CN117025803A - Method for detecting rifampicin resistance genotype of mycobacterium tuberculosis and detection product - Google Patents

Abstract

The invention discloses a method for detecting the rifampicin resistance genotype of mycobacterium tuberculosis and a detection product. The invention provides a set of primers, comprising a specific PCR amplification primer group, a single base extension primer group 1 and a single base extension primer group 2; the invention combines the technologies of PCR amplification, single base extension reaction, mass spectrum detection and the like into a whole, can amplify the detection template by the PCR technology and detect trace samples by the mass spectrum technology, combines the advantages of the two technologies, and is far superior to a method for detecting the drug-resistant genotype by singly using the PCR, so that the detection sensitivity is very high.

Description

Method for detecting rifampicin resistance genotype of mycobacterium tuberculosis and detection product

Technical Field

The invention belongs to the technical field of medical molecular biological diagnosis, and relates to a method for detecting a rifampicin resistance genotype of mycobacterium tuberculosis and a detection product.

Background

Tuberculosis is one of the biggest infectious disease killers worldwide, especially in developing countries. According to the estimated of the global tuberculosis report of 2022, the number of new tuberculosis patients in the world is 1060 ten thousand in 2021, and the number of new tuberculosis patients is increased by 4.5% compared with 2020. In addition, 160 ten thousand people worldwide die from tuberculosis, and the number of tuberculosis deaths is increased compared with 2020. The estimated number of new tuberculosis patients in China 2021 is 78.0 ten thousand, the estimated number of tuberculosis patients in 30 tuberculosis high-burden countries is 3, and the estimated number of tuberculosis patients accounts for 7.4% of the total number of global tuberculosis patients and is lower than that of India and Indonesia. Tuberculosis drug resistance is one of the main problems facing clinic at present, the rifampicin drug resistance tuberculosis (RR-TB) in 2021 new patients is 45 ten thousand cases, and the drug resistance tuberculosis burden is increased by 3 percent. Rifampicin is the most effective first-line antitubercular drug for tuberculosis, RR-TB is difficult to treat, and a chemotherapy scheme is composed by combining more antitubercular drugs, especially second-line antitubercular drugs, and the treatment course is longer. It follows that tuberculosis remains a serious public health problem and that rapid detection of rifampicin resistance is critical for effective treatment of tuberculosis.

At present, a traditional clinical Mycobacterium Tuberculosis (MTB) rifampin phenotype drug sensitivity test method is based on bacterial culture, bacteria are generally cultured on a solid or liquid culture medium, and drug sensitivity tests are further carried out after bacterial strains are identified as MTB after bacterial growth, so that 1-2 months are generally required, the time is tedious and time is wasted, and early diagnosis and effective chemotherapy of tuberculosis are seriously delayed, so that drug-resistant tuberculosis is spread.

With the development of molecular biology technology and the partial elucidation of the mechanism of MTB on partial first and second line antitubercular drug resistant molecules, as current research has demonstrated that MTB rifampicin resistance is related to the mutation of the beta subunit coding gene rpoB of RNA polymerase, 90% -96% of the mutations occur on a 81bp fragment of the 507-533 codons of rpoB (which are rifampicin resistance determining regions, RRDR), most common mutation sites are 531 and 526 amino acid codons, and most of the mutations exhibit high level drug resistance; whereas mutations at codons 511, 513-516 and 521, 522, 529, 533 generally lead to medium and low levels of resistance; the amino acid substitutions at positions 507-509, 517, 523, 532 may be unrelated to MTB rifampicin resistance. The drug resistance condition of a patient can be known by detecting the mutation part and mutation property of the gene of the drug resistance related locus, a series of methods for rapidly detecting the MTB drug resistance genotype are established at present, the molecular drug sensitivity test methods are established on the basis of gene amplification, MTB drug resistance gene mutation can be rapidly (2-48 h) and sensitively detected from MTB isolated strains or pretreated clinical specimens, but the molecular drug sensitivity test methods which are clinically applied at present have advantages and disadvantages, such as a reverse hybridization method and a gene chip method, can know the common mutation locus and property of the drug resistance gene, but the hybridization and detection process is complicated and time-consuming, usually takes 1-2 days, and the open detection can pollute amplified products to cause false drug resistance report; the real-time fluorescent quantitative PCR and the probe melting curve method both adopt closed-tube detection, so that cross pollution or laboratory pollution is avoided, the detection process is simple, convenient and quick, only 2-3 hours are needed, but only the detection process can know whether the drug resistance gene has mutation or not, specific mutation sites and mutation types are not reported, and false positives are caused because some mutation of the gene sites are possibly irrelevant to drug resistance; the drug-resistant gene sequencing method is a gold standard of a molecular drug sensitivity test, but is not developed in a clinical laboratory at present, and only a gene sequencing company is used as a sequencing service.

The matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS for short) technology is a mass spectrometry technology established and rapidly developed at the end of the 80 th century, and is a novel soft ionization biological mass spectrum. The basic principle is that after the sample is combined with the chip matrix to form crystals, the sample is dispersed in the matrix in a single molecule state. After drying, exciting the sample in a mass spectrometer by high-energy laser, and desorbing the sample; the charge transfer between the matrix and the sample is carried out to ionize sample molecules, the ionized sample flies through a vacuum flight tube under the action of an electric field, the sample is detected according to different flight times reaching a detector, namely, the ions are analyzed in proportion to the flight time of the ions through the mass-charge ratio (M/Z) of the ions, the molecular weight of the sample molecules is measured, and then the genotype information of the analyte is obtained. According to the principle, ions with different masses can be separated according to mass-to-charge ratio, and the molecular mass and purity of biological macromolecules such as polypeptide, protein, nucleic acid, polysaccharide and the like can be accurately detected, so that the method has the advantages of high accuracy, high flexibility, large flux, short detection period and high cost performance.

Methods for detecting MTB rifampicin resistant genes by mass spectrometry are reported. Among them, the Chinese patent "method and kit for detecting drug-resistant gene mutant form of mycobacterium Tuberculosis (TB)" (application No. 201110448201.4) discloses primer design, experimental process and detection method for mutation detection of KatG, inhA regulation, inhA, kasA, rpoB, rrs, rpsL, embB and gyrA genes, but the detected MTB rifampicin drug-resistant gene rpoB has less mutation sites and mutation types, and only involves 4 codon sites (531, 526, 516 and 513 codon sites) and 6 mutation genotypes (Ser 531Leu, his526Tyr, his526Asn, his526Asp, asp516Val and Asp516 Gly) and affects the detection sensitivity. The Chinese patent 'nucleic acid fingerprint characteristic library of mycobacterium tuberculosis rpoB gene and application thereof' (application number 201210196931.4) discloses that the application of the nucleic acid fingerprint characteristic library to detect the MTB rpoB gene, the digestion of shrimp alkaline phosphatase (shrimp alkaline phosphatase, SAP) is carried out, the enzyme digestion reaction is carried out on the product, the nucleic acid fingerprint characteristic of various MTB obtained after the detection by a mass spectrometer is summarized and arranged through computer software, and the nucleic acid fingerprint characteristic library of the MTB rpoB gene RRDR is obtained. And comparing the mass spectrum peak diagram generated by the experiment with a database to detect whether the MTB rpoB gene RRDR is mutated or not and mutant type, thereby judging the drug resistance of MT to rifampicin. The method adopts transcription and nuclease digestion steps, is tedious and time-consuming, and has high technical requirements for staff. The Chinese patent 'tubercle bacillus drug-resistant gene locus, primer group and detection method based on Massarray nucleic acid mass spectrum platform' (application number 202210106388.8) discloses that amplification primers which cover rpoB, inhA, katG, eis, rrs, gyrB and gyrA mutation loci and application mass spectrum method are designed to detect drug-resistant genes, the mutation loci and mutation types of MTB rifampicin drug-resistant genes rpoB detected by the method are more, 8 codon loci (482, 513, 516, 522, 526, 531, 533 and 572) and 30 mutation genotypes are involved, but the method designs PCR amplification primers and extension primers aiming at each locus of each gene, is tedious and time-consuming, increases the working difficulty, is easy to make mistakes and has higher popularization difficulty.

