CN101440407A - Method for detecting nucleotide mutant site - Google Patents
Method for detecting nucleotide mutant site Download PDFInfo
- Publication number
- CN101440407A CN101440407A CNA2008102183444A CN200810218344A CN101440407A CN 101440407 A CN101440407 A CN 101440407A CN A2008102183444 A CNA2008102183444 A CN A2008102183444A CN 200810218344 A CN200810218344 A CN 200810218344A CN 101440407 A CN101440407 A CN 101440407A
- Authority
- CN
- China
- Prior art keywords
- site
- primer
- extension
- mutational site
- mutational
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting nucleotide mutation sites. The method comprises the following steps of: (1) determining the position of a mutation site in a to-be-detected sequence; (2) designing a primer according to the position of the position of the mutation site; (3) performing PCR amplification; (4) performing SAP enzyme treatment so as to remove dNTPs contained by a amplification product; (5) performing extension reaction and connecting the 3' end of an extension product with a basic group; (6) adopting resin to purify the extension reaction product; and (7) co-crystallizing the purified product and a chip matrix, putting a crystal into a vacuum tube of a mass spectrograph and then using instantaneous nanosecond intense laser excitation to perform mass spectrometric detection so as to determine the genotype of mutation. The detection method solves the problem that the prior method for detecting nucleotide mutation sites is low in sensitivity and accuracy.
Description
Technical field
The invention belongs to organic-biological molecule field in genomics and the molecular biology, relate in particular to the detection method of nucleotide mutant site.
Background technology
The genetic information of the most of organisms of nature all is included in the thymus nucleic acid (DNA), 3,000,000,000 bases in the human full genome, and about 40,000 genes are distributed on 24 pairs of karyomit(e)s.Each gene is by transcribing, translating, and the special protein of encoding is regulated and control specific biochemical reaction in the organism, brings into play special biological function.The change of dna sequence dna, i.e. transgenation can cause the change or the disappearance of protein structure, function, and then causes relevant genetic diseases.Transgenation comprises insertion, disappearance and the change (point mutation) that base pair takes place in the dna molecular.
Studies show that the generation of numerous disease, closely related as more than 3000 disease such as hemophilia, thalassemia, Du Shi type muscular dystrophy, Huntington chorea, senile dementia, diabetes, obesity, cardiovascular disorder and autoimmunization and transgenation.In addition, people recognize that gradually the generation development of cancer also is a gene accumulation results of mutation in recent years.
In human genome, about 90% difference is that the difference with single Nucleotide embodies, mainly conversion (transition) or the transversion (transversion) by single base caused, such difference site be called single nucleotide polymorphism (single nucleotide polymorphism, SNP).In the crowd, the occurrence frequency of this variation is greater than 1% at least, otherwise is considered to point mutation.SNP site great majority are bifurcation, and two kinds of manifestation are promptly only arranged on a site, and extensively exist in human genome, just have 1 in average per 500～1000 base pairs, estimate that its sum can reach 3,000,000 even more.These differences very likely are to cause the inherited genetic factors of individual difference, find that therefore these sites can be widely used in research fields such as the research of genetic marker, assessment idiogenetics relation, assessment spore.
The method that detects SNP and transgenation at present has many kinds, as direct PCR order-checking, RFLP, gene chip and quantitative fluorescent PCR etc.Wherein, directly the PCR order-checking is least responsive, has only the medicament-resistant mutation strain to reach more than 20% and just can be detected; Be not suitable for extensive screening yet; Rflp analysis can only detect in virus is overall mutant strain greater than 5%, but for each interested sudden change, must the independent endonuclease of special design.Specificity restriction endonuclease at some sudden change may not exist, and rflp analysis also is not suitable for all sudden changes.Biochip technology is utilized the oligonucleotide microarray, can detect newfound sudden change, but this method costs dearly, and is not used widely.In a word, above-mentioned these methods do not waste time and energy, and sensitivity is low, and accuracy is low, is exactly the cost height, is not suitable for extensive examination.
Summary of the invention
The purpose of the embodiment of the invention is to provide a kind of detection method of nucleotide mutant site, is intended to solve the problem that detection method sensitivity is low, accuracy is low of existing nucleotide mutant site.
