WO2022033407A1 - Product for detecting dna/rna by using nucleic acid mass spectrometry and detection method - Google Patents

Abstract

Provided is a multiplex one-step PCR reagent that is used for nucleic acid mass spectrometry and can simultaneously detect DNA/RNA. The one-step PCR reagent is a One-Step RT-PCR Kit, the enzymes in the reagent being a two-enzyme system. The two-enzyme system comprises an M-MLV reverse transcriptase, which is selected from a murine leukemia virus source and the RNaseH activity of which has been eliminated, and a thermostable Taq DNA polymerase, which is specific and effectively reduces non-specific amplification caused by primer mismatch. Also provided is a detection product the protects said one-step PCR reagent and a detection use. The present invention can achieve a multiples DNA detection effect in existing nucleic acid mass spectrometry. Meanwhile, RNA reverse transcription and PCR are combined into one step for synchronous amplification, thereby reducing the operation steps, and reducing reagent costs.

Description

Products and detection methods for DNA/RNA detection by nucleic acid mass spectrometry technical field

The invention belongs to the technical field of biological diagnosis, and in particular relates to a product and a detection method for detecting DNA/RNA by nucleic acid mass spectrometry.

Background technique

Matrix-assisted laser desorption ionization (MALDI) detection method has the advantages of fast, accurate, high sensitivity, low sample consumption, high chemical specificity (can directly analyze complex biological samples or reaction mixtures) and other advantages, so it is widely used in proteins and peptides Research in the field of bioanalysis occupies an increasingly important position in the field of bioanalysis.

Nucleic acid mass spectrometry detection technology occupies a place in the field of molecular diagnosis due to its advantages such as a large number of single-reaction detection targets, a single detection sample throughput, accurate detection, and low cost. This technology has a wide range of applications in DNA nucleic acid detection, such as SNP typing detection, gene mutation, pathogen detection, DNA methylation, gene copy number variation, etc. Before the inventors used the mass spectrometry platform to detect the novel coronavirus (RNA virus), there was no report that the mass spectrometry platform was applied to RNA detection, let alone multiple RNA detection, let alone the simultaneous detection of multiple DNA/RNA using the mass spectrometry platform . This is mainly because the RNA content is too low relative to DNA, which is easy to be degraded by repeated freezing and thawing. The existence of RNase in the environment also has a great influence on the detection of RNA, which requires higher technical level of operators, and RNA needs to be reverse transcribed into cDNA can be further used as a template for PCR amplification and subsequent experiments, which increases the operation steps and further increases the risk of contamination.

With the in-depth study of one-step PCR technology, reverse transcription of RNA into cDNA and PCR amplification using cDNA as a template were combined into one step, and were quickly applied to the fluorescence quantitative platform, but mainly for 1-4 multiple RNA detection, not yet Multiplex RNA detection has been performed, and multiple DNA/RNA co-detection has not been performed. The first reason may be limited by the number of fluorescence quantitative channels, and the second may be the difficulty of developing multiplex one-step PCR reagents. The third possibility is that there is no suitable application platform for multiple detection.

Nucleic acid mass spectrometry detection platform is a very suitable multiple nucleic acid detection platform. One-step PCR technology combined with nucleic acid mass spectrometry platform makes multiple RNA detection possible. One-step PCR technology for multiplex RNA detection, in addition to a suitable multiplex detection platform, the most important thing is to find a multiplex one-step PCR reagent suitable for the platform, so as to achieve efficient RNA inversion and multiplex PCR amplification. At present, there is no suitable multiplex one-step PCR reagent for the nucleic acid mass spectrometry platform, so the inventors have invested a lot of time and energy in reagent screening, and finally successfully screened out a nucleic acid mass spectrometry platform that can simultaneously detect The multiplex one-step PCR reagent for DNA/RNA can realize multiplex DNA-/RNA simultaneous detection without reducing the detection sensitivity.

SUMMARY OF THE INVENTION

The first principle of the present invention is: considering that the nucleic acid properties of species mainly include DNA and RNA, if nucleic acids of both properties can be detected at the same time, and the limitation of single-plex detection can be broken, the detection cost will be greatly reduced and the detection efficiency will be improved. . To this end, it is creatively proposed to use conventional one-step PCR amplification reagents that cannot be used for nucleic acid mass spectrometry amplification to obtain a one-step PCR amplification reagent suitable for nucleic acid mass spectrometry to simultaneously detect DNA/RNA after screening and optimization.

The second principle of the present invention is as follows: the multiple one-step PCR amplification reagents that are suitable for nucleic acid mass spectrometry and can simultaneously detect DNA/RNA are prepared directly or matched with SAP reagents and single base extension reagents to make mass spectrometry DNA/RNA detection. This product can achieve the effect of multiple DNA detection by existing nucleic acid mass spectrometry. At the same time, RNA reverse transcription and PCR amplification are synchronized, which reduces the operation steps, and because the two steps are combined into one, the reagent cost is reduced.

The third principle of the present invention is: on the basis of the above research, a nucleic acid mass spectrometry detection method and a detection system for simultaneously detecting multiple DNA/RNA are developed. Compared with the existing nucleic acid mass spectrometry detection methods and systems, the method and system have Innovative advantages for simultaneous detection of multiplex DNA/RNA.

The fourth principle of the present invention is that: in order to reduce the detection time of nucleic acid mass spectrometry, a one-step PCR detection method for DNA/RNA without nucleic acid extraction (including purification steps) is creatively proposed for nucleic acid mass spectrometry detection.

Therefore, the first object of the present invention is to provide a multiple one-step PCR reagent One-Step RT-PCR Kit that can be applied to nucleic acid mass spectrometry and can detect DNA/RNA at the same time, wherein the one-step PCR reagent One-Step RT-PCR Kit The enzymes in the kit include a two-enzyme system (that is, RNA reverse transcription and PCR amplification reactions are catalyzed by reverse transcriptase and DNA polymerase, respectively).

In one embodiment, the two-enzyme system is selected from the group consisting of M-MLV reverse transcriptase derived from murine leukemia virus that eliminates RNaseH activity, and a thermostable that is specific and effective in reducing non-specific amplification caused by primer mismatches Taq DNA polymerase.

In a specific embodiment, the PCR reaction reagents matched with the dual-enzyme system include buffer, dNTPs, wherein the buffer includes Mg ²⁺ , PCR stabilizer and enhancer. In a more specific embodiment, the enhancer comprises 200 mM Tris-HCl (pH 8.4), 500 mM KCl.

In a specific embodiment, the dNTPs comprise dATP, dCTP, dGTP, dTTP in the same molar ratio. In a more specific embodiment, the dNTPs include: 200uM dATP, 200uM dCTP, 200uM dGTP, 200uM dTTP.

The second object of the present invention is to provide the use of a multiplex one-step PCR reagent for detecting DNA/RNA by nucleic acid mass spectrometry, wherein the multiplex one-step PCR reagent includes One-Step RT-PCR Kit, wherein the one-step PCR reagent One-Step RT -Enzymes in PCR Kit include two-enzyme system (that is, RNA reverse transcription and PCR amplification reactions are catalyzed by reverse transcriptase and DNA polymerase, respectively) and single-enzyme systems (that is, RNA reverse transcription and PCR amplification reactions are the same catalyzed by an enzyme).

The third object of the present invention is to provide a DNA/RNA nucleic acid mass spectrometry detection product, including the above-mentioned multiplex one-step PCR reagent, a reagent for single-base extension reaction, and a matrix reagent for mass spectrometry, wherein the one-step PCR reagent One-Step The enzymes in RT-PCR Kit include two-enzyme system (that is, RNA reverse transcription and PCR amplification reactions are catalyzed by reverse transcriptase and DNA polymerase, respectively) and single-enzyme systems (that is, RNA reverse transcription and PCR amplification reactions are catalyzed by catalyzed by the same enzyme).

