSnp2[G/A], middle SNP site, degenerated primer, the extension primer is: ... AGCGATATCC and ... AGCGATATTC.
In specific embodiments of the present invention, used following one or more pairs of following amplimer to and one or more following extension primers, the sequence of each primer and sequence numbering and explanation see the following form 1
Table 1: amplimer of the present invention and extension primer
| The extension primer (KRAS61c2#2) of base | ||
| SEQ ID NO：16 | GTCCCTCATTGCACTGTACTCCTC | Detect the extension primer (KRAS61c3) of KRAS61 codon the 3rd bit base |
| SEQ ID NO：17 | AATTCCTTTTATTGAAACATCA | Detect the extension primer (KRAS146c1) of KRAS146 codon the first bit base |
| SEQ ID NO：18 | TACTTACCTGTCTTGTCTTT | Detect the extension primer (KRAS146c2) of KRAS146 codon second base |
| SEQ ID NO：19 | ACCCACTCCATCGAGATTTC | Detect the extension primer of BRAF600 codon GAG, GCG sudden change |
Pcr amplification
In the step (3) of present method, the purpose fragment is carried out pcr amplification, the condition of amplified reaction is well known to those skilled in the art, and also describes in an embodiment of the present invention exemplary reaction conditions in detail.And according to the concrete sequence of employed primer of the present invention, the condition of amplified reaction is carried out certain variation or optimized also within those skilled in the art's limit of power.
In amplification step of the present invention, the amplimer of use is to being the primer with SEQ ID NO:1 and SEQ ID NO:2.
In a preferred embodiment of the invention, the amplimer of use is to also comprising the one or more pairs of SEQ of having ID NO:3 and SEQ ID NO:4, and the mixture of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6.
In another preferred embodiment of the present invention, the amplimer of use is to also comprising the mixture with polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8.
The SAP enzyme is processed
In the step (4) of the inventive method, amplified production is carried out SAP enzyme (shrimp alkaline phosphotase) to be processed, remove the dNTP that contains in the described amplified production, can be with unreacted dNTP dephosphorylation, stop it to participate in the subsequent reactions, only extend a base when guaranteeing extension.
Extension
In the step (5) of the inventive method, the amplified production of processing through SAP is carried out extension, in extension, use extension primer of the present invention, a base (ddNTP) that how difference of resulting extension products and extension primer only has been its 3 ' end.The employed raw material of extension is the ddNTP through modification of liquor quality, and it had both guaranteed that extension only connected a base, and the resolving power of whole system is improved.
Use in the method for the invention the ddNTP through modification of liquor quality, the main purpose of carrying out modification of liquor quality is in order to make molecular weight differences between each extension products apart from increasing, thereby improves the resolving power of follow-up mass spectroscopy.The method of ddNTP being carried out modification of liquor quality is known.
As a preferred embodiment of the present invention, the molecular weight of four kinds of ddNTP is respectively: ddATP, 271.2Da, ddTTP 327.1Da, ddCTP 247.2Da, and ddGTP 287.2Da; Wherein molecular weight difference is more than 16Da.
In the method for the invention, employed extension primer comprises one or more of polynucleotide with SEQ ID NO:9 to SEQID NO:12 sequence shown in each.
In a preferred embodiment of the invention, employed extension primer comprises one or more of polynucleotide with SEQ IDNO:13 to SEQ ID NO:18 sequence shown in each.
In again another preferred embodiment of the present invention, employed extension primer also comprises the polynucleotide with sequence shown in the SEQ ID NO:19.
In other specific embodiments of the present invention, can use each combination of primers as described below to carry out extension and the order-checking of mass spectrum subsequently: (1) is with KRAS12c1, KRAS12c2, KRAS13c1, KRAS13c2, BRAF V600E combination is used for an extension system and places simultaneously a mass spectrometric well to detect reaction product, and the mutant that detects is: KRAS gene 12 bit codon mutation types (comprise CGT, AGT, TGT and GCT, GAT, GTT) and KRAS gene 13 bit codon mutation types (comprise CGC, AGC, TGC and GCC, GAC, GTC) and BRAF gene the 600th codon mutation type (comprising GAG and GCG); (2) KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1, KRAS146c2 combination are used for an extension system and place simultaneously a mass spectrometric well to detect reaction product, the mutant that detects is: KRAS gene 61 bit codon mutation types (comprising CCA, CGA, CTA, CAC and CAT) and KRAS gene 146 bit codon mutation types (comprising ACA, CCA, GTA); (3) use separately KRAS61c1 to carry out extension and place mass spectrometric independent well to detect reaction product, the mutant that detects is 61 bit codon mutation types (comprising AAA, GAA).