The embodiment of the invention is achieved in that a kind of detection method of nucleotide mutant site, comprises the steps:
A kind of detection method of nucleotide mutant site comprises the steps:
(1) mutational site that may exist, and the position of definite mutational site in sequence to be checked at nucleotide sequence to be checked;
(2) according to the position in mutational site, design 3 primers, wherein, a pair of is amplimer, and every primer length is 30bp at least, and its 5 ' end respectively contains the tag of 10bp; Another is for extending primer, and length is 17-28bp, just in time is positioned at the 5 ' end in mutational site;
(3), obtain to contain the target sequence amplified production in described mutational site by pcr amplification;
(4) handle by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) by extension, connect a base at the 3 ' end that extends primer, and this base just in time with the mutational site on base complementrity, the employed raw material of extension is to be that purpose was carried out four kinds of ddNTP molecules that quality is modified to enlarge molecular weight difference
(6) adopt resin purification extension product;
(7) with product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then and carry out mass spectrometric detection, determine the genotype of sudden change.
Compared with prior art, technique scheme is handled by SAP enzyme (shrimp alkali Phosphoric acid esterase), remove the dNTPs that contains in the described amplified production, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extend a base when guaranteeing extension; The employed raw material of extension is the ddNTP that modifies through quality, to increase four kinds of ddNTP molecular weight differences, improves resolving power.With purified product and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then, because substrate molecule absorbs energy through radiation, cause energy to be accumulated and heat production rapidly, thereby make the host crystal distillation, nucleic acid molecule will desorption and is changed metastable state ion into, the ion that produces mostly is single charge ion, these single charge ions obtain identical kinetic energy in accelerating field, and then in a non-electric field drift region, separated according to its mass-to-charge ratio rate, flight arrives detector in the vacuum tubule.Like this, it is not only convenient to adopt mass spectrograph to detect mutational site to be detected, and highly sensitive, accuracy is high.
Above-mentioned target sequence amplified production length is 80-120bp.
As a concrete embodiment of the present invention, the molecular weight of four kinds of ddNTP is respectively ddATP271.2Da, ddTTP 327.1Da, and ddCTP 247.2Da, ddGTP 287.2Da, wherein that the molecular weight difference minimum is 16Da, has improved resolving power greatly.
As a preferred implementation of the present invention, above-mentioned steps (2) can also comprise: according between primer, do not form dimer, hairpin structure between primer and amplified production, and the principle that mispairing does not take place, the amplimer of a plurality of detection site is mixed with amplimer, extend primer and mix with the extension primer.Can detect a plurality of discrete SNP site so simultaneously, improve efficient, provide cost savings.
As another preferred implementation of the present invention, continuous a plurality of mutational sites can also be marked at same nucleotides sequence and list shared a pair of amplimer.The length of amplified production can be between 100-350bp.Both sides design is to the left and right taked in the mutational site at two ends, and the extension primer in mutational site, left side is taked the forward design, and the extension primer in mutational site, right side is taked reverse design; The extension primer that is positioned at the intermediary mutational site has many, and comprises all Nucleotide situations that the mutational site of its upstream may exist.Like this, can detect a plurality of sites of continuous sudden change simultaneously, provide cost savings, shorten the cycle, improve efficient.Specifically, can adopt following method to design the primer in continuous a plurality of mutational sites: if the mutational site, left side is Snp1, the intermediary mutational site is Snp2, the mutational site, right side is Snp3, Snp1/Snp2/Snp3 place sequence is: ... TCAGCGATAT[C/T] C[G/A] [T/G] AATTCGTACGATGATCGCTAGA......, Snp1[C/T then], SNP site, right side, the forward design, the extension primer is: ... TCAGCGATATSnp3[T/G], SNP site, left side, reverse design, the extension primer is: ... TACGAATTSnp2[G/A], middle SNP site, degenerate primer, extend primer and be: ... AGCGATATCC and ... AGCGATATTC.
In the above-mentioned embodiment, mass spectrograph is selected ground substance assistant laser desorption ionization flight time mass spectrum (MALDI-TOF-MS).The reaction system of this flight time mass spectrum gene type system is non-hybridization dependency, does not exist potential hybridization mispairing to disturb, do not need to introduce various markers yet, thereby the accuracy height.