In one embodiment, the two-enzyme system is selected from the group consisting of M-MLV reverse transcriptase derived from murine leukemia virus that eliminates RNaseH activity, and a thermostable that is specific and effective in reducing non-specific amplification caused by primer mismatches Taq DNA polymerase.

In a specific embodiment, the PCR reaction reagents matched with the dual-enzyme system include buffer, dNTPs, wherein the buffer includes Mg ²⁺ , PCR stabilizer and enhancer. In a more specific embodiment, the enhancer comprises 200 mM Tris-HCl (pH 8.4), 500 mM KCl.

In a specific embodiment, the dNTPs comprise dATP, dCTP, dGTP, dTTP in the same molar ratio. In a more specific embodiment, the dNTPs include: 200uM dATP, 200uM dCTP, 200uM dGTP, 200uM dTTP.

In one embodiment, the detection product is a detection product for the detection of respiratory pathogens, which includes reaction reagents for one-step PCR for inversion and PCR amplification and reagents for single-base extension reactions, for mass spectrometry The matrix reagent, wherein the one-step PCR reaction reagent includes any one of the above-mentioned one-step PCR reaction reagents.

In any of the above embodiments, the detection product further includes a reagent for purifying the PCR amplification product.

In any of the above embodiments, the nucleic acid is a nucleic acid extracted and purified from a sample, or a nucleic acid free of extraction and purification, so that the sample is mixed with the reaction reagent and then directly subjected to PCR amplification. In a specific embodiment, the nucleic acid is DNA or RNA. In a more specific embodiment, when the nucleic acid is DNA/RNA or RNA, the PCR reaction reagent is any of the PCR reaction reagents described above.

In any of the above-mentioned embodiments, the detection product further includes: specific PCR primers, and reagents for PCR product purification. In a preferred embodiment, the detection product further includes reagents for single-base extension reaction, including: extension primer, high-temperature-resistant single-base extension enzyme, ddNTPs, extension reaction buffer.

In a specific embodiment, the detection product may further include: negative quality control product, positive quality control product, resin for purification, target for spotting and mass spectrometry detection and other reagents.

In another specific embodiment, reagents for purification of PCR products: alkaline phosphatase, or alkaline phosphatase and exonuclease ExoI, or electrophoretic gel recovery reagents, or PCR product purification columns. Wherein, when the purification reagents of alkaline phosphatase and exonuclease ExoI are included, the PCR primers used need not include protective bases.

In any of the above-mentioned embodiments, the detection product includes a detection reagent, a detection matrix and/or a detection chip, and an analysis software used independently, and a detection reagent, a detection matrix and/or a detection chip, and an analysis software are included. test kit.

The fourth object of the present invention is to provide a multiplex DNA/RNA nucleic acid mass spectrometry detection method, comprising:

(1) Prepare the sample to be tested;

(2) One-step PCR reaction: the sample is subjected to one-step PCR reaction to obtain a PCR product containing the amplified target region;

(3) PCR product purification: the PCR product obtained in step (2) is purified to reduce interference to subsequent reactions;

(4) Single-base extension: using specific extension primers, in a reaction system, single-base extension is performed on the purified PCR product obtained in step (3);

(5) purification of the extension product: the extension product obtained in step (4) is purified to obtain a high-purity extension product and to avoid the influence of impurities such as salt ions on subsequent detection;

(6) Mass spectrometer detection: spot the purified product obtained in step (5) on a target sheet containing a matrix, put it into a mass spectrometer for detection, and obtain nucleic acid spectra of extension products at different SNP sites;

(7) The nucleic acid spectrum of the obtained extension products of different SNP sites is compared with the standard spectrum and analyzed by the supporting software of the mass spectrometer, and the bases of the SNP sites are confirmed, so as to determine the genotype of the sample.

In one embodiment, when the sample to be tested is extracted and purified DNA/RNA, step (1) directly adds the sample to be tested into the one-step PCR reaction reagent.

In another embodiment, when the sample to be tested is a sample such as throat swab virus preservation solution, nasal swab virus preservation solution, etc., in step (1), the sample to be tested is added to a commercial sample treatment agent, and the sample is pretreated , without purification.

In a specific embodiment, when the sample to be tested is a sample such as throat swab virus preservation solution, nasal swab virus preservation solution, etc., step (1) uses a lightning nucleic acid release agent (Beijing Baoying Tonghui Biotechnology) for the sample to be tested Co., Ltd., product number: BT0066) for pretreatment, using the principle that the difference in salt ion concentration inside and outside the cell can cause the cell membrane to burst to lyse cells and release nucleic acids without purification. In a more specific embodiment, use Lightning Nucleic Acid Release Agent (Beijing Baoying Tonghui Biotechnology Co., Ltd., product number: BT0066) for blood sample pretreatment according to the following steps: for every 20 μL of sample, add 5 μL Lightning Nucleic Acid Release Agent to a A new 200 μL Eppendorf tube, vortex to mix evenly, place the Eppendorf tube in a metal bath or a thermal-lid PCR machine and heat at 95°C for 10 minutes. Take out the Eppendorf tube and equilibrate to room temperature, centrifuge at 12,000 rpm for 2 min, and transfer the supernatant from the Eppendorf tube to a clean centrifuge tube for inspection. During PCR amplification, 1 μL of the treated supernatant can be added to each 25 μL reaction system.

In any of the above embodiments, wherein the PCR primer sequence in step (2) is a core sequence, which may include a protective base sequence at the 5' end. In a specific embodiment, wherein the protected base sequence is 5-15 bases. In a preferred embodiment, wherein the protective base sequence is selected from: ACGTTGGATG.

In any of the above embodiments, wherein the purification process of step (3) can be selected from alkaline phosphatase digestion, alkaline phosphatase and exonuclease ExoI digestion, gel cutting purification, PCR purification column passing column and the like. In a specific embodiment, wherein the high temperature enzyme inactivation treatment is performed after purification using alkaline phosphatase digestion, or alkaline phosphatase and exonuclease ExoI digestion.

In any of the above-mentioned embodiments, the 5' end of the extension primer in step (4) may have a base sequence added as a linker.

The fifth object of the present invention is to provide the use of the above multiplex one-step PCR reagent or detection product for detecting DNA/RNA, wherein the use is non-disease detection use.

In one embodiment, the use is for determining whether certain pathogens (including bacteria, viruses, rickettsia, fungi, tuberculosis) are carried from animals and plants, people, water sources, food, public places, residential or office environments Mycobacteria, etc., dead or live bacteria, etc.), in order to determine the test results of health and epidemic prevention.

In one embodiment, the use is to determine the genotyping of pathogen-carrying virtual SNP loci in human blood, sputum, oropharyngeal swabs, nasal swabs, etc., in order to provide reference for dosing regimens.

In another specific embodiment, the determination of the virtual SNP site of the pathogen is to determine that the patient is infected with Mycobacterium tuberculosis or non-tuberculous Mycobacterium, so as to screen for effective drugs.

In one embodiment, wherein the use is to determine a SNP site in an individual is to determine a drug target in a patient for screening effective drugs; or the use is to determine kinship between individuals, including but not limited to paternity testing , forensic identification or forensic identification.

technical effect

1. The present invention saves the time of RNA reverse transcription, and determines a suitable one-step PCR reagent through conventional reagent exploration, which significantly reduces the reagent cost.

2. Sensitivity: The present invention integrates one-step PCR, single-base extension, mass spectrometry detection and other technologies into one. It can not only amplify RNA in one step by one-step PCR technology, amplify the detection template, but also detect trace samples by mass spectrometry technology. detection sensitivity.

3. Simple and safe: simple operation, safety, high degree of automation, anti-pollution.

4. Fast: high speed and high throughput, can complete the detection of hundreds of samples within 5-6 hours.

5. The present invention detects 8 kinds of pathogens in the human respiratory tract. Compared with the traditional method that needs to reverse RNA alone, the detection result is fast, accurate and stable.