Mass spectroscopy
In the step (7) of the inventive method, purified extension products is carried out mass spectroscopy, thereby determine the molecular weight of each extension products.
In preferred implementation of the present invention, mass spectrograph is selected ground substance assistant laser desorption ionization flight time mass spectrum (MALDI-TOF-MS).The reaction system of this flight time mass spectrum gene type system is non-hybridization dependency, does not exist potential hybridization mispairing to disturb, and also do not need to introduce various markers, thereby accuracy is high.
In described method, with purified product and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser, because substrate molecule is through the radiation absorption energy, cause energy to be accumulated and rapidly heat production, thereby make the host crystal distillation, nucleic acid molecule will desorption and is changed metastable state ion into, the ion that produces mostly is single charge ion, these single charge ions obtain identical kinetic energy in accelerating field, and then are separated according to its mass-to-charge ratio rate in a non-electric field drift region, and flight arrives detector in the vacuum tubule.Like this, adopt mass spectrograph to detect mutational site to be detected not only convenient, and highly sensitive, accuracy is high.
Compared with prior art, the present invention adopts matrix-assisted laser desorption/ionization flight time mass spectrum (MALDI-TOF-MS) system to detect, the reagent consumptive material that uses in mass-spectrometric technique is relatively simple and stable, do not need fluorescence dye, special expensive reagent such as enzyme, reaction can be carried out in micro-system, reduces the use of sample and various running stores.
Because the molecular weight (mass-to-charge ratio) of mass-spectrometric technique direct-detection DNA, directly determine the type of base, do not need through any type of conversion of signals, as long as there is in theory the SNP segment of a copy to be amplified and to identify, stopped the possibility that false negative occurs.Mass-spectrometric technique also has automatization, high throughput testing characteristics in addition.Mass-spectrometric technique combines with many primer extensions technology, can in a reaction system, detect simultaneously a plurality of mutational sites, the PCR reaction can be carried out in micro-system, in conjunction with DNA automatic lifting taking equipment, multiple PCR primer design software and data analysis software, greatly alleviate workload, improved the detection flux.
In order to make purpose of the present invention, technical scheme and advantage clearer, below in conjunction with accompanying drawing and following embodiment, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explain the present invention, is not intended to limit the present invention.
Embodiment 1: the nucleotide mutant site that detects the KRAS gene
(1) amplimer of design amplification KRAS gene the 12nd, 13,61 and 146 codons reaches the extension primer for detection of the coding mutation in each site
Mass spectrometric detection for the said mutation site, according to KRAS gene order (NCBI accession number: EU332849), design each amplimer and extend primer, each amplimer is all at the sequence label of 5 ' end with 10 base acgttggatg, and sequence and the sequence numbering of described each amplimer and extension primer see the above table 1.
(2) pcr amplification
Sample is the DNA that extracts from the paraffin section tissue, chooses at random sample and tests, and arranges simultaneously and does not contain the dna sample of sudden change as negative control.
By pcr amplification, obtain to contain the target sequence amplified production in described mutational site.Reaction system is 5 μ l, wherein contains 2mM Mg2+, 1 * damping fluid, 100nM amplimer, 500 μ MdNTP, 0.5U HotstarTaq enzyme (except amplimer, all the other are all available from U.S. Sequenom company); Reaction conditions is 94 ℃, 15min; 94 ℃ of sex change 20s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, coamplification 45 circulations; Final 72 ℃ are extended 3min.After the PCR reaction, the copy number with the nucleotide sequence in mutational site in the KRAS genomic dna has obtained amplification.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and process.