In summary, the current method for detecting MTB drug-resistant genotype by mass spectrometry needs further research and improvement to meet the requirements of a simple, rapid, sensitive and specific detection method in clinic, and provides experimental basis for clinicians to reasonably formulate treatment schemes.

Disclosure of Invention

The invention aims to provide a method for detecting the rifampicin resistance genotype of mycobacterium tuberculosis and a detection product.

In a first aspect, the present invention provides a kit of primers comprising a specific PCR amplification primer set, a single base extension primer set 1 and a single base extension primer set 2;

the specific PCR amplification primer group consists of primers shown by nucleotides 11 to 29 (SEQ ID NO:1, 11 to 29 are PCR primer core sequences) with SEQ ID NO:2, 11 to 30 are PCR primer core sequences;

the single base extension primer group 1 consists of primers shown in SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 14 and 3 rd to 18 th nucleotides with SEQ ID NO. 16;

the single-base extension primer group 2 consists of primers shown in SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 9, SEQ ID NO. 13, SEQ ID NO. 15 and SEQ ID NO. 17.

In the set of primers, a protecting base is added to the tail end of each primer in the specific PCR amplification primer set;

each primer in the specific PCR amplification primer group is formed by adding a protective base at the tail end of the corresponding primer; specifically, a protecting base sequence of 5-15 bases is added to the 5' -end, preferably 10bp tag ACGTTGGATG is added.

The PCR amplification primer amplifiable region of the specific PCR amplification primer set is a DNA sequence containing a mutation site. The amplification primer has 15 or more bases at the 3' end, which are completely matched with the target gene sequence; to avoid interfering with the detection effect by the PCR primers entering the mass spectrometer detection window, a number of bases, typically, for example, 10bp tag (ACGTTGGATG), are added to the 5' end to increase the molecular weight of the PCR primers beyond the mass spectrometer detection window.

Adding a joint sequence at the tail end of each primer in the single-base extension primer group; further, the linker sequence is preferably 1 to 15 bases, more preferably 1 to 3 bases.

In the set of primers described above, in one embodiment,

the specific PCR amplification primer group consists of a primer shown in SEQ ID NO. 1 and a primer shown in SEQ ID NO. 2;

The single base extension primer group 1 consists of primers shown in SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 14 and SEQ ID NO. 16.

The single-base extension primer group 2 consists of primers shown in SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 9, SEQ ID NO. 13, SEQ ID NO. 15 and SEQ ID NO. 17.

In a second aspect, the present invention provides a PCR reagent comprising the specific PCR amplification primer set of the first aspect, a PCR reagent comprising the single base extension primer set 1 of the first aspect, and a PCR reagent comprising the single base extension primer set 2 of the first aspect.

In a third aspect, the present invention provides the use of a primer set according to the first aspect or a PCR reagent according to the second aspect for the preparation of a product having any one of the following functions;

1) Detecting a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

2) Detecting the genotype of a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

3) Identification or assisted identification of resistance of MTB to rifampicin.

In the above application, the product is a kit.

In a fourth aspect, the present invention provides a kit comprising the primer set of the first aspect or the PCR reagent of the second aspect.

The kit described above also includes alkaline phosphatase and reagents or instrumentation required for mass spectrometry detection.

The mutation site and the corresponding genotype of the rifampicin resistant gene rpoB in the MTB are respectively as follows:

the 511 th codon of the rpoB coding protein of the rifampicin resistant gene, the genotype of the site before and after mutation is CTG→CCG；

The 513 th codon of the rifampicin resistant gene rpoB coded protein, the genotype of the site before and after mutation isCAA→AAA orGAA；

Rifampicin drug-resistant gene rpoB coding protein 513 th codon, and genotype of the site before and after mutation is CAA→CCA；

The 513 th codon of the rifampicin resistance gene rpoB coded protein, the genotype of the site before and after mutation is CAA→CAT；

The 516 th codon of the rifampicin resistant gene rpoB coded protein, the genotype of the site before and after mutation isGAC→TAC；

Rifampicin drug-resistant gene rpoB coding protein 516 th codon, and genotypes of the sites before and after mutation are GAC→GTC or GGC；

RifampicinThe 516 th codon of the protein encoded by the drug-resistant gene rpoB, and the genotype of the site before and after mutation is GAC→GAG；

The 526 th codon of the rpoB coding protein of the rifampicin resistant gene, the genotypes of the 526 th codon before and after mutation are thatCAC→GAC orTAC orAAC；

The 526 th codon of the rpoB coded protein of the rifampicin resistant gene, the genotype of the site before and after mutation is C AC→CTC or CGC；

The 526 th codon of the rpoB coding protein of the rifampicin resistant gene, the genotype of the site before and after mutation is CAC→CAA；

Rifampicin drug-resistant gene rpoB coding protein 531 th codon, and genotype of the site before and after mutation is TCG→TTG or TGG；

Rifampicin drug-resistant gene rpoB coding protein 531 th codon, and genotype of the position before and after mutation is TCG→TCC

The 533 th codon of the rpoB coded protein of the rifampicin resistant gene, the genotype of the site before and after mutation is CTG→CCG。

The mutation site is the position of a mutation amino acid codon in rpoB gene encoding protein;

the above genotypes are represented by amino acid codons of the mutation site, and underlined nucleotides are mutant nucleotides; the wild genotype is in front of the arrow, and the mutant genotype is behind the arrow.

The kit described above further comprises a readable carrier describing a method for detecting the rifampicin resistance genotype of mycobacterium tuberculosis as follows:

the detection method comprises the following steps:

(1) Extracting genome DNA of a sample to be detected;

(2) Taking genomic DNA of the sample to be detected as a template, carrying out PCR amplification by using the specific PCR amplification primer set in the first aspect, wherein the amplification is divided into 2 systems, namely TB-W1 and TB-W2, respectively, so as to obtain a TB-W1PCR amplification product and a TB-W2PCR amplification product;

(3) Respectively digesting the TB-W1PCR amplification product and the TB-W2PCR amplification product by alkaline phosphatase to obtain a TB-W1 digestion product and a TB-W2 digestion product;

(4) Performing multiplex single-base extension on the TB-W1 digestion product and the TB-W2 digestion product by using the single-base extension primer group 1 and the single-base extension primer group 2 respectively to obtain a TB-W1 extension product and a TB-W2 extension product; a single base extension primer set 1 was used for the TB-W1 digestion product pair, and a single base extension primer set 2 was used for the TB-W2 digestion product pair.

(5) Purifying the TB-W1 extension product and the TB-W2 extension product by using resin to obtain a TB-W1 purified product and a TB-W2 purified product;

(6) And detecting the purified TB-W1 product and the purified TB-W2 product by a mass spectrometer to obtain the mutation site and genotype of the MTB rifampicin resistance gene rpoB.

The above detection is specifically performed by spotting onto a substrate of a microarray chip, respectively, and placing into a Massary array nucleic acid mass spectrometry System (MassARRAY Analyzer System).

The readable carrier may be a read carrier capable of recording a detection method, such as a manual or a CD.