6. The present invention detects 8 pathogens in the human respiratory tract, from which the optimal one-step PCR reaction kit reaction system that can simultaneously detect DNA/RNA is obtained, and the detection results are fast, accurate and stable.

7. The nucleic acid mass spectrometry technology involved in the present invention has extremely strong resolution and sensitivity, the highest resolution reaches 9 Da, and is interpreted by a computer program, and the human interference factor is low. Compared with traditional PCR amplification after gel electrophoresis detection, if the electrophoresis gel bands of the respective amplified components are too poorly differentiated, the results will be difficult to distinguish.

8. The present invention fills the detection gap of nucleic acid mass spectrometry detection technology that simultaneously detects DNA/RNA by one-step PCR reagent, has independent intellectual property rights, and plays an important role in promoting and supporting the development of nucleic acid detection field in my country.

Principles and Definitions

The nucleic acid mass spectrometry detection principle of the present invention is as follows: using specific PCR primers, performing reverse transcription and PCR amplification on the DNA/RNA template to be detected, to obtain macromolecular gene fragments or PCR products containing virtual SNP sites to be detected. For the virtual SNP to be detected, it is also necessary to carry out single-base extension after the PCR product is purified, and then extend a nucleotide after extending the primer, and the nucleotide is complementary to the template (for example, the template is nucleotide A, T) will be extended on the corresponding extension primer; in the single-base extension step, ddNTP is used instead of dNTP, so after one base is extended, the extension primer will terminate the extension; during mass spectrometry detection, the single-base extension product After desalting purification, it is spotted onto a matrix-containing target and excited by a laser in a vacuum environment, passing through the flight tube to the detector. The time that different substances pass through the flight tube is negatively related to their molecular weight, that is, the higher the molecular weight, the slower the flight time and the later the time it reaches the detector.

The traditional nucleic acid mass spectrometry detection technology mainly uses the mass spectrometry platform to detect DNA, but has not detected RNA, and has not detected DNA/RNA at the same time. Nucleic acid mass spectrometry detects single-base extension products, which are obtained using PCR amplification products as templates, and PCR amplification products are obtained using single-stranded or double-stranded DNA as templates. Double-stranded DNA can be directly obtained by nucleic acid extraction. Stranded DNA is mainly obtained by reverse transcription of RNA. That is, theoretically, after RNA is reversed into single-stranded cDNA, nucleic acid mass spectrometry detection can also be performed by PCR amplification and single-base extension reaction. The invention explores and experimentally verifies the multiple nucleic acid mass spectrometry detection of RNA, and fills the blank of the mass spectrometry platform to detect RNA.

The enzyme contained in the one-step PCR reagent screened this time is a two-enzyme system. Among them, M-MLV reverse transcriptase derived from murine leukemia virus is a high temperature-resistant reverse transcriptase screened by gene mutation, which is suitable for high temperature reaction. Transcription, which is conducive to the elimination of RNA high-level structure, has high stability and strong reverse transcription synthesis ability, and has good compatibility with various PCR amplification enzymes. Thermostable Taq DNA polymerase effectively reduces non-specific amplification caused by primer mismatches. This dual-enzyme system cooperates with a unique buffer system that can improve the specificity of the reaction, and also has high sensitivity and specificity for low-concentration template amplification.

The term "protected base" refers to an additional base added to the 5' end of a PCR primer. The sequence of the protected base increases the molecular weight of the PCR primer, which can prevent the remaining PCR primer from the reaction from entering the detection window of the mass spectrometer, so as to avoid interfering with the detection effect. In addition, the 5' end of the extension primer can also increase the base sequence appropriately, but its function is not like the protection base of the PCR primer to make it exceed the detection window, but to appropriately adjust the molecular weight of the extension primer, so that the extension primer and its products are in the In a reasonable position within the detection window. For example, when the molecular weights of the extension primers and products corresponding to two gene polymorphism sites are close, by adding bases to one of the extension primers, the molecular weights of the primers and their products are changed, and the molecular weights of the other extension primers and products are drawn. A large gap can be used to avoid interference and unclear resolution due to excessive concentration of mass spectral peaks in local areas, thereby improving the detection effect. Therefore, the molecular weight of the extension primer and product after increasing the bases must not exceed the detection window. The extra bases of the extension primers described above may be referred to as primer linkers.

The term "alkaline phosphatase digestion" is used to degrade the residual dNTPs in the system after the PCR reaction. , avoiding the influence on the next single-base extension.

The term "exonuclease Exo I digestion" is used to sequentially catalyze the hydrolysis of the 3,5-phosphodiester bonds between dNTPs that make up the DNA from one end of the single-stranded DNA, so that the single-stranded DNA is finally hydrolyzed to dNTPs. In this technical scheme, it is used to degrade the remaining PCR primers after the PCR reaction. Since the exonuclease can excise the single-stranded PCR primer, it will not appear in the detection window, so when using the exonuclease, the PCR primer used does not need to include protective bases.

The term "single base extension", also known as mini sequence, refers to adding an extension primer and ddNTP to the system, and the ddNTP is connected to the 3' of the extension primer to form an extension product, that is, the primer is extended by one base. Different from common dNTPs, ddNTPs lack a hydroxyl group at the 3' position of deoxyribose and cannot form phosphodiester bonds with subsequent ddNTPs. Therefore, the extension primer can only connect one ddNTP, so it is called single-base extension. Single-base extension is very similar to the sequencing process. A mixture of dNTP and ddNTP is added to the sequencing system. After the sequencing primer is connected to dNTP, the extension will continue. Only after the ddNTP is connected, the extension can be terminated. Therefore, the sequencing produces nucleosides of different lengths. A mixture of acid fragments; only ddNTP is added to the single-base extension system, and the extension primer can only connect one ddNTP and terminate the extension. Therefore, the single-base extension reaction produces a nucleotide fragment in which the extension primer extends only one base.

The term "extension efficiency" refers to the efficiency of converting a single-base extension primer into a single-base extension product, which can be calculated by calculating the ratio of the single-base extension product SNR/(single-base extension primer SNR+single-base extension product SNR) get.

The term "ddNTP" is a special kind of nucleotide. There are four kinds of nucleotides used in this technical scheme, and there are molecular weight differences among them. ddTTP is the molecular weight after modification. Molecular weight differences are formed when the extension primers extend different nucleotides depending on the genotype of the SNP site. This difference can be resolved by mass spectrometry detection (the minimum sensitivity of mass spectrometry for detecting nucleic acids is about 9 Da). For example, if a SNP site is G/A polymorphism, the corresponding extension primer is 22 bases in length (molecular weight is 6153Da). When the SNP site is G genotype, the extension primer will extend a C nucleotide And terminate the extension to form an extension product with a length of 23 bases and a molecular weight of 6400.2Da; when the SNP site is A genotype, the extension primer will extend a T nucleotide and terminate the extension, forming a 23-base long, The extension product with a molecular weight of 6480.1 Da, there is a molecular weight difference of 80.1 Da between the two products. That is, for this SNP site, using this extension primer of 6153 Da, the G genotype will correspond to a mass spectrum peak of 6400.2 Da, and the A genotype will correspond to a mass spectrum peak of 6480.1 Da. In the actual detection process, users can observe 6153Da, 6400.2Da, and 6480.1Da through the software: if there is a mass spectrum peak at 6153Da, it means that some or all of the extension primers are not bound to ddNTP; no matter whether there is a mass spectrum at 6153Da Peak, if only one mass spectrometry peak appears at 6400.2Da and 6480.1Da, the genotype of the SNP site is homozygous and corresponds to the position of the mass spectrometry peak. As mentioned above, the mass spectrometry peak of 6400.2Da corresponds to the G gene genotype, the mass spectrum peak of 6480.1Da corresponds to the A genotype; if there are mass spectrometry peaks at both 6400.2Da and 6480.1Da, the genotype of the SNP site is heterozygous; if there is no mass spectrum at both 6400.2Da and 6480.1Da peak, the experiment failed.