(3) SAP processes
The PCR reaction product is processed through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme (available from Fermentas company); The reaction cumulative volume is 7 μ l (2 μ l SAP+5 μ l PCR products).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
The aforementioned reaction product of processing through SAP is carried out extension, connect a base at the 3 ' end that extends primer, molecular weight difference is not less than 9Da between the extension products that obtains and the described extension primer, and the molecular weight difference between other extension products of each mutant is not less than 9Da.The employed raw material of extension is the ddNTP through modification of liquor quality, and it had both guaranteed that extension only connected a base, and the resolving power of whole system is improved.
The extension system is 9 μ l, the reaction density of all ingredients such as damping fluid, ddNTPs (quality is through modifying), iPLEX enzyme (all available from U.S. Sequenom company) is different because of the difference of reaction times, the concentration of extending primer sees the following form 2, and the reaction cumulative volume is 9 μ l (2 μ l extension mixtures+7 μ l SAP process product).Reaction conditions: 94 ℃ of 30s; 40 circulations [94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s)], 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
Table 2: employed extension primer concentration
| The primer title | Concentration (μ M/9 μ l reaction system) |
| KRAS12c1 | 0.726 |
| KRAS12c2 | 0.964 |
| KRAS13c1 | 0.753 |
| KRAS13c2 | 0.837 |
| KRAS61c1 | 0.731 |
| |
0.728 |
| |
0.715 |
| KRAS61c3 | 1.061 |
| KRAS146c1 | 0.985 |
| KRAS146c2 | 0.882 |
(5) adopt resin purification extension product.
Add 6mg resin (available from U.S. Sequenom company, model 08040) in the product of extension, 30min turns upside down.Through the reaction of this step, the resin fully positively charged ion in reaction system is combined, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into the mass spectrometric valve tube of Sequenom with this crystal, then excite with instantaneous Beam in Nanosecond Intense Laser, and carry out MALDI-TOF-MS and analyze, thus the genotype in definite each mutational site of KRAS gene to be detected.
The result of mass spectrometric detection Figure 1 shows that and use to extend the result that primer KRAS12c2 and KRAS13c2 detect 12 and 13 codons of test sample book KRAS gene shown in following each figure.The negative check sample of sample 1A wherein, sample 1B and 1C are sample to be tested.For negative control sample 1A, because codon is not undergone mutation, therefore use the extension products molecular weight that extends primer KRAS12c2 and KRAS13c2 gained to be 6819.5Da (Figure 1A-1) and 5393.5Da (Figure 1A-2); For sample 1B, the molecular weight of mass spectrometric detection KRAS12c2 product is 6819.5Da and 6803.5Da, can determine that the KRAS12 dibasic sudden change of bit codon (Figure 1B) has occured sample 1B; For sample 1C, the molecular weight of mass spectrometric detection KRAS13c2 product is respectively 5393.5Da and 5473.5Da, can infer to have the dibasic sudden change of KRAS13 bit codon (seeing Fig. 1 C) in this sample.
Figure 2 shows that and use to extend the result that primer KRAS61c2# 1, KRAS61c2# 2 and KRAS146c1 detect 61 and 146 codons of test sample book KRAS gene.The negative check sample of 2A wherein, sample 2B and 2C are sample to be tested.For negative control sample 2A, because codon is not undergone mutation, and KRAS61c2 is detected simultaneously with KRAS61c2# 1 and two primers of KRAS61c2# 2, so KRAS61c2# 1, KRAS61c2# 2, KRAS146c1 extension products molecular weight are respectively 5426.57Da (Fig. 2 A-1), 6016.81 (Fig. 2 A-2) and 6954.59Da (Fig. 2 A-3); For sample 2B, the molecular weight of mass spectrometric detection KRAS61c2# 1, KRAS61c2# 2 extension products is 5442.57Da and 5936.89Da, can determine that the dibasic sudden change of KRAS61c2 bit codon (Fig. 2 B-1,2B-2) has occured sample 2B; For sample 2C, the molecular weight of mass spectrometric detection KRAS146c1 product is 6938.59Da, can infer the sudden change (seeing Fig. 2 C) that has KRAS146c1 bit codon the first base in this sample.
Can find out from the above results, use method of the present invention and primer to detect the drug-fast mutant sites of KRAS gene, can increase at the same time the KRAS gene the 12nd, 13,61 and 146 codons the various mutations type and carry out mass spectrometric detection, compared with prior art, greatly improve detection efficiency, and reduced testing cost.