In one embodiment, the kit specifically includes the following:

(1) A PCR amplification reagent comprising: reaction solution I (dNTPs, tris-HCl, mgCL2,), enzyme I (amplifying enzyme, UNG enzyme) and specific PCR amplification primer group;

(2) Digestion with SAP enzyme: comprising the following steps: reaction solution II (Tris-HCl, mgCL 2) and enzyme II (SAP enzyme);

(3) A reagent for single base extension reaction, comprising: reaction solution III (ddNTPs, tris-HCl, mgCL 2), enzyme III (elongase) and single-base extension primer set 1 or 2.

In a specific embodiment, the kit may further comprise:

(4) A purification resin;

(5) Sample application, mass spectrum detection chip and other reagents.

In another specific embodiment, the reagents for PCR product purification: alkaline phosphatase, or alkaline phosphatase and exoenzyme ExoI, or electrophoresis gel recovery reagents, or PCR product purification columns. Wherein the PCR primer used need not include a protecting base when including the purification reagents of alkaline phosphatase and exoenzyme ExoI.

In a fifth aspect, the invention provides the use of a kit according to the fourth aspect for the preparation of a product having any one of the following functions;

1) Detecting a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

2) Detecting the genotype of a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

3) Identification or assisted identification of resistance of MTB to rifampicin.

In a sixth aspect, the present invention provides a method for detecting the genotype of the mutation site of the rpoB gene of MTB rifampicin resistance, comprising the steps of:

(1) Extracting genome DNA of a sample to be detected;

(2) Taking genomic DNA of the sample to be detected as a template, carrying out PCR amplification by using the specific PCR amplification primer set in the first aspect, wherein the amplification is divided into 2 systems, namely TB-W1 and TB-W2, respectively, so as to obtain a TB-W1PCR amplification product and a TB-W2PCR amplification product;

(3) Respectively digesting the TB-W1PCR amplification product and the TB-W2PCR amplification product by alkaline phosphatase to obtain a TB-W1 digestion product and a TB-W2 digestion product;

(4) Respectively carrying out multiple single base extension on the TB-W1 digestion product and the TB-W2 digestion product by using the single base extension primer group 1 and the single base extension primer group 2 to obtain a TB-W1 extension product and a TB-W2 extension product;

(5) Purifying the TB-W1 extension product and the TB-W2 extension product by using resin to obtain a TB-W1 purified product and a TB-W2 purified product;

(6) And detecting the purified TB-W1 product and the purified TB-W2 product by a mass spectrometer to obtain the mutation site and genotype of the MTB rifampicin resistance gene rpoB.

The above detection by a mass spectrometer is specifically performed by spotting the purified product obtained in (5) onto a substrate of a microarray chip, and placing the substrate into a Massarray nucleic acid mass spectrometry System (MassARRAY Analyzer System).

In the above, when the sample to be tested is the extracted DNA, the step (1) is omitted directly from the step (2).

The procedure used for PCR amplification in step (2) was: pre-denaturation at 50 ℃ for 2min; pre-denaturation at 95℃for 2min; 40-50 cycles of denaturation at 95℃for 30sec, annealing at 56℃for 30sec, and extension at 72℃for 30sec; extending at 72℃for 5min.

In step (3), alkaline phosphatase digestion, specifically SAP digestion, is performed by the following procedure: 30min at 37 ℃;65 ℃ for 5min.

The single base extension reaction in step (4) uses the following procedure: pre-denaturation at 94 ℃ for 30sec; 40-50 cycles of 94℃denaturation for 5sec,56℃annealing for 5sec and 80℃extension for 5sec for 5 cycles; extending at 72℃for 3min.

In one embodiment, the purification process of step (5) may be selected from alkaline phosphatase digestion, alkaline phosphatase and exonuclease ExoI digestion, gel cutting purification, PCR purification column chromatography, and the like. In a specific embodiment, the high temperature enzyme inactivation treatment is performed after purification using alkaline phosphatase digestion, or alkaline phosphatase and exoenzyme ExoI digestion.

One of the principles of the present invention is: the invention provides a technology combining PCR amplification, single base extension reaction and mass spectrum detection, a method for detecting the drug resistance genotype of MTB rifampicin rpoB gene and a detection product. Designing 1 a PCR primer to amplify a DNA fragment product containing a specific target sequence aiming at MTB rifampicin drug-resistant hot spot site; in single base extension, the digestion product of the PCR is subjected to multiple single base extensions, and the extension primer extends one nucleotide at the corresponding site, such that the extended nucleotide is complementarily paired with the genotype at the site. Single base extension results in a cocktail consisting of extension primer and extension product. Detecting the purified mixture to be detected by MALDI-TOF MS, determining the molecular weight of each substance in the mixture to be detected by a mass spectrum peak, comparing the molecular weight with the pre-calculated theoretical molecular weight of each extension primer and extension product, and determining the genotype of the sample to be detected in the extension product, thereby determining whether the sample is sensitive or resistant to rifampicin.

The second principle of the invention is that in order to solve the mutual interference of multiple extension products and eliminate unsuitable sites to be detected, the invention performs optimized screening, thereby determining optimized extension primer combination.

In the third principle of the invention, in the process of further optimizing the PCR system, in order to ensure that the molecular weights of the extension primer and the extension product are distributed in an ideal mass spectrum detection window as much as possible, the tag sequence which does not influence PCR amplification is introduced into the amplification primer, so that the final extension product falls into the detection window and is distinguished at the same time, the superposition of the molecular weights is avoided, and the detection accuracy and the sensitivity are improved.

Experiments prove that the primer and the method have the following technical effects:

1. sensitivity: the invention combines the technologies of PCR amplification, single base extension reaction, mass spectrum detection and the like into a whole, can amplify the detection template by the PCR technology and detect trace samples by the mass spectrum technology, combines the advantages of the two technologies, and is far superior to a method for detecting the drug-resistant genotype by singly using the PCR, so that the detection sensitivity is very high.

2. Specific: single base extension is also called as 'micro sequencing', uses a specific single base extension primer to identify DNA molecules, and has the characteristics of high accuracy, good specificity, low false positive and the like of a sequencing technology; in particular, unlike sequencing techniques that extend hundreds of bases, the technique extends only a single base with a lower probability of error;

3. Simple and safe: the operation is simple and safe, the automation degree is high, and the pollution is prevented;

4. and (3) quick: high speed and high flux, and can complete detection of hundreds of samples in 5-6 hours.

5. The invention can detect a plurality of individuals to be detected to respectively obtain detection results with different gene loci, wherein the detected person can be a single locus or a plurality of loci. This means that the subject may carry one or more genetic mutations.

6. The invention overcomes the defect of too few gene loci detected once in the prior art, and has low cost.

Principles and definitions of the present invention:

the invention provides a method for distinguishing MTB rifampicin resistant genotype by combining PCR amplification, single base extension, mass spectrum detection and other technologies and a detection product. The principle is as follows: in the PCR step, the DNA fragment of the MTB rifampicin resistant gene mutation hot spot site can be amplified by designing and using specific primers. In the single base extension step, the PCR product after the previous digestion is subjected to multiple single base extension. Wherein, 15 extension primers are divided into 2 systems to carry out single base extension, and the extension primers respectively correspond to 6 drug-resistant gene loci in 2 reaction systems, and extend a nucleotide at the corresponding specific locus, wherein the nucleotide is complementarily paired with the genotype at the specific locus (for example, the genotype A at a certain gene locus is obtained, and T nucleotide is extended on the corresponding extension primer). In the single base extension step, ddNTPs are used instead of dNTPs, so extension of the primer will terminate extension after one base extension. In the mass spectrometry detection process, the single base extension product is purified, then spotted on the matrix of the microarray chip, and excited by laser in a vacuum environment, and passes through a flight tube to a detector. The time for the different substances to pass through the flight tube is inversely related to their molecular weight, i.e. the greater the molecular weight, the slower the flight speed and the later the time to reach the detector.