The term "detection window" refers to the range of molecular weights of nucleotides that can be used for mass spectrometry detection, usually referring to the design reference range of primers. In order to avoid interference between different extension primers and products due to the proximity of molecular weights, the simultaneous detection of multiple substances can be achieved in a relatively wide detection window, such as 4000-9000 Da.

The term "SNP" genotype refers to the type of single nucleotide polymorphism in the genome of a species. Among them, in the actual inspection, the genotype used for detection as a control can come from either the genome of the species or the vector tool cloned into the plasmid, and the latter has the advantages of convenient replication and storage, stable source and easy availability. welcomed by actual users.

The term "detection products" refers to any conventional products used to detect the genotype of SNP loci, including: detection reagents, detection chips (such as gene chips, liquid chips, etc.), detection vectors, analysis and test software supporting the detection, and detection reagents box etc.

The term "One-Step RT-PCR Kit" is a multiplex one-step PCR reagent developed by Zhongke Yamei Medical Technology (Beijing) Co., Ltd., product website and product number: https://www.instrument.com.cn/list/CM1160348 /Q4939907.html, JHM0004.

Description of drawings

Figures 1 to 30: Figures of mass spectrometry results of each group of negative controls, positive controls and samples to be tested for nucleic acid mass spectrometry detection of DNA/RNA to be tested in Example 2.

Figure 31-Figure 42: Figures of mass spectrometry optimization results of the optimized one-step PCR reagent reaction system for each group of negative controls, positive controls and samples to be tested in Example 3.

Figures 43-48: Figures of mass spectrometry results of the negative control, positive control and test samples of each group of the one-step PCR reaction without nucleic acid extraction in Example 4.

detailed description

The present invention will be further described in detail below in conjunction with specific embodiments.

Example 1: Screening of one-step PCR reagents

The following table compares test reagents from different sources.

Example 2: Nucleic acid mass spectrometry detection of DNA/RNA to be tested

In this example, 10 kinds of one-step PCR reagents and multiple primer systems for detecting 8 kinds of respiratory pathogens were used to detect the same samples to be tested (2.0×10 ³ copies/mL B/Victory, 1.8×10 ³ copies/mL A H1N1 (2009), 1.2×10 ³ copies/mL of influenza A H3N2 RNA mixture of three pathogens). By comparing the detection results of different reagents, the optimal one-step PCR reagents were screened out. The negative control was water, and the positive control was the plasmid mixture for each target of 8 respiratory pathogens. Quality standards for screening the best one-step PCR reagents: no target was detected in water; 4 detection targets were detected in the RNA mixture of the 3 pathogens; the plasmid mixture was detected in the largest number; no spurious peaks in the range of 3000-10000Da in the spectrum or <2 impurity peaks.

Wherein, the information of the 8 respiratory pathogens is as follows:

site number

pathogen

detection target

Nucleic acid properties

8HXD-1	SARS-COV-2	target 1	RNA
8HXD-2	SARS-COV-2	target 2	RNA
8HXD-3	FluA	target 3	RNA
8HXD-4	FluA-H1N1 (2009)	target 4	RNA
8HXD-5	FluA-H3N2	target 5	RNA
8HXD-6	FluB	target 6	RNA
8HXD-7	RSV	target 7	RNA
8HXD-8	HADV(Type 3)	target 8	DNA
8HXD-9	Mp	target 9	DNA
8HXD-10	HuRNA	target 10	RNA
8HXD-11	HuDNA		target 11	DNA

The primer sequences of the 8 respiratory pathogens are as follows:

serial number	Sequence (5'→3')	for site	use
SEQ ID No: 1	acgttggatgccctgtgggttttacactta	8HXD-1	PCR primers
SEQ ID No: 2	acgttggatgaaaacgattgtgcatcagc	8HXD-1	PCR primers
SEQ ID No: 3	acgttggatgggaacttctcctgctagaat	8HXD-2	PCR primers
SEQ ID No: 4	acgttggatgcagacattttgctctcaag	8HXD-2	PCR primers
SEQ ID No: 5	acgttggatgacagagacttgaagatgtct	8HXD-3	PCR primers
SEQ ID No: 6	acgttggatgtcagaggtgacaggattg	8HXD-3	PCR primers
SEQ ID No: 7	acgttggatgtgggaggctggtgtttatag	8HXD-4	PCR primers
SEQ ID No: 8	acgttggatgtgctggatctggtattatc	8HXD-4	PCR primers
SEQ ID No: 9	acgttggatggtactgacaaggaccaaatc	8HXD-5	PCR primers
SEQ ID No: 10	acgttggatgggcttcttttggtagatactg	8HXD-5	PCR primers
SEQ ID No: 11	acgttggatgggtcaaattctttcccaccg	8HXD-6	PCR primers
SEQ ID No: 12	acgttggatgcgctgtttggagacacaatt	8HXD-6	PCR primers
SEQ ID No: 13	acgttggatgtcaatattgagatagaatct	8HXD-7	PCR primers
SEQ ID No: 14	acgttggatgaatttggttattacaagggc	8HXD-7	PCR primers
SEQ ID No: 15	acgttggatgactcattggaacaactgccg	8HXD-8	PCR primers
SEQ ID No: 16	acgttggatggtacgcaggtagactgtctc	8HXD-8	PCR primers
SEQ ID No: 17	acgttggatgtaccttaggacttgccattg	8HXD-9	PCR primers
SEQ ID No: 18	acgttggatgatagcgcaaacccagccttc	8HXD-9	PCR primers
SEQ ID No: 19	acgttggatggtactacactgaattcaccc	8HXD-10	PCR primers
SEQ ID No: 20	acgttggatgtccaatccaaatgcggcatc	8HXD-10	PCR primers
SEQ ID No: 21	acgttggatgcacaccattgcacattgcac	8HXD-11	PCR primers
SEQ ID No: 22	acgttggatgcaggtattcaagatacaaag	8HXD-11	PCR primers
SEQ ID No: 23	ggtatgtggaaaggttatg	8HXD-1	extension primer

SEQ ID No: 24	ttgctgctgcttgacagat	8HXD-2	extension primer
SEQ ID No: 25	caatcctgtcacctctga	8HXD-3	extension primer
SEQ ID No: 26	ccacgattgcaatacaacttg	8HXD-4	extension primer
SEQ ID No: 27	ggaccaaatcttcctgta	8HXD-5	extension primer
SEQ ID No: 28	gaaccaacagtgtaatttttc	8HXD-6	extension primer
SEQ ID No: 29	ggctccagaatataggcatgat	8HXD-7	extension primer
SEQ ID No: 30	agacttgggacagaaca	8HXD-8	extension primer
SEQ ID No: 31	cccaatgcacaagaacaaa	8HXD-9	extension primer
SEQ ID No: 32	gcctgccgtgtgaaccatgtgactt	8HXD-10	extension primer
SEQ ID No: 33	ccaggatggagccg	8HXD-11	extension primer

The molecular weights of the extension primers and extension products corresponding to each site are shown in the table below.

In one embodiment, the above-mentioned PCR primer sequence is a core sequence, which may include a protective base sequence at the 5' end, preferably 5-15 bases. In a specific embodiment, the protection base sequence is selected from the tag (acgttggatg) added in the 5' segment, for example, the PCR primer SEQ ID NO: 1 is 5'-acgttggatgccctgtgggttttacactta-3'. In another specific embodiment, the 5' end of the extension primer can also add a base sequence that serves as a linker.