Embodiment 2: each mutational site of detecting simultaneously KRAS and BRAF gene.
In the present embodiment, detect simultaneously the 12nd, 13,61 and 146 bit codons of KRAS gene and the 600th bit codon of BRAF gene.
(1) is designed for the amplimer of amplification BRAF gene the 600th codon and for detection of the extension primer of the coding mutation of this codon
The wild-type of BRAE gene the 600th codon is GTG, and its common mutations type comprises GAG and GCG.(the NCBI accession number: NG_007873), design each amplimer and extend primer, each amplimer is all at the sequence label of 5 ' end with 10 base acgttggatg according to the BRAF gene order.The amplimer that is used for each codon of amplification KRAS gene is identical with embodiment 1.Sequence and the sequence numbering of described each amplimer and extension primer see the above table 1.
(2) pcr amplification
Reaction system is similar to embodiment 1 with condition, and difference only has been also to add concentration in reaction system be the BRAF amplimer mixture of 100nM, by pcr amplification, obtains to contain the target sequence amplified production in described mutational site.
(3) SAP processes
Aforesaid PCR mixture of reaction products is processed by SAP digestive ferment (shrimp alkaline phosphotase), and the system of described SAP reaction is identical with embodiment 1 with condition.
(4) extension
The extension system is similar to embodiment 1 with condition, difference only has been also to add the extension primer for detection of BRAE the 600th bit codon shown in the SEQ ID NO:19 in reaction system, the concentration of described extension primer is 0.879 μ M/9 μ l reaction system.
In the present embodiment, also used each combination of primers as described below to carry out extension and the order-checking of mass spectrum subsequently: (1) is with KRAS12c1, KRAS12c2, KRAS13c1, KRAS13c2, the BRAEV600E combination is used for an extension system and places simultaneously a mass spectrometric well to detect reaction product, and the mutant that detects is: KRAS gene 12 bit codon mutation types (comprise CGT, AGT, TGT and GCT, GAT, GTT) and KRAS gene 13 bit codon mutation types (comprise CGC, AGC, TGC and GCC, GAC, GTC) and BRAE gene the 600th codon mutation type (comprising GAG and GCG); (2) KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1, KRAS146c2 combination are used for an extension system and place simultaneously a mass spectrometric well to detect reaction product, the mutant that detects is: KRAS gene 61 bit codon mutation types (comprising CCA, CGA, CTA, CAC and CAT) and KRAS gene 146 bit codon mutation types (comprising ACA, CCA, GTA); (3) use separately KRAS61c1 to carry out extension and place mass spectrometric independent well to detect reaction product, the mutant that detects is 61 bit codon mutation types (comprising AAA, GAA).
(5) adopt resin purification extension product.
The resin purification step is identical with embodiment 1.
(6) mass spectrometric detection
Carry out mass spectrometric detection according to the method identical with embodiment 1, determine the genotype in each mutational site of KRAS gene and BRAF gene.
Mass spectrometric detection the results are shown in following each figure.Figure 3 shows that and use to extend the result that primer BRAF V600E detects 600 codons of test sample book BRAF gene.The negative check sample of sample 3A, sample 3B are sample to be tested.For negative control sample 3A, owing to codon is not undergone mutation, so BRAF V600E extension products molecular weight is 6597.3Da (Fig. 3 A); For sample 3B, the molecular weight of mass spectrometric detection BRAF V600E extension products is 6597.3Da and 6653.2Da, can determine that BRAF V600E bit codon mutation (Fig. 3 B) has occured sample 3B.
The result that Fig. 4 detects 600 codons of 12,13 codons of the KRAS gene of test sample book and BRAF gene simultaneously for use extending primer KRAS12C1, KRAS12C2, KRAS13C1, KRAS13C2 and BRAF V600E.The detected result of sample 4A is shown, the molecular weight of extension products is respectively 5574.6,6819.5,5995.9,5393.5 and 6597.3Da, does not undergo mutation in the above site of visible sample 4A.
The result that Fig. 5 detects 61 and 146 codons of the KRAS gene of test sample book simultaneously for use extending primer KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1 and KRAS146c2.To the detected result demonstration of sample 5, the molecular weight of extension products is respectively 5426.57Da, 6016.81Da, 7517.8Da, 6954.59Da and 6902.1Da, does not undergo mutation in the above site of visible sample 5.