The detection of the rifampicin resistance genotype of the mycobacterium tuberculosis disclosed by the invention comprises the judgment of MTB mutation sites and rifampicin resistance. For example, clinical samples or MTB isolates are analyzed to determine whether or not the MTB rpoB gene RRDR is mutated or mutated, and thus determine whether MTB is sensitive or resistant to rifampicin, thereby helping clinicians to rationally formulate patients' chemotherapy regimens.

The invention designs PCR primer aiming at common drug-resistant mutation section of mycobacterium tuberculosis rpoB gene, and amplified fragment of the primer comprises mycobacterium tuberculosis rifampicin resistance determining region (RRDR, 81 bp). Most of the gene mutations of rifampicin resistant strains are concentrated in a region consisting of 27 amino acids (81 bp) at 507-533, and 96% of rifampicin resistant strains are caused by the sequence (511, 513, 516, 526, 531 and 533 allelic points) mutation.

The current technical route for detecting rifampicin resistance is to carry out mutation detection and determination on amplified products on the basis of amplifying rpoB gene mutation concentrated regions by using a PCR method, and the existing methods include a direct sequencing method, a polymerase chain reaction-single-strand conformation polymorphism analysis method (PCR-SSCP), a dideoxy fingerprint method, a reverse series probe hybridization method (LiPA), a gene chip method, a probe melting curve method and the like. The mass spectrometry technology is used for detecting the rifampicin drug resistance, is a new technical means, and has the advantages of rapidness, accuracy, high flux, low price and the like compared with the existing molecular biology detection method.

In the single base extension step, the product of the previous PCR is digested and multiplex single base extension is performed sequentially. Wherein 15 of the extension primers correspond to 8 of the reaction wells 1 and 7 of the reaction wells 2, respectively, and a nucleotide is extended at the corresponding specific site, which nucleotide is complementarily paired with the genotype at the specific site (e.g., genotype A at a specific site, T nucleotide will be extended on the corresponding extension primer). In the single base extension step, ddNTPs are used instead of dNTPs, so extension of the primer will terminate extension after one base extension.

In the mass spectrometry detection process, the single base extension product is purified, then spotted on the matrix of the microarray chip, and excited by laser in a vacuum environment, and passes through a flight tube to a detector. The time for the different substances to pass through the flight tube is inversely related to their molecular weight, i.e. the greater the molecular weight, the slower the flight speed and the later the time to reach the detector.

The term "protected base" refers to an additional base added to the 5' end of a PCR primer. The molecular weight of the PCR primer is increased due to the sequence of the protective base, so that the residual PCR primer in the reaction can be prevented from entering a mass spectrum detection window, and the interference of the detection effect can be avoided. In addition, the 5' end of the extension primer can be added with a proper amount of base sequence, but the extension primer does not act like the protecting base of the PCR primer to enable the protecting base to exceed the detection window, and the molecular weight of the extension primer is properly regulated to enable the extension primer and the product thereof to be in a reasonable position in the detection window. For example, when the molecular weights of the extension primer and the product corresponding to two gene loci are close, the base is added to one extension primer, the molecular weight of the primer and the product is changed, and the gap between the molecular weights of the other extension primers and the product is increased, so that interference and indistinguishability caused by excessive concentration of mass spectrum peaks in local areas are avoided, and the detection effect is improved. Therefore, the molecular weight of the extended primer and the product after the increase of the base is not necessarily beyond the detection window. The additional bases of the extended primer described above may be referred to as primer adaptors.

The term alkaline phosphatase digestion is used for degrading residual dNTPs in a PCR reaction system, and the principle is that the 5'-P end of the dNTPs is converted into the 5' -0H end, so that the capability of combining with a primer to extend the primer is lost, and the influence on the next single base extension is avoided.

The term "single base extension", also known as micro sequencing (mini sequence), refers to the addition of an extension primer and ddNTPs to the system, the ddNTPs being ligated to the 3' end of the extension primer to form an extension product (i.e., the primer is extended by one base), the specific ddNTPs being ligated according to the base complementary pairing rules, the process being similar to the PCR process in that dNTPs are added one by one to the PCR primer according to the base composition of the complementary strand. The "ddNTP" is called single base extension because, unlike a general dNTP, one ddNTP is ligated at a specific site and cannot be extended continuously downward as in PCR. Single base extension is very similar to the sequencing process, a mixture of dNTPs and ddNTPs is added into a sequencing system, the extension is continued after the sequencing primer is connected with the dNTPs, and the extension is terminated only after the ddNTPs are connected, so that the sequencing generates a mixture of nucleotide fragments with different lengths; only ddNTPs are added to a single base extension system, and the extension primer can only ligate one ddNTP and terminate extension, so that single base extension results in a nucleotide fragment of the extension primer that extends only one base.

The term "detection product" refers to any conventional product for detecting the genotype of a drug-resistant gene locus, including: detection reagents, detection chips (such as microarray chips, gene chips, liquid chips, etc.), detection carriers, detection kits, etc.

The term "ddNTP" is a special nucleotide, four types of the technical scheme are adopted, and molecular weight differences exist between the ddNTP and the special nucleotide, for example, the molecular weight of ddATP, ddCTP, ddGTP, ddTTP is 271.2Da, 247.2Da, 287.2Da and 327.1Da respectively (wherein ddTTP is the molecular weight after modification). When the extension primer extends different nucleotides depending on the genotype of a specific site, a molecular weight difference will be formed. This difference can be resolved by mass spectrometry detection. For example, if a particular site is mutated for a→t, the corresponding extension primer will be 17 bases (molecular weight 5257.4 Da) long, if no mutation is present at that site, the extension primer will extend one T nucleotide and terminate extension, forming an extension product of 18 bases long and molecular weight 5584.5Da, if a mutation is present at that site, the extension primer will extend one a nucleotide and terminate extension, forming an extension product of 18 bases long and molecular weight 5528.6Da, with a molecular weight difference of 55.9Da between the two products. That is, for this site, if this 5257.4Da extension primer is used, the A genotype would correspond to the 5584.5Da mass spectrum peak without mutation and the T genotype would correspond to the 5528.6Da mass spectrum peak with mutation.

The term "purification" refers to a treatment step used to reduce the effect of other substances in the system under test on subsequent reactions. The PCR product purification of the present invention has two modes: firstly, separating impurities and discarding the impurities, and secondly, inactivating the impurities. Wherein, the gel cutting purification, the purification column passing through and the like are all to separate impurities through electrophoresis and the purification column, and to recover relatively pure PCR products, which can be considered as a first purification mode, the mode is generally time-consuming, the operation is complex, and particularly when the sample size is large; alkaline phosphatase acts to degrade (also known as "digest") dNTPs, making them unable to continue to participate in PCR or single base extension reactions as substrates for DNA polymerase or single base extension enzymes, so as not to interfere with subsequent reactions, and can be considered a second purification mode. It should be noted that exoenzyme ExoI alone does not perform a purification function, and when it is used in combination with alkaline phosphatase, it functions to degrade single-stranded DNA (mainly the remaining PCR primers in the PCR product system after completion of the reaction) into dntps in advance, and then the dntps are degraded further by alkaline phosphatase. Since the PCR primers are degraded and do not enter the final mass spectrometry step, if ExoI exonuclease treatment is added in the intended purification step, then the use of PCR primers with protected bases is not required. In addition, since both the exonuclease and the alkaline phosphatase are inactivated by high temperature before the single base extension step, they do not degrade the single-stranded extension primer, ddNTP, etc. added in the single base extension step, and thus, influence on subsequent experiments is avoided.