The test was performed using an ABI 9700 PCR machine. The operation is carried out according to the manual, and the specific methods are as follows:

1. One-step PCR amplification

1.1 In the PCR solution area, prepare a 200μL PCR reaction tube according to the number of samples to be tested, and mark the sample number on the tube;

1.2 Take out 10 kinds of one-step PCR reagents, ddH ₂ O, from the kit, thaw them naturally, vortex to mix them well, and centrifuge them to the bottom of the tube briefly;

1.3 According to the number of samples, prepare the reagents according to the proportion of the 25ul system in the corresponding instructions of each reagent, place each in a centrifuge tube, mix well, and dispense into 200ul PCR reaction tubes;

1.4 According to the corresponding instructions of each reagent, add 6 μL of the sample to be tested to each tube of mixture in the PCR amplification area, so that the total volume of each PCR reaction system is 25 μL. Among them, the negative control is ultrapure water, and the positive control is plasmid mixture;

1.5 Put the PCR reaction tube in the PCR amplifier, and carry out the PCR amplification reaction according to the procedure recommended in the corresponding instructions of each reagent.

2.SAP Enzymatic Digestion

After the PCR reaction is over, take 5 μL of PCR products into new tubes in turn, add 2 μL of SAP enzyme mixture to each tube, then place the PCR reaction tube in the PCR amplifier, and execute the procedure in the following table.

temperature(℃)	time (min)	number of cycles
37	30	1
65	5	1

3. Single base extension

3.1 In the PCR preparation area, according to the number of samples, take out the extension primer mixture and the extension enzyme mixture according to the ratio in the table below, put them in a centrifuge tube and mix well.

component name	Single reaction volume (μL)
Extension primer mix	1
elongase mix	1
total	2

3.2 In the PCR amplification area, add 2 μL of extension mixture to each tube of PCR product for aliquoting;

3.3 Place the PCR reaction tube in the PCR amplifier, and carry out the extension reaction according to the procedure in the table below.

4. Purification

In the PCR amplification area, add 41 μL of pure water and 15 mg of resin to each extension product, invert and mix for 30 min.

5. Spotting

Using a micropipette, aspirate 0.5 μL of the purified product and spot it onto the matrix-containing target.

6. Analysis of results

The Clin-TOF time-of-flight mass spectrometer developed by the inventor was used to detect and judge the results of the spotted target pieces.

7. Testing quality standards

Miscellaneous peaks: The peaks that may not appear in this reaction system are miscellaneous peaks;

8. Test results

The single-base extension products of test groups 1-10 described in Example 1 were all spotted on the same chip, and nucleic acid mass spectrometry detection was performed. The mass spectrometry detection results are shown in the following table:

(1) Negative control: 10 kinds of one-step PCR reagents were detected in the negative control, and no pathogen target was detected;

(2) Positive control: Reagent 1, 4, 8, 9, 10 can detect 11 targets; Reagent 3, 5, 7 can detect 10 targets; Reagent 6 can detect 9 targets; Reagent 2 can detect 6 targets.

(3) Samples to be tested: none of the four targets of reagent 4 were detected; 1 target was detected by reagents 5 and 7; 2 targets were detected by reagents 2, 3 and 6; 3 targets were detected by reagents 1, 8 and 9 , all four targets of reagent 10 were detected.

Comprehensive analysis of the above results shows that (1) when 10 kinds of one-step PCR reagents were used to detect the samples to be tested, H3 was not detected 9 times, FluB was not detected 5 times, and H1 was not detected 4 times, that is, because of the sensitivity difference of the reagents or The possible special structure of the detection target or the sensitivity of the primers make it difficult to detect the three targets of H3, FluB, and H1, but the reagent 10 can detect all three targets, indicating that the reagent 10 has higher performance than other reagents. Sensitivity, the best performance for detecting RNA. (2) Reagent 4 detected the positive control, and all 11 targets were detected, but when the RNA sample to be tested was detected, none of the 4 targets were detected, which may be caused by the unsuccessful reverse transcription. It is suggested that the ratio of reverse transcriptase and DNA polymerase is more important for the one-step PCR reagent of the two-enzyme system. (3) In this reagent screening, during the one-step PCR amplification, although the template sample volume remains the same and the total reaction volume remains the same, the recommended reaction procedures for different reagents are different, and the detection results may be affected by the selected reaction. program impact. (4) DNA/RNA detection by nucleic acid mass spectrometry, one-step PCR amplification reaction is the first step, and then combined with SAP and single-base extension reaction, the product required for mass spectrometry detection can be obtained. If there is interference between the reagents, it will also affect the detection sensitivity. Therefore, it is very necessary to screen one-step PCR reagents suitable for nucleic acid mass spectrometry platforms.

Example 3: Optimization of one-step PCR reagent reaction system

In this embodiment, 3 test groups and 1 control group are set, and a better detection effect is achieved by optimizing the ratio of buffer and enzyme in the one-step PCR reagent. Using the one-step PCR reagent 10 screened in Examples 1 and 2 as the detection reagent, using the RNA mixture of 3 kinds of pathogens as the sample to be tested (this sample is the same as in Example 2), and using the multiple primer mixture of 13 kinds of respiratory pathogens as the primer system, Perform nucleic acid mass spectrometry detection, and screen out the optimal one-step PCR reagent reaction system by comparing the detection results of the test group and the control group. The negative control was set to water, and the positive control was the plasmid mixture for the detection of each target of 13 respiratory pathogens. The quality standard of the best one-step PCR reagent reaction system: no target was detected in water; 4 detection targets were detected in the RNA mixture of the 3 pathogens; the plasmid mixture detected the largest number of targets; no target in the range of 3000-10000Da in the spectrum Miscellaneous peaks or <2 miscellaneous peaks.

Among them, the information of the 13 respiratory pathogens is as follows:

site number	pathogen	detection target	Nucleic acid properties
13HXD-1	SARS-COV-2	target 1	RNA
13HXD-2	SARS-COV-2	target 2	RNA
13HXD-3	FluA	target 3	RNA
13HXD-4	FluA-H1N1 (2009)	target 4	RNA
13HXD-5	FluA-H3N2	target 5	RNA
13HXD-6	FluB	target 6	RNA
13HXD-7	HuRNA	target 7	RNA
13HXD-8	HcoV-229E	target 8	RNA
13HXD-9	HcoV-OC43	target 9	RNA
13HXD-10	HcoV-NL63	target 10	RNA
13HXD-11	HcoV-HKU1		target 11	RNA
13HXD-12	HcoV-SARS		target 12	RNA
13HXD-13	HcoV-MERS	target 13	RNA
13HXD-14	HcoV-MERS		target 14	RNA
13HXD-15	FluA-H5N1	target 15	RNA
13HXD-16	FluA-H7N9	target 16	RNA

The primer sequences of the 13 respiratory pathogens are as follows:

serial number	Sequence (5'→3')	for site	use
SEQ ID No: 1	acgttggatgccctgtgggttttacactta	13HXD-1	PCR primers
SEQ ID No: 2	acgttggatgaaaacgattgtgcatcagc	13HXD-1	PCR primers
SEQ ID No: 3	acgttggatgggaacttctcctgctagaat	13HXD-2	PCR primers