The result that Fig. 6 detects 61 codons of the KRAS gene of test sample book for use extending primer KRAS61c1.To the detected result demonstration of sample 6, the molecular weight of extension products is respectively 5417.6Da, does not undergo mutation in this site of visible sample 6.
Can find out from the above results, use method of the present invention and primer to detect the drug-fast mutant sites of KRAS gene and BRAF gene, can in a mass spectrometric detection, detect simultaneously the 12nd, 13,61 and 146 codons of KRAS gene and the various mutations type of BRAF gene the 600th bit codon, compared with prior art, greatly improve detection efficiency, and reduced testing cost.
The above only is preferred and specific embodiment of the present invention, not in order to limiting the present invention, all any modifications of doing within the spirit and principles in the present invention, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.
Sequence table
＜110〉Shenzhen Huada Genetic Technology Co., Ltd
＜120〉detection method of the nucleotide mutant site of a kind of KRAS gene and/or BRAF gene
<130>CP1091108/CB
<160>19
<170>PatentIn version 3.3
<210>1
<211>30
<212>DNA
＜213〉artificial sequence
<400>1
acgttggatg ggcctgctga aaatgactga 30
<210>2
<211>30
<212>DNA
＜213〉artificial sequence
<400>2
acgttggatg gttggatcat attcgtccac 30
<210>3
<211>29
<212>DNA
＜213〉artificial sequence
<400>3
acgttggatg ggagaaacct gtctcttgg 29
<210>4
<211>29
<212>DNA
＜213〉artificial sequence
<400>4
acgttggatg atgtactggt ccctcattg 29
<210>5
<211>29
<212>DNA
＜213〉artificial sequence
<400>5
acgttggatg tcagtgttac ttacctgtc 29
<210>6
<211>29
<212>DNA
＜213〉artificial sequence
<400>6
acgttggatg ctcaggactt agcaagaag 29
<210>7
<211>29
<212>DNA
＜213〉artificial sequence
<400>7
acgttggatg tcaaactgat gggacccac 29
<210>8
<211>29
<212>DNA
＜213〉artificial sequence
<400>8
acgttggatg cttcatgaag acctcacag 29
<210>9
<211>17
<212>DNA
＜213〉artificial sequence
<400>9
ttgtggtagt tggagct 17
<210>10
<211>21
<212>DNA
＜213〉artificial sequence
<400>10
aacttgtggt agttggagct g 21
<210>11
<211>19
<212>DNA
＜213〉artificial sequence
<400>11
aaggcactct tgcctacgc 19
<210>12
<211>17
<212>DNA
＜213〉artificial sequence
<400>12
aggcactctt gcctacg 17
<210>13
<211>17
<212>DNA
＜213〉artificial sequence
<400>13
ttctcgacac agcaggt 17
<210>14
<211>17
<212>DNA
＜213〉artificial sequence
<400>14
tctcgacaca gcaggtc 17
<210>15
<211>19
<212>DNA
＜213〉artificial sequence
<400>15
cattgcactg tactcctct 19
<210>16
<211>24
<212>DNA
＜213〉artificial sequence
<400>16
gtccctcatt gcactgtact cctc 24
<210>17
<211>22
<212>DNA
＜213〉artificial sequence
<400>17
aattcctttt attgaaacat ca 22
<210>18
<211>20
<212>DNA
＜213〉artificial sequence
<400>18
<210>19
<211>20
<212>DNA
＜213〉artificial sequence
<400>19
acccactcca tcgagatttc 20
Claims (9)
1. the detection method of a nucleotide mutant site comprises the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change;
Wherein said nucleotide mutant site is first and two bit bases of the 12nd and 13 codons of KRAS gene;
The employed amplimer of wherein said step (2) is to being the combination of the polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ ID NO:2;
And the employed extension primer of wherein said step (5) is one or more of polynucleotide of SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each, wherein SEQ ID NO:9 is for detecting the extension primer of KRAS12 codon the first bit base, SEQ ID NO:10 is for detecting the extension primer of KRAS12 codon second base, SEQ ID NO:11 is for detecting the extension primer of KRAS13 codon the first bit base, and SEQ ID NO:12 is for detecting the extension primer of KRAS13 codon second base;
Described method is used for non-diagnostic purpose.