Description of drawings
Figure 1A is in the embodiment of the invention 1, the mass spectrum of resulting negative control A1; Figure 1B is in the embodiment of the invention 1, the mass spectrum of resulting sample to be tested B1; Fig. 1 C is in the embodiment of the invention 1, the mass spectrum of resulting sample to be tested C1;
Fig. 2 A is in the embodiment of the invention 2, the mass spectrum of resulting negative control A2; Fig. 2 B is in the embodiment of the invention 2, the mass spectrum of resulting sample to be tested B2; Fig. 2 C is in the embodiment of the invention 2, the mass spectrum of resulting sample to be tested C2; Fig. 2 D is in the embodiment of the invention 2, the mass spectrum of resulting sample to be tested D2; Fig. 2 E is in the embodiment of the invention 2, the mass spectrum of resulting sample to be tested E2;
Fig. 3 A-1 is in the embodiment of the invention 3, the mass spectrum of resulting negative control A3-1; Fig. 3 A-2 is in the embodiment of the invention 3, the mass spectrum of resulting negative control A3-2; Fig. 3 B is in the embodiment of the invention 3, the mass spectrum of resulting sample to be tested B3; Fig. 3 C is in the embodiment of the invention 3, the mass spectrum of resulting sample to be tested C3;
Fig. 4 A is in the embodiment of the invention 4, the mass spectrum of resulting sample to be tested A4; Fig. 4 B-E is respectively the partial enlarged drawing of Fig. 4 A, and wherein, Fig. 4 B is in the embodiment of the invention 4, detects the mass spectrum in 180 sites; Fig. 4 C is in the embodiment of the invention 4, detects the mass spectrum in 204 sites; Fig. 4 D is in the embodiment of the invention 4, detects the mass spectrum in 250 sites; Fig. 4 E is in the embodiment of the invention 4, detects the mass spectrum in 184 sites.
Embodiment
In order to make purpose of the present invention, technical scheme and advantage clearer,, the present invention is further elaborated below in conjunction with drawings and Examples.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.
Embodiment 1:
(1) primer of design amplification hepatitis B virus reversed transcriptive enzyme district 180 bit codons
Hepatitis B virus (hepatitis B virus, HBV) infecting is serious worldwide hygienic issues, annual have nearly million people to die from all kinds of diseases that hepatitis B virus infection causes approximately.If the drug main nucleic acid analog of treatment hepatitis B comprises lamivudine, adefovir ester, Entecavir etc. at present, this class medicine substitutes normal dNTP in the viral dna replication process, thereby causes the synthetic termination of DNA.Yet, take certain medicine for a long time and can cause chemical sproof generation, not only do not reach the purpose of treatment, cause bounce-back on the contrary.If variation is studied to the intravital resistance of hepatitis B patient, can the announcement crowd in Different Individual to the basic reason of the sensitivity differences of same medicine, also help the investigator to screen more suitably medicine.
Wherein, hepatitis B virus gene group reversed transcriptive enzyme district 180 bit codon C/TTG become ATG, make amino acid become methionine(Met) (L180M) by leucine, thus the resistance of the virus drugs lamivudine that creates antagonism.
For the mass spectrometric detection in this mutational site, we design following experiment: at first according to the sequence of hepatitis B virus gene group (the NCBI accession number: NC_003977), design one couple of PCR primers and one extend primer, and the PCR primer is:
Upstream: 5 '-acgttggatgAAGATTCCTATGGGAGTGGG-3 ';
Downstream: 5 '-acgttggatgAGCCCTACGAACCACTGAAC-3 ';
Extending primer is: 5 '-GCCTCAGTCCGTTTCTC-3 '.
Wherein, lowercase is partly represented the tag of 10bp.
(2) amplification contains the fragment of hepatitis B virus reversed transcriptive enzyme district 180 bit codons
PCR fragment reaction length scale is 101bp, and reaction system is 5ul, wherein contains 4mM Mg2+, 1 * damping fluid, 100nM primer, 500uM dNTP, 0.5U HotstarTaq; Reaction conditions: 95 ℃ of 15min; 45 circulations (94 ℃ of 20s, 56 ℃ of 30s, 72 ℃ of 1min); 72 ℃ of 3min.After the PCR reaction, the copy number that has that section nucleotide sequence in mutational site among the hepatitis B virus gene group DNA has obtained amplification.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and handle.