SEQ ID No: 4	acgttggatgcagacattttgctctcaag	13HXD-2	PCR primers
SEQ ID No: 5	acgttggatgacagagacttgaagatgtct	13HXD-3	PCR primers
SEQ ID No: 6	acgttggatgtcagaggtgacaggattg	13HXD-3	PCR primers
SEQ ID No: 7	acgttggatgtgggaggctggtgtttatag	13HXD-4	PCR primers
SEQ ID No: 8	acgttggatgtgctggatctggtattatc	13HXD-4	PCR primers
SEQ ID No: 9	acgttggatggtactgacaaggaccaaatc	13HXD-5	PCR primers
SEQ ID No: 10	acgttggatgggcttcttttggtagatactg	13HXD-5	PCR primers
SEQ ID No: 11	acgttggatgggtcaaattctttcccaccg	13HXD-6	PCR primers
SEQ ID No: 12	acgttggatgcgctgtttggagacacaatt	13HXD-6	PCR primers
SEQ ID No: 19	acgttggatggtactacactgaattcaccc	13HXD-7	PCR primers
SEQ ID No: 20	acgttggatgtccaatccaaatgcggcatc	13HXD-7	PCR primers
SEQ ID No: 34	acgttggatggatgcatctgaaccacaacg	13HXD-8	PCR primers
SEQ ID No: 35	acgttggatgactatcaacaagcaaagggc	13HXD-8	PCR primers
SEQ ID No: 36	acgttggatggaaggtctgctcctaattcc	13HXD-9	PCR primers
SEQ ID No: 37	acgttggatggggttctattgccagaattg	13HXD-9	PCR primers
SEQ ID No: 38	acgttggatggccaacgctcttgaacattc	13HXD-10	PCR primers
SEQ ID No: 39	acgttggatgggtcattcccaggaatcttg	13HXD-10	PCR primers
SEQ ID No: 40	acgttggatgtgctaatcaccaagctgac	13HXD-11	PCR primers
SEQ ID No: 41	acgttggatgtaccaggcggaaacctagt	13HXD-11	PCR primers
SEQ ID No: 42	acgttggatggcctctcttgttcttgctcg	13HXD-12	PCR primers
SEQ ID No: 43	acgttggatgggtaagcgtaaaactcatcc	13HXD-12	PCR primers
SEQ ID No: 44	acgttggatgttcattactcgtgaagagg	13HXD-13	PCR primers
SEQ ID No: 45	acgttggatgttggtgccacatgcattacg	13HXD-13	PCR primers
SEQ ID No: 46	acgttggatgtcctcttcacataatcgccc	13HXD-14	PCR primers
SEQ ID No: 47	acgttggatgtacacgggacccatagtag	13HXD-14	PCR primers
SEQ ID No: 48	acgttggatgctgccatcctccctctataa	13HXD-15	PCR primers
SEQ ID No: 49	acgttggatgcaccccctcaccatcggggaa	13HXD-15	PCR primers
SEQ ID No: 50	acgttggatggatggttggtatggtttcag	13HXD-16	PCR primers
SEQ ID No: 51	acgttggatgttgccgattgagtgcttttg	13HXD-16	PCR primers
SEQ ID No: 23	ggtatgtggaaaggttatg	13HXD-1	extension primer
SEQ ID No: 24	ttgctgctgcttgacagat	13HXD-2	extension primer
SEQ ID No: 25	caatcctgtcacctctga	13HXD-3	extension primer
SEQ ID No: 26	ccacgattgcaatacaacttg	13HXD-4	extension primer
SEQ ID No: 52	ggaccaaatcttcctgta	13HXD-5	extension primer
SEQ ID No: 28	gaaccaacagtgtaatttttc	13HXD-6	extension primer
SEQ ID No: 32	gcctgccgtgtgaaccatgtgactt	13HXD-7	extension primer
SEQ ID No: 53	taaggtattctaccctgac	13HXD-8	extension primer

SEQ ID No: 54	ctgctcctaattccagatctactt	13HXD-9	extension primer
SEQ ID No: 55	ctgctcatctttattacccttacc	13HXD-10	extension primer
SEQ ID No: 56	cccttgacgaaacatcggaggga	13HXD-11	extension primer
SEQ ID No: 57	gtccgcaatctacaacacaggc	13HXD-12	extension primer
SEQ ID No: 58	gcatgtggcaccaatgt	13HXD-13	extension primer
SEQ ID No: 59	cgcagagctgcttaaacgataa	13HXD-14	extension primer
SEQ ID No: 60	cctgctatagctccaaa	13HXD-15	extension primer
SEQ ID No: 61	gagagggaactgctgca	13HXD-16	extension primer

The molecular weights of the extension primers and extension products corresponding to each site are shown in the table below.

In one embodiment, the above-mentioned PCR primer sequence is a core sequence, which may include a protective base sequence at the 5' end, preferably 5-15 bases. In a specific embodiment, the protection base sequence is selected from a tag (acgttggatg) added at the 5' end of 10 bp, for example, the PCR primer SEQ ID NO: 1 is 5'-acgttggatgccctgtgggtttttacactta-3'. In another specific embodiment, the 5' end of the extension primer can also add a base sequence that serves as a linker.

The reaction system of the control group in this example is consistent with that recommended in the instructions, and the ratios of enzyme and buffer in the one-step PCR reagent were adjusted for the three test groups respectively. In test group 1, the amount of enzyme was increased to 1.5 times the amount in the instructions, and the amount of buffer was unchanged; in test group 2, the amount of enzyme was unchanged, and the amount of buffer was increased to 1.5 times the amount in the instructions; in test group 3, the amount of enzyme was increased to 1.5 times in the instructions. The amount of buffer increased to 1.5 times the amount in the manual. The reaction volume and template loading volume used in the control group and the three test groups were the same, the reaction procedures were the same, and the reaction systems and procedures of the SAP and single-base extension reactions were the same.

The test was performed using an ABI 9700 PCR machine. The operation is carried out according to the instructions, and the specific methods are as follows:

1. PCR amplification

1.1 In the PCR preparation area, prepare a 200 μL PCR reaction tube according to the number of samples to be tested, and mark the sample number on the tube.

1.2 Take one-step PCR reagent 10, ddH2O out of the kit, thaw it naturally, vortex to mix it well, and centrifuge it to the bottom of the tube briefly.

1.3 According to the number of samples, take out the buffer and enzyme according to the ratio in the table below, put them in a 1.5mL centrifuge tube and mix well, and add the corresponding volume of mixture to each PCR reaction tube for aliquoting.

1.4 Add the corresponding volume of the sample to be tested to each tube of mixture in the PCR amplification area, so that the total volume of each PCR reaction system reaches the corresponding volume. Among them, the negative control is ultrapure water, and the positive control is the plasmid mixture for detecting each target of 13 respiratory pathogens.

1.5 Put the PCR reaction tube in the PCR amplifier, and carry out the PCR amplification reaction according to the procedure in the table below.

2.SAP Enzymatic Digestion

After the PCR reaction is over, take 5 μL of PCR products into new tubes in turn, add 2 μL of SAP enzyme mixture to each tube, and then place the PCR reaction tube in the PCR amplifier, and execute the procedure in the following table.

temperature(℃)	time (min)	number of cycles
37	30	1
65	5	1

3. Single base extension

3.1 In the PCR preparation area, according to the number of samples, take out the extension primer mixture and the extension enzyme mixture according to the ratio in the table below, and place them in a centrifuge tube and mix well.

component name	Single reaction volume (μL)
Extension primer mix	1

elongase mix	1
total	2

3.2 In the PCR amplification area, add 2 μL of extension mixture to each tube of PCR product for aliquoting;

3.3 Place the PCR reaction tube in the PCR amplifier, and carry out the extension reaction according to the procedure in the table below.

4. Purification

In the PCR amplification area, add 41 μL of pure water and 15 mg of resin to each extension product, invert and mix for 30 min.

5. Spotting

Using a micropipette, aspirate 0.5 μL of the purified product and spot it onto the matrix-containing target.

6. Detection and result interpretation

The Clin-TOF time-of-flight mass spectrometer developed by the inventor was used to detect and judge the results of the spotted target pieces.