2. the detection method of a nucleotide mutant site comprises the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change; Wherein said nucleotide mutant site is the first to three bit base of the 61st codon of KRAS gene;
The employed amplimer of wherein said step (2) is to being the combination of the polynucleotide of sequence shown in SEQ ID NO:3 and the SEQ ID NO:4,
Employed extension primer is one or more of polynucleotide of sequence shown in SEQ ID NO:13 to the SEQ ID NO:16 in the wherein said step (5), wherein SEQ ID NO:13 is for detecting the extension primer of KRAS61 codon the first bit base, SEQ ID NO:14 is for detecting the extension primer of KRAS61 codon second base, SEQ ID NO:15 is for detecting the extension primer of KRAS61 codon second base, and SEQ ID NO:16 is for detecting the extension primer of KRAS61 codon the 3rd bit base;
Described method is used for non-diagnostic purpose.
3. the detection method of a nucleotide mutant site comprises the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change; Wherein said nucleotide mutant site is first and two bit bases of the 146th codon of KRAS gene;
The employed amplimer of wherein said step (2) is to being the combination of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6,
Employed extension primer is one or more of polynucleotide of sequence shown in SEQ ID NO:17 and the SEQ ID NO:18 in the wherein said step (5), wherein SEQ ID NO:17 is for detecting the extension primer of KRAS146 codon the first bit base, and SEQ ID NO:18 is for detecting the extension primer of KRAS146 codon second base;
Described method is used for non-diagnostic purpose.
4. the detection method of a nucleotide mutant site comprises the steps:
(1) for the mutational site of nucleotide sequence to be checked, determines the position of mutational site in sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) process by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are that to enlarge molecular weight difference be four kinds of ddNTP molecules that purpose was carried out modification of liquor quality;
(6) adopt resin purification extension product;
(7) with the product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, then excite with instantaneous Beam in Nanosecond Intense Laser and carry out mass spectrometric detection, determine the genotype of sudden change; Wherein said nucleotide mutant site is the 600th bit codon GAG, the GCG sudden change of BRAF gene;
The employed amplimer of wherein said step (2) is to being the combination of the polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8,
Employed extension primer is the polynucleotide of sequence shown in the SEQ ID NO:19 in the wherein said step (5);
Described method is used for non-diagnostic purpose.
5. the combination of primers that is used for the detection method of claim 1, described combination of primers be the polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ ID NO:2 as amplimer, and the polynucleotide of sequence shown in SEQ ID NO:9 to the SEQ ID NO:12 are as extending primer.
6. the combination of primers that is used for the detection method of claim 2, described combination of primers be the polynucleotide of sequence shown in SEQ ID NO:3 and the SEQ ID NO:4 as amplimer, and the polynucleotide of sequence shown in SEQ ID NO:13 to the SEQ ID NO:16 are as extending primer.
7. the combination of primers that is used for the detection method of claim 3, described combination of primers be the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6 as amplimer, and the polynucleotide of sequence shown in SEQ ID NO:17 to the SEQ ID NO:18 are as extending primer.
8. the combination of primers that is used for the detection method of claim 4, described combination of primers be the polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8 as amplimer, and the polynucleotide of sequence shown in the SEQ ID NO:19 are as extending primer.