(3) SAP handles
The PCR reaction product is handled through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme, reaction cumulative volume are 7ul (2ul SAP+5ul PCR product).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
The product that to obtain a clip size behind the extension be 18bp, it with the difference of extending primer (17bp) only be 3 ' end many a base.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and further the resolving power of total system improves again.The extension system is 9ul, and the reaction density of all ingredients such as damping fluid, ddNTPs (quality is through modifying), extension primer, iPLEX enzyme is different because of the difference of reaction clump number, and the reaction cumulative volume is 9ul (2ul extends mix+7ul SAP processing product).Reaction conditions: 94 ℃ of 30s; 40 circulations { 94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s) }; 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
(5) resin purification
Add the 6mg resin in the product of extension, 30min turns upside down.Through the reaction of this step, resin combines positively charged ion abundant and in the reaction system, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into mass spectrometric valve tube with this crystal, excite with instantaneous nanosecond light laser then, can carry out MALDI-TOF-MS and analyze.Criterion is as follows: if medicament-resistant mutation does not take place, the mass spectrum result of extension products is: 5 '-GCCTCAGTCCGTTTCTCC-3 ' or 5 '-GCCTCAGTCCGTTTCTCT-3 ', molecular weight are respectively 5335.5Da and 5415.4Da; If the generation medicament-resistant mutation, the mass spectrum result of extension products is: 5 '-GCCTCAGTCCGTTTCTCA-3 ', molecular weight are 5359.5Da.
Detected result is as follows:
The negative check sample of sample A1 wherein, sample B 1 and C1 are sample to be tested.For negative control sample A1, because medicament-resistant mutation does not take place for it, so the molecular weight of extension products is 5415.4Da (seeing Figure 1A); For sample B 2, mass spectrometric detection to molecular weight be 5359.5Da, can determine that medicament-resistant mutation (seeing Figure 1B) has taken place sample B 2; For sample C1, two peaks have appearred on the mass spectrum, respectively at 5359.5Da and 5415.4Da, can infer to have wild strain and mutant strain (seeing Fig. 1 C) in this sample.
(1) primer of design amplification hepatitis B virus reversed transcriptive enzyme district 181 bit codons
Hepatitis B virus gene group reversed transcriptive enzyme district 181 bit codon GCT become GTT or ACT, make amino acid become Xie Ansuan or Threonine (A181V/T) by L-Ala, thus the resistance of the virus drugs adefovir ester that creates antagonism.
For the mass spectrometric detection in this mutational site, according to the sequence of hepatitis B virus gene group (the NCBI accession number:
NC_003977), design 1 pair of PCR primer and 5 extension primers, the PCR primer is:
Upstream: 5 '-acgttggatgAAGATTCCTATGGGAGTGGG-3 ';
Downstream: 5 '-acgttggatgAGCCCTACGAACCACTGAAC-3 '.
Wherein, lowercase is partly represented the tag of 10bp.Owing to also undergo mutation easily in 180 sites, upstream in 181 sites, promptly C/TTG also can become ATG, and also can undergo mutation in 184 sites, downstream, become GGT by ACT, so designed 3 merger extension primers at first base of 181 codons, is respectively:
181#1#1：5’-TCAGTCCGTTTCTCTTG-3’，
181#1#2：5’-TCAGTCCGTTTCTCCTG-3’，
181#1#3：5’-TCAGTCCGTTTCTCATG-3’。
Its second codon designed 2 and annexed the extension primer, is respectively:
181#2#1：5’-ATGGCACTAGTAAACTGA-3’，
181#2#2：5’-TGGCACTACCAAACTGA-3’。
(2) amplification contains the fragment of hepatitis B virus reversed transcriptive enzyme district 181 bit codons
PCR fragment reaction length scale is 98bp, and reaction system is 5ul, wherein contains 4mM Mg2+, 1 * damping fluid, 100nM primer, 500uM dNTP, 0.5U HotstarTaq; Reaction conditions: 95 ℃ of 15min; 45 circulations (94 ℃ of 20s, 56 ℃ of 30s, 72 ℃ of 1min); 72 ℃ of 3min.After the PCR reaction, the copy number that has that section nucleotide sequence in mutational site among the hepatitis B virus gene group DNA has obtained amplification.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and handle.