7. Testing quality standards

Miscellaneous peaks: The peaks that may not appear in this reaction system are miscellaneous peaks;

8. Test results

The three single-base extension products of the three test groups and one control group described in Example 3 were all spotted on the same chip for nucleic acid mass spectrometry detection. The mass spectrometry results show:

(1) Negative control: The negative controls in the 3 test groups and 1 control group were all normal and no pathogen target was detected;

(2) Positive control: All the targets of the positive control in the 3 test groups and 1 control group were correctly detected, but the extension efficiency of H1 and H5 sites were different. Test group 1, test group 2, test group 3, control The extension efficiencies of the H1 site in the group were: 65%, 81%, 92%, and 96%, and the extension efficiencies of the H5 site were: 98%, 41%, 98%, and 99%, respectively. Compared with the control group, the extension efficiency of the H1 site was significantly improved, and the extension efficiency of the H5 site in the test group 1 was significantly lower than that of the control group;

(3) Samples to be tested: The extension efficiencies of the four detection targets are as follows:

	FluA	FluB	H3	H1
control group	99%	94%	58%	77%
Test group 1	100%	96%	twenty four%	72%
Test group 2	98%	100%	86%	71%
Test group 3	99%	99%	84%	74%

It can be seen from the above table that the extension efficiency of H3 in test group 1 is significantly lower than that in the control group, and the extension efficiency of H3 in test group 2 is significantly higher than that in the control group.

Comprehensive analysis of the above results showed that (1) no matter how the ratio of buffer and enzyme in the reaction system changed, the negative control was normal and undetected, suggesting that the reagent has good specificity and is suitable for multiple DNA/RNA nucleic acid mass spectrometry detection. (2) Compared with the control group, the test group 1 will lead to a decrease in the extension efficiency of individual sites: the test group 1 detects the positive control, the H5 extension efficiency is lower than that of the other groups, the test group 1 detects the sample to be tested, and the H3 extension efficiency compares The other groups decreased. The increase in the amount of buffer in the analysis test group 1 increases the concentration of cations, dNTPs, etc. contained in the reaction system, and even the pH environment of the reaction changes accordingly. The change of these parameters may lead to changes in the optimal reaction conditions of the enzyme, thereby This leads to a decrease in the extension efficiency of individual sites, which suggests that buffer plays an important role in one-step PCR reagents; (3) Compared with the control group, test groups 2 and 3 can significantly improve the extension efficiency of individual sites: test groups 2 and 3 The positive control was detected, and the H1 extension efficiency was improved compared with other groups. The test groups 2 and 3 detected the samples to be tested, and the H3 extension efficiency was improved compared with other groups. It is suggested that when the reaction sensitivity is insufficient, it can be considered to increase the amount of enzyme appropriately.

Example 4: One-step PCR reaction without nucleic acid extraction

In this example, a control group and a test group were set up to compare the effects of one-step PCR amplification after nucleic acid extraction and purification and direct one-step PCR amplification without nucleic acid extraction to detect DNA/RNA. The one-step PCR reagent 10 screened in Examples 1 and 2 was used as the detection reagent, the Shanghai Clinical Laboratory Center's new crown inter-laboratory quality assessment sample 2014 was used as the sample to be tested, and the 3-plex nucleic acid detection of the new coronavirus (SARS-COV-2) was used as the test sample. The primer mixture is used as a primer system for nucleic acid mass spectrometry detection. By comparing the detection results of the test group and the control group, it is determined whether the one-step PCR reagents 10 screened in Examples 1 and 2 are suitable for the detection of DNA/RNA samples free of nucleic acid extraction. Set the negative control as water, and the positive control as the plasmid mixture of each target of the new coronavirus nucleic acid detection. The detection effect of the test group should be no worse than that of the control group.

Among them, the site information of the new coronavirus nucleic acid detection is as follows:

site number	pathogen	detection target	Nucleic acid properties
SARS-COV-2-1	SARS-COV-2	target 1	RNA
SARS-COV-2-2	SARS-COV-2	target 2	RNA
SARS-COV-2-3	HuRNA	target 3	RNA

The primer sequences of the 13 respiratory pathogens are as follows:

serial number	Sequence (5'→3')	for site	use
SEQ ID No: 1	acgttggatgccctgtgggttttacactta	SARS-COV-2-1	PCR primers
SEQ ID No: 2	acgttggatgaaaacgattgtgcatcagc	SARS-COV-2-1	PCR primers

SEQ ID No: 3	acgttggatgggaacttctcctgctagaat	SARS-COV-2-2	PCR primers
SEQ ID No: 4	acgttggatgcagacattttgctctcaag	SARS-COV-2-2	PCR primers
SEQ ID No: 19	acgttggatggtactacactgaattcaccc	SARS-COV-2-3	PCR primers
SEQ ID No: 20	acgttggatgtccaatccaaatgcggcatc	SARS-COV-2-3	PCR primers
SEQ ID No: 23	ggtatgtggaaaggttatg	SARS-COV-2-1	extension primer
SEQ ID No: 24	ttgctgctgcttgacagat	SARS-COV-2-2	extension primer
SEQ ID No: 32	gcctgccgtgtgaaccatgtgactt	SARS-COV-2-3	extension primer

The molecular weights of the extension primers and extension products corresponding to each site are shown in the table below.

In one embodiment, the above-mentioned PCR primer sequence is a core sequence, which may include a protective base sequence at the 5' end, preferably 5-15 bases. In a specific embodiment, the protection base sequence is selected from a tag (acgttggatg) added at the 5' end of 10 bp, for example, the PCR primer SEQ ID NO: 1 is 5'-acgttggatgccctgtgggtttttacactta-3'. In another specific embodiment, the 5' end of the extension primer can also add a base sequence that serves as a linker.

In this example, a control group was set up, the samples used were extracted and purified nucleic acids, the samples used in the test group were samples that were rapidly processed by a commercial kit, and the selected one-step PCR reagent 10 was used in both the control group and the test group, and the reaction volume was The amount of sample added to the template is the same, the reaction program is the same, and the reaction system and program of the SAP and single-base extension reactions are the same.

The test was performed using an ABI 9700 PCR machine. The operation is carried out according to the manual, and the specific methods are as follows:

1. PCR amplification

1.1 In the PCR preparation area, prepare a 200 μL PCR reaction tube according to the number of samples to be tested, and mark the sample number on the tube.

1.2 Take out the one-step PCR reagent 10, ddH2O from the kit, thaw it naturally, vortex to mix it well, and centrifuge it to the bottom of the tube briefly.

1.3 According to the number of samples, take out the buffer and enzyme according to the ratio in the table below, put them in a 1.5mL centrifuge tube and mix well, and add the corresponding volume of mixture to each PCR reaction tube for aliquoting.

test group	water (ul)	buffer(ul)	Enzyme (ul)	Primer (ul)	template (ul)	Total (ul)
control group	4.5	5	1	2.5	12	25
test group	15.5	5	1	2.5	1	25

1.4 Add the corresponding volume of the sample to be tested to each tube of mixture in the PCR amplification area, so that the total volume of each PCR reaction system reaches the corresponding volume. Among them, the negative control is ultrapure water, and the positive control is the plasmid mixture of each target of the new coronavirus nucleic acid detection.

1.5 Put the PCR reaction tube in the PCR amplifier, and carry out the PCR amplification reaction according to the procedure in the table below.

2.SAP Enzymatic Digestion

After the PCR reaction is over, take 5 μL of PCR products into new tubes in turn, add 2 μL of SAP enzyme mixture to each tube, and then place the PCR reaction tube in the PCR amplifier, and execute the procedure in the following table.

temperature(℃)	time (min)	number of cycles
37	30	1
65	5	1

3. Single base extension

3.1 In the PCR preparation area, according to the number of samples, take out the extension primer mixture and the extension enzyme mixture according to the ratio in the table below, and place them in a centrifuge tube and mix well.

component name	Single reaction volume (μL)
Extension primer mix	1
elongase mix	1
total	2

3.2 In the PCR amplification area, add 2 μL of extension mixture to each tube of PCR product for aliquoting;

3.3 Place the PCR reaction tube in the PCR amplifier, and carry out the extension reaction according to the procedure in the table below.

4. Purification

In the PCR amplification area, add 41 μL of pure water and 15 mg of resin to each tube of extension product, invert and mix for 30 min.

5. Spotting

Using a micropipette, aspirate 0.5 μL of the purified product and spot it onto the matrix-containing target.

6. Detection and result interpretation

The Clin-TOF time-of-flight mass spectrometer developed by the inventor was used to detect and judge the results of the spotted target pieces.