9. the described combination of primers of claim 5-8 is for detection of first and two bit bases of the 12nd and 13 codons of KRAS gene, the first to three bit base and the first and two bit bases sudden change of the 146th codon and/or the purposes of BRAF gene the 600th bit codon GAG, GCG sudden change of the 61st codon, wherein
Amplimer is to SEQ ID NO:1 and SEQ ID NO:2 and the first and two bit bases sudden change of extension primer SEQ ID NO:9 to SEQ ID NO:12 for detection of the 12nd and 13 codons of KRAS gene, wherein SEQ ID NO:9 is for detecting the extension primer of KRAS12 codon the first bit base, SEQ ID NO:10 is for detecting the extension primer of KRAS12 codon second base, SEQ ID NO:11 is for detecting the extension primer of KRAS13 codon the first bit base, and SEQ ID NO:12 is for detecting the extension primer of KRAS13 codon second base;
Amplimer is to SEQ ID NO:3 and SEQ ID NO:4 and first to the three bit base sudden change of extension primer SEQ ID NO:13 to SEQ ID NO:16 for detection of the 61st codon of KRAS gene, wherein SEQ ID NO:13 is for detecting the extension primer of KRAS61 codon the first bit base, SEQ ID NO:14 is for detecting the extension primer of KRAS61 codon second base, SEQ ID NO:15 is for detecting the extension primer of KRAS61 codon second base, and SEQ ID NO:16 is for detecting the extension primer of KRAS61 codon the 3rd bit base;
Amplimer to SEQ ID NO:5 and SEQ ID NO:6 with extend primer SEQ ID NO:17 and SEQ ID NO:18 first and two bit bases for detection of the 146th codon of KRAS gene, wherein SEQ ID NO:17 is for detecting the extension primer of KRAS146 codon the first bit base, and SEQ ID NO:18 is for detecting the extension primer of KRAS146 codon second base;
Amplimer is to SEQ ID NO:7 and SEQ ID NO:8 and 600th bit codon GAG, the GCG sudden change of extension primer SEQ ID NO:19 for detection of the BRAF gene;
Described purposes is non-diagnostic purpose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910177851 CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810218344.4 | 2008-12-12 | ||
| CNA2008102183444A CN101440407A (en) | 2008-12-12 | 2008-12-12 | Method for detecting nucleotide mutant site |
| CN 200910177851 CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101838683A CN101838683A (en) | 2010-09-22 |
| CN101838683B true CN101838683B (en) | 2013-09-18 |
Family
ID=42742358
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910177851 Active CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101838683B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016007959A1 (en) * | 2014-07-11 | 2016-01-14 | Expression Pathology, Inc. | Srm/mrm assay for the serine/threonine-protein kinase b-raf (braf) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012049279A1 (en) * | 2010-10-14 | 2012-04-19 | Universitaet Des Saarlandes | MEANS AND METHODS APPLYING SINGLE NUCLEOTIDE PRIMER EXTENSION WITH ION PAIR-, REVERSED-PHASE HPLC (SIRPH) FOR THE DIAGNOSIS OF SNPs |
| CN102409089B (en) * | 2011-10-08 | 2017-04-19 | 深圳华大基因股份有限公司 | Kit, method and application for detecting mutation of predetermined locus in DNA sample |
| CN103184270A (en) * | 2011-12-28 | 2013-07-03 | 北京宏微特斯生物科技有限公司 | Method and kit for detecting drug resistance gene mutant type of tuberculous bacillus (TB) |
| CN102758012B (en) * | 2012-06-15 | 2013-06-05 | 毅新兴业（北京）科技有限公司 | Nucleic acid fingerprint feature atlas database of mycobacterium tuberculosis rpoB gene and use of nucleic acid fingerprint feature atlas database |
| CN102925555B (en) * | 2012-09-19 | 2014-07-09 | 长沙三济生物科技有限公司 | Sequencing primer pair for qualitatively detecting human BRAF V600E gene mutation and kit thereof |
| CN103013993B (en) * | 2012-12-26 | 2016-06-29 | 武汉康圣达医学检验所有限公司 | The method of primer and this primer Mass Spectrometer Method PIK3CA hotspot mutation |
| CN103602740A (en) * | 2013-11-06 | 2014-02-26 | 毅新兴业（北京）科技有限公司 | Method and kit for identifying free DNAs in serum by adopting mass spectrometer and applications of method and kit |
| CN111378751A (en) * | 2018-12-29 | 2020-07-07 | 成都华青精准医疗科技有限公司 | Nucleotide sequence group for detecting KRAS gene mutation and application thereof |
| CN111500727A (en) * | 2020-04-30 | 2020-08-07 | 北京和合医学诊断技术股份有限公司 | Primer group for detecting KRAS gene and BRAF gene mutation and application method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101014861A (en) * | 2004-08-13 | 2007-08-08 | 因迪维姆德有限公司 | Use of C3A and derivatives thereof as a biomarker for colorectal adenoma and/or carcinoma, diagnosis method and test system using the same |
-
2009