(3) the SAP enzyme is handled
The PCR reaction product is handled through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme, reaction cumulative volume are 7ul (2ul SAP+5ul PCR product).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
The product that to obtain a clip size behind the extension be 18bp, it with the difference of extending primer only be 3 ' end many a base.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and further the resolving power of total system improves again.The extension system is 9ul, and the reaction density of all ingredients such as damping fluid, ddNTPs (quality is through modifying), extension primer, iPLEX enzyme is different because of the difference of reaction clump number, and the reaction cumulative volume is 9ul (2ul extends mix+7ulSAP processing product).Reaction conditions: 94 ℃ of 30s; 40 circulations { 94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s) }; 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
(5) resin purification
Add the 6mg resin in the product of extension, 30min turns upside down.Through the reaction of this step, resin combines positively charged ion abundant and in the reaction system, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into mass spectrometric valve tube with this crystal, excite with instantaneous nanosecond light laser then, can carry out MALDI-TOF-MS and analyze.Somatotype is the result judge according to molecular weight, and standard is as follows: 181#1#1, and wild-type is 5405.5Da, mutant is 5389.5Da; 181#1#2, wild-type is 5390.5Da, mutant is 5374.5Da; 181#1#3, wild-type is 5414.6Da, mutant is 5398.5Da; 181#2#1, wild-type is 5818.8Da, mutant is 5802.8Da; 181#2#2, wild-type is 5450.6Da, mutant is 5434.6Da.
Detected result is as follows:
Sample A2, B2, C2, D2 and E2 are clinical sample to be tested.Sample A2 detects wild-type and mutant by 181#1#1, so the molecular weight of extension products is respectively 5405.5Da and 5389.5Da (seeing Fig. 2 A); Sample B 2 detects wild-type and mutant by 181#1#2, so the molecular weight of extension products is respectively 5390.5Da and 5374.5Da (seeing Fig. 2 B); Sample C2 detects wild-type and mutant by 181#1#3, so the molecular weight of extension products is respectively 5414.6Da and 5398.5Da (seeing Fig. 2 C); Sample D2 detects wild-type and mutant by 181#2#1, so the molecular weight of extension products is respectively 5818.8Da and 5802.8Da (seeing Fig. 2 D); Sample E2 detects mutant by 181#2#2, so the molecular weight of extension products is 5434.6Da (seeing Fig. 2 E).
(1) KRAS gene the 12nd, 13 bit codon mutation detects design of primers
The KRAS gene claims murine sarcoma virus oncogene homologue gene again, and its function and GTP enzymic activity are closely related.Whether detection KRAS gene suddenlys change and can predict the curative effect of colorectal carcinoma patient to Cetuximab (Erbitux, Erbitux, Bristol Myers Squibb), has been classified as one of the gene project that detects of recommending by NCCN; Of paramount importance first exons 1,2,13 bit codons that sport of KRAS, wild-type 12,13 bit codons are GGTGGC, there is various mutations in it; 12, the sudden change of 13 bit codons the one or two bit base can cause the change of coded amino acid, and then influences the function of KRAS gene expression product.
For the mass spectrometric detection in this mutational site, according to sequence (the NCBI accession number: EU332849), design 1 pair of PCR primer and 10 extension primers of KRAS gene.Because the 1st, 2 base of KRAS gene the 12nd, 13 bit codon all may be undergone mutation, so take the method for both sides design and degenerate primer design.KRAS primer sequence table sees Table 1.
Table 1
| Primer?ID | SEQUENCE (from 5 ' to 3 ') |
| PCR-F | acgttggatgGGCCTGCTGAAAATGACTGA |
| PCR-R | acgttggatgGTTGGATCATATTCGTCCAC |
| KRAS13c2 | AGGCACTCTTGCCTACG |
| KRAS12c1A | TGTGGTAGTTGGAGCTA |
| KRAS12c1T | CTTGTGGTAGTTGGAGCTT |
| KRAS12c1G | AACTTGTGGTAGTTGGAGCTG |
| KRAS12c1C | ATAAACTTGTGGTAGTTGGAGCTC |
| KRAS13c2T | GGCACTCTTGCCTACGA |
| KRAS12c1 | TTGTGGTAGTTGGAGCT |
| KRAS13c2G | AAGGCACTCTTGCCTACGC |
| KRAS13c2A | TCAAGGCACTCTTGCCTACGT |
| KRAS13c2C | CGTCAAGGCACTCTTGCCTACGG |
(2) amplification contains the fragment of the 136bp of KRAS12,13 bit codons
PCR fragment reaction length scale is 136bp, and reaction system is 5ul, wherein contains 4mM Mg2+, 1 * damping fluid, 100nM primer, 500uM dNTP, 0.5U HotstarTaq; Reaction conditions: 95 ℃ of 15min; 45 circulations (94 ℃ of 20s, 56 ℃ of 30s, 72 ℃ of 1min); 72 ℃ of 3min.After the PCR reaction, have easy sudden change 12,13 among the KRAS and obtained amplification for the copy number of that section nucleotide sequence in codon site.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and handle.