7. Testing quality standards

Miscellaneous peaks: the peaks that may not appear in this reaction system are all miscellaneous peaks; peak type: no bifurcation, partial front, following peaks, etc., are considered as better peak types

8. Test results

The three single-base extension products of each of the test group and the control group described in Example 4 were spotted on the same chip for nucleic acid mass spectrometry detection. The mass spectrometry results show:

(1) Negative control: The negative controls in both the test group and the control group were normal and did not detect any pathogen targets;

(2) Positive control: all the targets of the positive control in the test group and the control group were correctly detected;

(3) Samples to be tested: All the targets of the samples to be tested in the test group and the control group were correctly detected, and the extension efficiency was 100%;

(4) There were no obvious impurity peaks in the test group and the control group, the baseline was stable, and there was no significant difference in the detection effect.

Comprehensive analysis of the above results shows that the one-step PCR reagents 10 screened in Examples 1 and 2 can be used for sample detection without nucleic acid extraction, thereby reducing reagent costs, sample consumption, and operation steps.

Claims (20)

1. A multiple one-step PCR reagent One-Step RT-PCR Kit that can be applied to nucleic acid mass spectrometry and can simultaneously detect DNA/RNA, wherein the enzyme in the one-step PCR reagent One-Step RT-PCR Kit is a double-enzyme system, The dual-enzyme system is selected from M-MLV reverse transcriptase derived from murine leukemia virus that has eliminated RNaseH activity, and a specific and effective thermostable Taq DNA polymerase that reduces non-specific amplification caused by primer mismatches.
2. The one-step PCR reagent according to claim 1, wherein the PCR reaction reagent matched with the double-enzyme system comprises buffer and dNTP, wherein the buffer comprises Mg ²⁺ , a PCR stabilizer and an enhancer, and the enhancer comprises 200mM Tris-HCl (pH 8.4), 500mM KCl
3. The one-step PCR reagent of claim 1 or 2, wherein the dNTPs comprise 200uM dATP, 200uM dCTP, 200uM dGTP, 200uM dTTP.
4. A DNA/RNA nucleic acid mass spectrometry detection product, comprising the one-step PCR reagent described in claims 1-3, a reagent for a single base extension reaction, and a matrix reagent for mass spectrometry, wherein the dual enzyme system is selected from murine leukemia A virus-derived M-MLV reverse transcriptase that eliminates RNaseH activity, and a specific and effective thermostable Taq DNA polymerase that reduces non-specific amplification caused by primer mismatches.
5. The detection product according to claim 4, wherein the PCR reaction reagent matched with the double enzyme system comprises buffer and dNTP, wherein the buffer comprises Mg ²⁺ , PCR stabilizer and enhancer, and enhancer: comprises 200mM Tris -HCl (pH 8.4), 500 mM KCl, the dNTPs include 200 uM dATP, 200 uM dCTP, 200 uM dGTP, 200 uM dTTP.
6. The detection product of claim 4 or 5, wherein the detection product is a detection product for detecting respiratory pathogens, which comprises a reaction reagent for one-step PCR of inversion and PCR amplification and a single-base extension reaction reagent. Reagents, purification reagents, and matrix reagents for mass spectrometry.
7. The detection product of claim 6, wherein the nucleic acid is a nucleic acid extracted and purified from a sample, or a nucleic acid free of extraction and purification, so that the sample is mixed with the reaction reagent and then directly subjected to PCR amplification.
8. The detection product according to any one of claims 4-7, the detection product further comprises: specific PCR primers, reagents for purifying PCR products, and reagents for single-base extension reaction, including: extension primers, high temperature resistant single base elongase, ddNTPs, extension reaction buffer.
9. The detection product according to claim 8, wherein the detection product can further include: negative quality control substance, positive quality control substance, resin for purification, target for spotting and mass spectrometry detection and other reagents.
10. The detection product of claim 8, wherein the reagent used for the purification of the PCR product comprises alkaline phosphatase, or alkaline phosphatase and exonuclease ExoI, or an electrophoresis gel recovery reagent, or a PCR product purification column, when an alkali is included The PCR primers used do not need to include protective bases when using purification reagents for sex phosphatase and exonuclease ExoI.
11. The detection product according to any one of claims 4-10, wherein the detection product comprises a detection reagent, a detection matrix and/or a detection chip, an analysis software used independently, and a detection reagent, a detection matrix and/or a detection chip which are used independently , Analysis software detection kit.
12. A kind of utilizing the one-step PCR reagent of claim 1-3, or utilizing the detection product of claim 4-11, carry out multiplex DNA/RNA nucleic acid mass spectrometry detection method, comprising:

    (1) Prepare the sample to be tested;

    (2) One-step PCR reaction: the sample is subjected to one-step PCR reaction to obtain a PCR product containing the amplified target region;

    (3) PCR product purification: the PCR product obtained in step (2) is purified to reduce interference to subsequent reactions;

    (4) Single-base extension: using specific extension primers, in a reaction system, single-base extension is performed on the purified PCR product obtained in step (3);

    (5) purification of the extension product: the extension product obtained in step (4) is purified to obtain a high-purity extension product and avoid the influence of impurities such as salt ions on subsequent detection;

    (6) Mass spectrometer detection: spot the purified product obtained in step (5) on a target sheet containing a matrix, put it into a mass spectrometer for detection, and obtain nucleic acid spectra of extension products at different SNP sites;

    (7) The nucleic acid spectrum of the obtained extension products of different SNP sites is compared with the standard spectrum and analyzed by the supporting software of the mass spectrometer, and the bases of the SNP sites are confirmed, so as to determine the genotype of the sample.
13. The nucleic acid mass spectrometry detection method of claim 12, when the sample to be tested is extracted and purified DNA/RNA, the step (1) directly adds the sample to be tested into the one-step PCR reaction reagent.
14. The detection method of claim 13, when the sample to be tested is a sample such as throat swab virus preservation solution, nasal swab virus preservation solution, etc., step (1) adds the sample to be tested into a commercialized sample treatment agent, and conducts sample pretreatment , without purification.
15. The detection method of claim 14, wherein in step (1), the sample to be tested is pretreated with a lightning nucleic acid release agent, and the cell is lysed by the principle that the difference in salt ion concentration inside and outside the cell can cause the cell membrane to burst to release the nucleic acid without purification.
16. 16. The method of claim 15, wherein the step of step (1) comprises:

    For every 20 μL of sample, add 5 μL of Lightning Nucleic Acid Release Reagent to a new 200 μL Eppendorf tube. After vortexing and mixing evenly, place the Eppendorf tube in a metal bath or hot-lid PCR machine and heat at 95°C for 10 min. Take out the Eppendorf tube and equilibrate to room temperature, centrifuge at 12,000 rpm for 2 min, and suck the supernatant from the Eppendorf tube into a clean centrifuge tube for inspection. During PCR amplification, 1 μL of the treated supernatant was added to each 25 μL reaction system.
17. The use of the one-step PCR reagent of claims 1-3, or the use of the detection product of claims 4-11 for detecting DNA/RNA, wherein the use is a non-disease detection use.
18. The use of claim 17, wherein the use is for determining whether certain pathogens (including bacteria, viruses, rickettsia, fungi, Mycobacterium tuberculosis, etc., dead or live bacteria, etc.), in order to determine the test results of health and epidemic prevention.
19. The purposes of claim 17 or 18, wherein the purpose is to determine the genotyping of pathogen-carrying virtual SNP loci in human blood, sputum, oropharyngeal swabs, nasal swabs, etc., in order to provide a dosing regimen. Reference comments.
20. The purposes of claim 17 or 18, wherein the purposes are to determine the SNP site of the individual is to determine the drug target of the patient, so as to screen an effective drug; or the purpose is to determine the kinship between the individuals, including but not limited to Paternity testing, forensic identification or forensic testing.

Images