The term "detection window" refers to a range of molecular weights of nucleotides that can be detected by mass spectrometry, and generally relates to the design reference range of primers. When the extension primer is designed, according to the sequence characteristics of DNA regions of the sites and the genotypes of the specific sites, the extension primer and the extension product with different molecular weights can be designed for different specific sites, so that interference between different extension primers and products due to the approach of the molecular weights is avoided, and the detection of a plurality of specific sites can be realized in a relatively wide detection window, such as 4000-9000 Da.

Drawings

FIG. 1 shows the results of detection of the 513 site of HB126 sample, wherein the four dotted lines from left to right are theoretical peaks of extension primer, wild-type (C) extension product, mutant (A) extension product, and mutant (G) extension product, respectively.

FIG. 2 shows the results of detection at position 513 of samples 99 to 103, wherein the four dotted lines from left to right are theoretical peaks of the extension primer, the wild-type (C) extension product, the mutant (A) extension product, and the mutant (G) extension product, respectively.

FIG. 3 shows the results of detection of the position 516 of the HB191 sample, wherein the four dotted lines from left to right are theoretical peaks of the extension primer, the mutant (G) extension product, the mutant (T) extension product, and the wild type (A) extension product, respectively.

FIG. 4 shows the results of the detection of the 526 site of the CH15 sample, wherein the five dotted lines from left to right are theoretical peaks of the extension primer, the wild-type (C) extension product, the mutant (A) extension product, the mutant (G) extension product, and the mutant (T) extension product, respectively.

FIG. 5 shows the results of the detection of the 526 site of the CH19 sample, wherein the four dotted lines from left to right are theoretical peaks of the extension primer, the mutant (G) extension product, the mutant (T) extension product, and the wild type (A) extension product, respectively.

FIG. 6 shows the results of detection of the position 531 of HB1601 sample, wherein the four dotted lines from left to right are theoretical peaks of extension primer, wild type (C) extension product, mutant (G) extension product, mutant (T) extension product, respectively.

FIG. 7 shows the results of detection of the position 531 of HB361 sample, wherein the four dotted lines from left to right are theoretical peaks of extension primer, wild-type (C) extension product, mutant (G) extension product, and mutant (T) extension product, respectively.

FIG. 8 shows the detection results of the 533-locus of the CH28 sample, wherein the three dotted lines from left to right are theoretical peaks of the extension primer, the wild-type (T) extension product, and the mutant (C) extension product, respectively.

FIG. 9 shows the results of detection at positions 511 and 516 of sample HB307, wherein the three dotted lines from left to right at position 511 are the theoretical peaks of the extension primer, mutant (C) extension product, and wild type (T) extension product, respectively; the three dashed lines from left to right at 516 are theoretical peaks of extension primer, wild-type (G) extension product, mutant (T) extension product, respectively.

FIG. 10 shows the results of detection of the first and second bases at position 526 of a CH22 sample, wherein the five dotted lines from left to right in the detection of the first base at position 526 are theoretical peaks of the extension primer, the wild-type (C) extension product, the mutant (A) extension product, the mutant (G) extension product, and the mutant (T) extension product, respectively; the four dotted lines from left to right in the second base detection at position 526 are theoretical peaks of the extension primer, mutant (G) extension product, mutant (T) extension product, and wild type (A) extension product, respectively.

FIG. 11 shows the result of mass spectrometry of the 513 locus of the primer TB-W2-2-UEP detecting strain HB 191.

FIG. 12 shows the mass spectrum of the 513 locus of the primer TB-W2-2-UEP detecting strain HB 361.

FIG. 13 shows the mass spectrum results of 513 locus of the primer TB-W2-2-UEP detection strain H37 Rv.

FIG. 14 shows the mass spectrum of the 513 locus of the detection strain HB191 of the primer TB-W2-2-UEP 1.

FIG. 15 shows the mass spectrum of the 513 locus of the detection strain HB361 of the primer TB-W2-2-UEP 1.

FIG. 16 shows the mass spectrum results of 513 locus of the primer TB-W2-2-UEP1 detection strain H37 Rv.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1 primer design and method set-up for detection of rifampicin resistant genotype in Mycobacterium tuberculosis

1. Primer design for detecting rifampicin resistant genotype of mycobacterium tuberculosis

The rpoB gene (CP 019613.1, filing date: 2018.07.03) mutation of MTB rifampicin resistant strain is mostly concentrated in rifampicin RRDR composed of 27 amino acids (corresponding to 81bp core sequence) at 507-533, more than 90% of rifampicin resistant strain is caused by mutation of the sequence (511, 513, 516, 526, 531 and 533 alleles).

The MTB rifampicin rpoB gene mutation sites are 6 sites, the sites are concentrated in 81bp core sequences shown in 85 th-165 th positions of SEQ ID NO. 18, and the mutation sites and the corresponding 19 mutation types (genotype before and after mutation) are respectively: 511-bit codon CTG→CCG. 513 codonCAA→AAA/GAA. Codon C of 513 bitsAA→CCA. 513 bit codon CAA→CATCodon 516 bitGAC→TAC. Codon G of 516 bitAC→GTC/GGC. 516 bit codon GAC→GAGCodon 526CAC→GAC/TAC/AAC. 526 bit codon CAC→CTC/CGC. 526 bit codon CAC→CAA531-bit codon TCG→TTG/TGG. 531-bit codon TCG→TCCAnd codon C of amino acid 533TG→CCG, wherein codons 511, 513, 516, 526, 531 and 533 are mutation sites, i.e The nucleotide underlined at the position of the amino acid of the protein encoded by the rpoB gene is a mutant nucleotide, the genotype in front of the arrow indicates the wild type, the genotype in back of the arrow indicates the mutant type, and the genotype is indicated by the codon of the mutation site.

1 pair of specific PCR primer sequences (SEQ ID No:1 to SEQ ID No: 2) and single base extension primer sequences (SEQ ID No:3 to SEQ ID No: 17) were designed according to the region in which these mutation sites were located. The primer sequences are shown in Table 1, and the molecular weights of the amplified products are shown in Table 2.

Table 1 shows primer sequences

/>

Note that: the inner number in the amino acid position of column 3 or the number in front of the bar in the table indicates the amino acid position of the mutation site, and the number in the rear of the bar in the bracket indicates the base mutation of the codon after mutation;

in column 4, the wild genotype is in front of the arrow and the mutant genotype is in back of the arrow.

Wherein the molecular weights of the extension primers and extension products corresponding to the respective sites are shown in Table 2.

Table 2 shows the molecular weights of the extension primers and extension products

/>

The PCR amplification primer amplifiable region is a DNA sequence that includes a mutation site. The amplification primer has 15 or more bases at the 3' end, which are completely matched with the target gene sequence; to avoid interfering with the detection effect by the PCR primers entering the mass spectrometer detection window, a number of bases, typically, for example, 10bp tag (ACGTTGGATG), are added to the 5' end to increase the molecular weight of the PCR primers beyond the mass spectrometer detection window. The related primers were synthesized by Shanghai JieRui bioengineering Co.Ltd.

2. Establishment of detection method for detecting rifampicin resistance genotype of mycobacterium tuberculosis

1. Sample DNA extraction

Genomic DNA of the sample is extracted.

If the sample is MTB strain, after inactivation, the sample is treated by lysozyme and proteinase K, then DNA is extracted by phenol and DNA extraction reagent according to the requirements of the specification, and the DNA is preserved at-20 ℃ for standby.