(3) SAP handles
The PCR reaction product is handled through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme, reaction cumulative volume are 7ul (2ul SAP+5ul PCR product).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
Obtain the product of a clip size scope in the 19-29bp scope behind the extension, it only has been with the difference of extending primer how 3 ' held a base.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and further the resolving power of total system improves again.The extension system is 9ul, and the reaction density of all ingredients such as damping fluid, ddNTPs (quality is through modifying), extension primer, iPLEX enzyme is different because of the difference of reaction clump number, and the reaction cumulative volume is 9ul (2ul extends mix+7ul SAP processing product).Reaction conditions: 94 ℃ of 30s; 40 circulations { 94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s) }; 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
(5) resin purification
Add the 6mg resin in the product of extension, 30min turns upside down.Through the reaction of this step, resin combines positively charged ion abundant and in the reaction system, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into mass spectrometric valve tube with this crystal, excite with instantaneous nanosecond light laser then, can carry out MALDI-TOF-MS and analyze.Somatotype is the result judge according to molecular weight, and standard is as follows: as KRAS12c1, wild-type is 5574.6Da, and mutant has three kinds of mass spectrum quality, is respectively 5534.6Da, 5558.6Da, 5614.5Da; KRAS12c1G, wild-type is 6819.5Da, mutant has three kinds of mass spectrum quality and is respectively 6779.4Da, 6803.5Da, 6859.3Da.
Detected result is as follows:
The negative check sample of sample A3 wherein, sample B 3 and C3 are sample to be tested.For negative control sample A3, because codon do not undergo mutation, so KRAS12c1 and KRAS12c1G extension products molecular weight are 5574.6Da (Fig. 3 A-1) and 6819.5Da (Fig. 3 A-2); For sample B 3, the molecular weight of mass spectrometric detection KRAS12c1 product is 5614.5Da and 5574.6Da, can determine that the sudden change (Fig. 3 B) of KRAS12 bit codon first base has taken place sample B 3; For sample 3C, the molecular weight of mass spectrometric detection KRAS12c1G product is respectively at 6819.5Da and 6803.5Da, can infer the sudden change (seeing Fig. 3 C) that has KRAS12 bit codon second base in this sample.
Embodiment 4
(1) primer of design amplification hepatitis B virus reversed transcriptive enzyme district 180,204,250 and 184 bit codons
Hepatitis B virus gene group reversed transcriptive enzyme district 180 bit codon TTG or CTG become ATG, and 204 bit codon ATG become ATT, and 250 bit codon ATG become GTG, and 184 bit codon ACT become GCT, thereby produce the antiviral resistance.
For the mass spectrometric detection in these mutational sites, according to the sequence of hepatitis B virus gene group (the NCBI accession number: NC_003977), design 1 pair of PCR primer and 4 and extend primers, the PCR primer is:
Upstream: 5 '-acgttggatg AAGATTCCTATGGGAGTGGG-3 ';
Downstream: 5 '-acgttggatg ACCCCAACTTCCAATTACAT-3 '.
Wherein, lowercase is partly represented the tag of 10bp.
Article 4, extend respectively corresponding 4 detection site of primer, information is as follows:
180：5’-GCCTCAGTCCGTTTCTC-3’
204：5’-CCCCCAATACCACATCATC-3’
250：5’-GGGCTACTCCCTTAACTTC-3’
184：5’-ACTGAACAAATGGCACTAC-3
(2) amplification contains the fragment of hepatitis B virus reversed transcriptive enzyme district 181 bit codons
PCR fragment reaction length scale is 293bp, and reaction system is 5ul, wherein contains 4mM Mg2+, 1 * damping fluid, 100nM primer, 500uM dNTP, 0.5U HotstarTaq; Reaction conditions: 95 ℃ of 15min; 45 circulations (94 ℃ of 20s, 56 ℃ of 30s, 72 ℃ of 1min); 72 ℃ of 3min.After the PCR reaction, the copy number that has that section nucleotide sequence in mutational site among the hepatitis B virus gene group DNA has obtained amplification.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and handle.