- 2009-09-28 CN CN 200910177851 patent/CN101838683B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101014861A (en) * | 2004-08-13 | 2007-08-08 | 因迪维姆德有限公司 | Use of C3A and derivatives thereof as a biomarker for colorectal adenoma and/or carcinoma, diagnosis method and test system using the same |
Non-Patent Citations (3)
| Title |
|---|
| Helen Davies et al..Mutations of the BRAF gene in human cancer.《nature》.2002,第417卷949-954. * |
| JP平10-276779A 1998.10.20 |
| kimura k. et al..No duplicate KRAS mutation is identified on the same allele in gastric or colorectal cancer cells with multiple KRAS mutations..《J.INT.MED.RES.》.2007,第35卷(第4期),450-457. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016007959A1 (en) * | 2014-07-11 | 2016-01-14 | Expression Pathology, Inc. | Srm/mrm assay for the serine/threonine-protein kinase b-raf (braf) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101838683A (en) | 2010-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
| EP3524688B1 (en) | Multiple detection method of methylated dna | |
| CN104293920B (en) | A kind of kit and using method thereof for fast detecting mankind VKORC1 and CYP2C9 gene pleiomorphism | |
| CN109182501B (en) | Folate metabolism gene polymorphism detection primer and kit | |
| CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
| CN101760566B (en) | Detection method on mutant site of ribonucleotide of HBV gene | |
| WO2022033407A1 (en) | Product for detecting dna/rna by using nucleic acid mass spectrometry and detection method | |
| CN101440407A (en) | Method for detecting nucleotide mutant site | |
| CN110923314A (en) | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof | |
| WO2012099397A2 (en) | Method for determining the single nucleotide polymorphism of target genes using a real-time polymerase chain reaction, and kit for determining the single nucleotide polymorphism of target genes using same | |
| CN113174438B (en) | ALDH2 gene polymorphism detection kit and detection method | |
| CN111235252A (en) | Method for distinguishing individual medication of nitrendipine by mass spectrometry through detecting product | |
| CN111549120B (en) | ALDH2 gene G1510A locus typing method without nucleic acid amplification, probe and reaction system used by same | |
| CN107400722B (en) | Competitive real-time fluorescent PCR SNP probe for detecting human genome | |
| CN112322726A (en) | Kit for detecting copy number variation of OTC (over-the-counter) gene | |
| CN111172268A (en) | Method for distinguishing individual drug administration of verapamil by detecting product and performing mass spectrometry | |
| CN111172266A (en) | Kit for detecting drug-using guide gene of antihypertensive drug verapamil | |
| CN111187815A (en) | Method for distinguishing individual administration of losartan by detecting product and performing mass spectrometry | |
| CN111549121B (en) | Isothermal nucleic acid amplification-free MTHFR gene C677T locus typing method, reaction probe and detection system used by same | |
| CN112695097B (en) | CYP2D6 x 10 genetic polymorphism detection kit for distinguishing CYP2D7P and CYP2D8P | |
| CN113265460B (en) | Primer for detecting SLC26A4 point mutation of deafness gene and application thereof | |
| Al-Turkmani et al. | Molecular assessment of human diseases in the clinical laboratory | |
| CN117230179A (en) | Primer group, kit and detection method for detecting SNP (single nucleotide polymorphism) combination of deafness-related genes and application of primer group and kit | |
| CN117025803A (en) | Method for detecting rifampicin resistance genotype of mycobacterium tuberculosis and detection product | |
| CN114686583A (en) | Detection method and kit for RFC gene 80GA mutation site and use method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1143610 Country of ref document: HK |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1143610 Country of ref document: HK |
|
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20100922 Assignee: Shenzhen Huada clinical inspection center Co., Ltd. Assignor: BGI-Shenzhen Co., Ltd. Contract record no.: 2014440020113 Denomination of invention: Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene Granted publication date: 20130918 License type: Exclusive License Record date: 20140414 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model | ||
| ASS | Succession or assignment of patent right |
Owner name: SHENZHEN BGI CORPORATION Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD. Effective date: 20150803 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20150803 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Patentee after: BGI SHENZHEN CO LTD Address before: 11, 8 floor, Beishan Industrial Zone, Yantian District, Guangdong, Shenzhen 518000, China Patentee before: BGI-Shenzhen Co., Ltd. |