2. Configuration of PCR primer and System

1) Preparing primers:

after centrifuging a primer tube synthesized by a company, slowly opening a tube cover, adding a proper amount of ultrapure water according to the molecular weight and the OD value of the primer to prepare a solution with a certain concentration, covering the tube cover, and fully oscillating, uniformly mixing and centrifuging. Adding proper amount of prepared primers and ultrapure water according to the following tables 3 and 4 to prepare a 2-tube primer mixed solution, namely a TB-W1 primer and a TB-W2 primer, covering a tube cover, fully oscillating up and down, uniformly mixing and centrifuging for later use.

Table 3 shows TB-W1 primer

TB-W1	Primer sequence number	100uM PCR primer uptake (μL)
			TB-1-rpoB-F(100uM)	SEQ ID NO:1	2
TB-1-rpoB-R(100uM)	SEQ ID NO:2	2
			The total amount of the above primers		4
Ultrapure water		96
			Total amount of working fluid		100

Table 4 shows TB-W2 primer

2) Preparation of PCR reaction system

PCR reaction systems were formulated as in tables 5 and 6:

preparing 200 mu L of PCR reaction tubes according to the number of samples to be detected in a PCR liquid preparation area, and marking sample numbers on the tubes;

Taking out the TB-W1 primer, the TB-W2 primer and the PCR reaction liquid shown in the table 3 and the table 4 respectively, naturally thawing the materials at room temperature, and centrifuging after vortex oscillation to fully mix the materials;

according to the number of samples, the reaction mixture was prepared in the proportions shown in Table 5 and Table 6, placed in a centrifuge tube, mixed well, and dispensed into 0.2. Mu.L of PCR amplification tubes by adding 4. Mu.L of the reaction system shown in Table 5 or Table 6, from which the DNA template was removed, per PCR reaction tube. Due to factors such as pipette tip residue during dispensing, insufficient parts may be dispensed, suggesting proper amplification of the dispensed volume of the mixture. For example, less than 10 samples to be tested, the mixture may be formulated in 10% more samples; above 10 samples to be tested, the mixture may be formulated in 20% more samples.

Table 5 shows the preparation of TB-W1 PCR amplification reaction system

Reagent component	Sample volume/serving (μL)
		Reaction liquid I (Beijing Yixinbo-CHUANG biotechnology Co., ltd.)	2.8
Enzyme I (Beijing and Yi Xinbo-created biotechnology Co., ltd.)	0.2
		TB-W1 primer	1.0
DNA template	1.0
		Total volume of	5.0

Table 6 shows the preparation of TB-W2 PCR amplification reaction system

Reagent component	Sample volume/serving (μL)
		Reaction solution I	2.8
Enzyme I	0.2
		TB-W2 primer	1.0
DNA template	1.0
		Total volume of	5.0

To each tube of the mixture was added 1. Mu.L of a sample to be tested (DNA template) in the PCR amplification zone, so that the total volume of each PCR reaction system was 5. Mu.L.

3) PCR reaction thermal cycling program

The PCR reaction tube was placed in a Bo-Japanese TC-96PCR amplification apparatus, and PCR amplification was performed according to the procedure shown in Table 7.

Table 7 shows the PCR amplification reaction procedure

PCR amplification was performed as described above to obtain a TB-W1 PCR amplification product and a TB-W2 PCR amplification product.

3. SAP enzyme digestion

1) Preparation of SAP enzyme digestion reaction system

According to the number of samples, the SAP enzyme digestion reaction mixture was prepared according to the ratio shown in table 8, placed in a centrifuge tube, mixed well, added with 2 μl of the mixture per PCR reaction tube, and packed into 0.2 μl PCR amplification tubes. For example, less than 10 samples to be tested, the mixture may be formulated in 10% more samples; above 10 samples to be tested, the mixture may be formulated in 20% more samples.

Table 8 shows SAP enzyme digestion reaction mixtures

Reagent component	Sample volume/serving (μL)
		Reaction solution II	1.5
Enzyme II	0.5
		Total volume of	2

2) SAP enzyme digestion reaction procedure

2. Mu.L of the SAP enzyme digestion reaction mixture shown in Table 8 was added to each of the PCR reaction tubes obtained in the above 2, which contained the TB-W1 PCR amplification product and the TB-W2 PCR amplification product, respectively, and the PCR reaction tubes were then placed in a Bori TC-96PCR amplification apparatus, and the procedure of Table 9 below was performed to obtain a TB-W1SAP enzyme digestion product and a TB-W2SAP enzyme digestion product.

Table 9 shows the SAP enzyme digestion procedure

Temperature (. Degree. C.)	Time (min)
		37	30
65	5
		12	Preservation of

4. Configuration and reaction of single base extension primer

1) Preparation of single base extension primer

Single-base extension primer mixtures, designated as TB-W1-U4 primer mixtures and TB-W2-U3 primer mixtures, were prepared as shown in tables 10 and 11 below.

Table 10 shows TB-W1-U4 mixture

TB-W1(100uM-200uM)	Primer sequence number	Mother liquor preparation (mu L)
			TB-W1-1-UEP	SEQ ID NO:4	2
TB-W1-2-UEP	SEQ ID NO:7	2
			TB-W1-3-UEP	SEQ ID NO:8	2
TB-W1-4-UEP	SEQ ID NO:10	2
			TB-W1-5-UEP	SEQ ID NO:11	2
TB-W1-6-UEP	SEQ ID NO:12	2
			TB-W2-4-UEP2	SEQ ID NO:14	2
TB-W1-14-UEP1	SEQ ID NO:16	2
			The total amount of the above primers		16
Ultrapure water		24
			Total amount of working fluid		40

Table 11 shows TB-W2-U3 mixture

TB-W2(100uM-200uM)	Primer sequence number	Mother liquor preparation (mu L)
			TB-W2-1-UEP	SEQ ID NO:3	2
TB-W2-2-UEP1	SEQ ID NO:5	2
			TB-W2-2-UEP2	SEQ ID NO:6	2
TB-W2-3-UEP	SEQ ID NO:9	2
			TB-W2-4-UEP	SEQ ID NO:13	2
TB-W2-5-UEP	SEQ ID NO:15	2
			TB-W2-6-UEP	SEQ ID NO:17	2
The total amount of the above primers		14
			Ultrapure water		26
Total amount of working fluid		40

2) Single base extension primer reaction system

According to the number of samples, a single base extension reaction mixture was prepared in the proportions shown in Table 12 and Table 13, placed in a centrifuge tube, mixed well, and dispensed into 0.2. Mu.L PCR amplification tubes by adding 2. Mu.L of the mixture per PCR reaction tube. For example, less than 10 samples to be tested, the mixture may be formulated in 10% more samples; above 10 samples to be tested, the mixture may be formulated in 20% more samples.

Table 12 preparation of TB-W1 extension reaction System

Reagent component	Sample volume/serving (μL)
		Reaction solution III	0.83
Enzyme III	0.23
		Extension primer TB-W1-U4	0.94
Total volume of	2

Table 13 shows the formulation of TB-W2 extension reaction system

Reagent component	Sample volume/serving (μL)
		Reaction solution III	0.83
Enzyme III	0.23
		Extension primer TB-W2-U3	0.94
Total volume of	2

Extension reaction procedure: and 2 mu LTB-W1 extension reaction system and TB-W2 extension reaction system are correspondingly added into each PCR reaction tube containing the TB-W1SAP enzyme digestion product and the TB-W2SAP enzyme digestion product obtained in the step 3, then the PCR reaction tubes are placed in a Bori TC-96PCR amplification instrument, and the following table 14 procedure is carried out to obtain a TB-W1 extension reaction product and a TB-W2 extension reaction product.

Table 14 shows the extension reaction procedure

5. Purification and spotting

After the extension reaction is completed, 41 mu L of ultrapure water and 15mg of resin (supplied by Beijing brand new boyan biotechnology Co., ltd.) are added into each PCR tube extension product in a product analysis area, the mixture is inverted and evenly mixed for 5min, and the mixture is centrifuged at 5000rpm for 1min, and the supernatant is the TB-W1 purified product and the TB-W2 purified product. The purified TB-W1 and TB-W2 products were spotted onto a microarray chip (supplied by Biotechnology Co., ltd.) at 0.5ul each.

6. On-machine detection and result interpretation

The spotted chip was tested and judged as a result using a MassARRAY nucleic acid mass spectrometry System (MassARRAY Analyzer 4 System).

The 15 extension primers and their 19 mutation types at 6 sites have different molecular weights according to the respective genotypes of the extension products, which correspond to the respective mass spectrum peaks as shown in the above Table 2. If a mass spectrum peak appears at a certain molecular weight, it is judged that a substance (an extension primer or a product) corresponding to the molecular weight exists, and the genotype of the corresponding rpoB mutation site is determined according to the corresponding extension primer, so that whether the strain is sensitive or resistant to rifampicin is determined.

Judgment standard:

(1) If the mass spectrum peaks corresponding to the wild type and the mutant type are not appeared, judging that the experiment fails no matter whether the mass spectrum peaks corresponding to the extension primer exist or not;

(2) If only one mass spectrum peak corresponding to the wild type or the mutant type appears, judging that the genotype corresponding to the appeared mass spectrum peak is the wild type or the mutant type;

(3) If the mass spectrum peak average corresponding to the wild type or the mutant type appears, the hybrid type is judged to be the hybrid type, and the heterogeneous drug resistance is indicated.

Example 2 use for detecting the rifampicin resistant genotype of Mycobacterium tuberculosis

MTB clinical isolate 121 (which has been identified as Mycobacterium tuberculosis and tested for rifampicin resistance.) of which rifampicin sensitive strain 68, rifampicin resistant strain 53.

The MTB clinical isolate is identified by morphological characteristics: the clinical separated strain of the mycobacterium tuberculosis is slender, straight or slightly bent, has rounded two ends, is arranged singly or in a branched shape, has no flagellum and no spore.

Drug resistance detection: the absolute concentration method of the Roche culture medium is partially a rifampicin sensitive strain and partially a rifampicin drug-resistant strain.

1. Detection of

The genotype of rpoB gene of each strain was examined in accordance with the method of example 1 II.

In MTB clinical isolate 121, detecting sensitive strain 68 by a Roche medium absolute concentration method, detecting 66 strain sensitivity and 2 strain 533 (533 CTG- & gtCCG 2 strain) drug resistance by the method; the absolute concentration method of the Roche medium is used for detecting 53 strains of drug-resistant strains, and the method provided by the invention is used for detecting 6 strains of sensitivity and 47 strains of drug resistance. Wherein 531 th 26 strains (531 th TCG- & gtTTG 24 strain, 531 th TCG- & gtTGG 1 strain, 531 th TCG-TCC 1 strain); 526 th strain 9 (526 th CAC→TAC 6 strain, 526 th CAC→CGC 2 strain, 526 th CAC→CTC 1 strain); 516 strain 4 (516 strain GAC. Fwdarw.TAC3, 516 strain GAC. Fwdarw.GTC1); 533 strain 2 (533 CTG→CCG2 strain); 513 strain 1 (513 strain CAA→AAA 1); mixed mutant 5 strain (516 GAC→TAC and 533 CTG→CCG1 strain, 511 CTG→CCG and 516 GAC→GGC1 strain, 511 CTG→CCG and 526 CAC→TAC 1 strain, 526 CAC→AAC and 526 CAC→CGC2 strain).

The absolute concentration method of the Roche medium is used for detecting the drug resistance of the clinical isolate as a standard, the sensitivity of the detection method is 88.68%, the specificity is 97.06%, the positive predictive value is 95.92%, the negative predictive value is 91.67%, and the accuracy is 93.39%.

The mass spectra of the exemplified strains HB126, 99-103, HB191, CH15, CH19, HB1601, HB361, CH28, HB307 and CH22 are shown in FIGS. 1-10 and Table 15, and it can be seen that the genotype detection at each site can be achieved in the exemplified samples. The method comprises the following steps:

FIG. 1 shows the result of mass spectrometry detection of the 513 site of a HB126 sample, which shows that the sample is wild type (C), i.e., wild type CAA at the 513 site;

FIG. 2 shows the mass spectrum detection result of 513 sites of 99-103 samples, and the detection result shows that the samples are mutant (A), namely the 513 site CAA-AAA mutation;

FIG. 3 shows the result of mass spectrometry detection of the 516 locus of the HB191 sample, which shows that the sample is a mutant (T) extension product, namely, the 516 locus GAC→GTC mutation;

FIG. 4 shows the result of mass spectrometry detection of the 526 site of a CH15 sample, which shows that the sample is a mutant (T) extension product, namely 526-CAC→TAC mutation;

FIG. 5 shows the result of mass spectrometry detection of the 526 site of a CH19 sample, which shows that the sample is a mutant (G) extension product, namely the 526 site CAC→CGC mutation;

FIG. 6 shows the mass spectrum detection result of the 531 sites of HB1601 samples, and the detection result shows that the samples are mutant (T) extension products, namely 531-position TCG-TTG mutation;

FIG. 7 shows the mass spectrum detection result of the 531 site of HB361 sample, and the detection result shows that the sample is a mutant (G) extension product, namely 531-bit TCG- & gtTGG mutation;

FIG. 8 shows the result of mass spectrometry detection of the 533 th site of a CH28 sample, which shows that the sample is a mutant (C) extension product, i.e., a 533 th CTG- & gtCCG mutation;

FIG. 9 shows the results of mass spectrometry detection of positions 511 and 516 of sample HB307, wherein the detection of position 511 shows that the sample is a mutant (C) extension product, i.e. the CTG- & gtCCG mutation at position 511; the 516 site detection result shows that the sample is a mutant (T) extension product, namely, the 516-site GAC-TAC mutation.

FIG. 10 shows the results of mass spectrometry detection of the first and second bases at 526 site of a CH22 sample, wherein the first base at 526 site shows that the sample is mutant (A), i.e., the 526-CAC→AAC mutation; the second base detection result at 526 site shows that the sample is mutant (G), namely 526 site CAC- & gtCGC mutation; the 526 CAC→AAC mutation and the 526 CAC→CGC mutation are combined into 526 CAC→AGC.

Table 15 shows the mutant bases of the mutant sites of the sample

In the above table, the bolded bases are the mutation bases of the mutation sites.

2. Sequencing assay

To verify the accuracy of the results of the method of the invention, sequencing verified the rpoB resistant genotype of part of strain rpoB of MTB clinical isolate 121.

Genomic DNA of MTB clinical isolate 121 was extracted, and part of the strain was amplified using the primers shown in Table 16 below to obtain PCR amplified products, which were sent to sequencing.

Table 16 shows sequencing primers

Gene	Primer 1 (5 '. Fwdarw.3')	Primer 2 (5 '. Fwdarw.3')
			rpoB	GGTGGTCGCCGCGATCAAG	CGAGCCGATCAGACCGATGT

The PCR amplification reaction system was 50. Mu.L.

50. Mu.L of a PCR reaction system was prepared as shown in Table 17 below

Table 17 shows the amplification system

Reagent component	Sample application volume
		DNA template	<1ug
Primer I (10 uM)	2μL
		Primer 2 (10 uM)	2μL
2xMaster Mix	25μL
		Ultrapure water	To 50 mu L

PCR reaction conditions: the reaction was performed on a Bo-TCA-96 PCR amplification apparatus under conditions of 94℃for 3min,94℃for 30sec,55℃for 30sec,72℃for 60sec, and 30 cycles, and 72℃for 5min after the completion of the reaction.

The PCR amplified product was sent to Beijing division, a division of biological engineering (Shanghai) Co., ltd, and sequenced with primer 2.

The above partial strains were selected for DNA sequencing according to the results of the detection method of the present invention in example 2. At least 5 strains were sequenced for each locus strain greater than 5 strains, less than all of the 5 strains were sequenced. Except for 3 strains of the method of the invention, the results are single point mutations, respectively: 526 CAC→CGC, 516 GAC→TAC and 531 TCG-TCC, and the sequencing results are double-site mutation, respectively: 526 CAC→CGC and 510 CAG→CAC, 516 GAC→TAC and 518 AAC→CAC, 531 TCG→TAC (531 TCG→TCC and 531, TCG→TAG mutation combination). Because the 3 site mutations, CAG→CAC, 518 AAC→CAC and 531 TCG-TAG, are unusual, the invention does not design an extension primer for detecting the 510, 518 and 531 sites, and therefore cannot be detected. The rest sequencing results are consistent with the detection results of the method. The method for detecting the MTB rifampicin resistant genotype and the detection product can be used for clinical detection, provide experimental basis for clinical doctor to reasonably formulate a chemotherapy scheme and guide clinical medication.

The sequencing results of rpoB resistant genotypes of the MTB isolates HB126, 99-103, HB191, CH15, CH19, HB1601, HB361, CH28, HB307 and CH22 are completely consistent with Table 15 by comparison, and the detection method and the sequencing result of the invention are proved to have higher consistency.

Comparative example, example Single base extension primer optimization

1. Single base extension primer design

The primers shown in Table 1 were obtained by the inventors through a number of optimizations, for example, the optimization procedure for the TB-W2-2-UEP1 primer shown in SEQ ID NO. 5:

primer TB-W2-2-UEP was designed for rpoB (513-2): GTTGTTCTGGTCCATGAAT, rpoB (513-2), CAA→CCA

2. Detection of rifampicin resistant genotypes of Mycobacterium tuberculosis

The rifampicin resistant genotypes of MTB strains HB191, HB361, H37Rv were tested using the method of example 1 II, wherein the extension primer TB-W1-U3 in the single base extension system TB-W1 consisted of TB-W1-1-UEP, TB-W1-2-UEP, TB-W1-3-UEP, TB-W1-4-UEP, TB-W1-5-UEP, and TB-W1-6-UEP, and the extension primer TB-W2-U3 in TB-W2 consisted of TB-W2-1-UEP, TB-W2-2-UEP, TB-W2-3-UEP, TB-W2-4-UEP, TB-W2-5-UEP, and TB-W2-6-UEP.

The spotted chip was tested and judged as a result using a MassARRAY nucleic acid mass spectrometry System (MassARRAY Analyzer 4 System).

The results are shown in Table 18 and FIGS. 11-13, and it can be seen that all mass spectra have a mutation at position 513, indicating that this extension primer is unsuitable and requires replacement.

Table 18 shows the results

Sequence number	Strain numbering	Sequencing results	Mass spectrometry results
				1	HB191	516，GAC→GTC	513，CAA→CCA，516，GAC→GTC
2	HB361	531，TCG→TGG	513，CAA→CCA，531，TCG→TGG
				3	H37Rv	Sensitivity to	513，CAA→CCA

3. Redesign of the experimental primer TB-W2-2-UEP1 (SEQ ID NO: 5)

SEQ ID NO:5：CCAGCCAGCTGAGCC，rpoB(513-2)，CAA→CCA

Using the procedure described above for two, experiments were performed using the extension primer TB-W2-2-UEP1 in place of TB-W2-2-UEP, with the results for the 513 locus of strain shown in Table 19 and FIGS. 14-16: the sequencing result is consistent with the mass spectrum result, and the extension primer TB-W2-2-UEP1 can accurately detect the CAA-CCA mutation at the 513 position of the rpoB gene.

Table 19 shows the results

Sequence number	Strain numbering	Sequencing results	Mass spectrometry results
				1	HB191	516，GAC→GTC	516，GAC→GTC
2	HB361	531，TCG→TGG	531，TCG→TGG
				3	H37Rv	Sensitivity to	Sensitivity to

Claims (9)

1. The complete set of primers comprises a specific PCR amplification primer group, a single-base extension primer group 1 and a single-base extension primer group 2;

the specific PCR amplification primer group consists of primers shown as 11 th to 29 th nucleotides with SEQ ID NO. 1 and primers shown as 11 th to 30 th nucleotides with SEQ ID NO. 2;

the single base extension primer group 1 consists of primers shown in SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 14 and 3 rd to 18 th nucleotides with SEQ ID NO. 16;

The single-base extension primer group 2 consists of primers shown in SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 9, SEQ ID NO. 13, SEQ ID NO. 15 and SEQ ID NO. 17.

2. The set of primers of claim 1, wherein: the tail end of each primer in the specific PCR amplification primer group is added with a protective base;

and adding a joint sequence at the tail end of each primer in the single-base extension primer group.

3. The set of primers according to claim 1 or 2, wherein:

the specific PCR amplification primer group consists of a primer shown in SEQ ID NO. 1 and a primer shown in SEQ ID NO. 2;

the single base extension primer group 1 consists of primers shown in SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 14 and SEQ ID NO. 16.

A PCR reagent comprising the specific PCR amplification primer set of any one of claims 1 to 3, a PCR reagent comprising the single base extension primer set 1 of any one of claims 1 to 3, and a PCR reagent comprising the single base extension primer set 2 of any one of claims 1 to 3.

5. Use of the set of primers of any one of claims 1 to 3 or the PCR reagents of claim 4 for the preparation of a product having any one of the following functions;

1) Detecting a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

2) Detecting the genotype of a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

3) Identification or assisted identification of resistance of MTB to rifampicin.

6. A kit comprising the set of primers of any one of claims 1 to 3 or the PCR reagent of claim 4.

7. The kit of claim 6, wherein:

the kit also comprises alkaline phosphatase and reagents or instruments required for mass spectrometry detection.

8. Use of a kit according to claim 6 or 7 for the preparation of a product having any one of the following functions;

1) Detecting a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

2) Detecting the genotype of a mutation site of a rifampicin drug-resistant gene rpoB in MTB;

3) Identification or assisted identification of resistance of MTB to rifampicin.

9. A method for detecting the genotype of a mutation site of the rpoB gene of rifampicin resistance of MTB, comprising the steps of:

(1) Extracting genome DNA of a sample to be detected;

(2) Using the genome DNA of the sample to be detected as a template, carrying out PCR amplification by using the specific PCR amplification primer set in claim 1, wherein the amplification is divided into 2 systems, namely TB-W1 and TB-W2, respectively, to obtain a TB-W1PCR amplification product and a TB-W2PCR amplification product;

(3) Respectively digesting the TB-W1PCR amplification product and the TB-W2PCR amplification product by alkaline phosphatase to obtain a TB-W1 digestion product and a TB-W2 digestion product;

(4) Multiplex single base extension is carried out on the TB-W1 digestion product and the TB-W2 digestion product by using the single base extension primer group 1 and the single base extension primer group 2 in the claim 1 respectively to obtain a TB-W1 extension product and a TB-W2 extension product;

(5) Purifying the TB-W1 extension product and the TB-W2 extension product by using resin to obtain a TB-W1 purified product and a TB-W2 purified product;

(6) Detecting the purified TB-W1 product and the purified TB-W2 product by a mass spectrometer to obtain the genotype of the mutation site of the MTB rifampicin resistant gene rpoB.