(3) the SAP enzyme is handled
The PCR reaction product is handled through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme, reaction cumulative volume are 7ul (2ul SAP+5ul PCR product).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
The product that to obtain 4 clip size behind the extension be 18-29bp, it with the difference of extending primer only be 3 ' end many a base.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and further the resolving power of total system improves again.The extension system is 9ul, and the reaction density of all ingredients such as damping fluid, ddNTPs (quality is through modifying), extension primer, iPLEX enzyme is different because of the difference of reaction clump number, and the reaction cumulative volume is 9ul (2ul extends mix+7ulSAP processing product).Reaction conditions: 94 ℃ of 30s; 40 circulations { 94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s) }; 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
(5) resin purification
Add the 6mg resin in the product of extension, 30min turns upside down.Through the reaction of this step, resin combines positively charged ion abundant and in the reaction system, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into mass spectrometric valve tube with this crystal, excite with instantaneous nanosecond light laser then, can carry out MALDI-TOF-MS and analyze.Somatotype is the result judge according to molecular weight, and standard is as follows: 180, and wild-type is 5335.5Da, mutant is 5359.5Da; 204, wild-type is 5868.9Da, and mutant is 5892.9Da; 250, wild-type is 5985.9Da, and mutant is 6001.9Da; 184, wild-type is 6037.0Da, and mutant is 6116.9Da.
Detected result is as follows:
Sample A4 is clinical sample to be tested.As can be seen from the figure, by reaction this time, realized that 4 sites detect (Fig. 4 A) simultaneously.Wherein detecting 180 sites is wild-type, and molecular weight is 5335.5Da (Fig. 4 B); 204 sites are wild-type, and molecular weight is 5868.9Da (Fig. 4 C); 250 sites are wild-type, and molecular weight is 5985.9Da (Fig. 4 D); 184 sites are mutant, and molecular weight is 6116.9Da (Fig. 4 E).
The above only is preferred embodiment of the present invention, not in order to restriction the present invention, all any modifications of being done within the spirit and principles in the present invention, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.
Claims (8)
1, a kind of detection method of nucleotide mutant site comprises the steps:
(1) mutational site that may exist, and the position of definite mutational site in sequence to be checked at nucleotide sequence to be checked;
(2) according to the position in mutational site, design 3 primers, wherein, a pair of is amplimer, and every primer length is 30bp at least, and its 5 ' end respectively contains the tag of 10bp; Another is for extending primer, and length is 17-28bp, just in time is positioned at the 5 ' end in mutational site;
(3), obtain to contain the target sequence amplified production in described mutational site by pcr amplification;
(4) handle by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) by extension, connect a base at the 3 ' end that extends primer, and this base just in time with the mutational site on base complementrity, the employed raw material of extension is to be that purpose was carried out four kinds of ddNTP molecules that quality is modified to enlarge molecular weight difference;
(6) adopt resin purification extension product;
(7) with product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then and carry out mass spectrometric detection, determine the genotype of sudden change.
2, the detection method of nucleotide mutant site as claimed in claim 1 is characterized in that, described target sequence amplified production length is 80-120bp.
3, the detection method of nucleotide mutant site as claimed in claim 1 is characterized in that, the molecular weight of four kinds of ddNTP that described process quality is modified is respectively ddATP 271.2Da, ddTTP 327.1Da, ddCTP 247.2Da, ddGTP 287.2Da.
4, the detection method of nucleotide mutant site as claimed in claim 1, it is characterized in that, described step (2) also comprises: according between primer, do not form dimer, hairpin structure between primer and amplified production, and the principle that mispairing does not take place, the amplimer of a plurality of detection site is mixed with amplimer, extend primer and mix with the extension primer.
5, the detection method of nucleotide mutant site as claimed in claim 1, it is characterized in that, nucleotide mutant site to be detected is for a plurality of continuously, these continuous a plurality of mutational sites are marked at same nucleotides sequence and list, and shared a pair of amplimer, both sides design is to the left and right taked in the mutational site at two ends, and the extension primer in mutational site, left side is taked the forward design, and the extension primer in mutational site, right side is taked reverse design; The extension primer that is positioned at the intermediary mutational site has many, and comprises all Nucleotide situations that the mutational site of its upstream may exist.
6, the detection method of nucleotide mutant site as claimed in claim 5 is characterized in that, the length of amplified production is 100-350bp.
7, the detection method of nucleotide mutant site as claimed in claim 5 is characterized in that, if described left side mutational site Snp1, the intermediary mutational site is Snp2, and the mutational site, right side is Snp3, and Snp1/Snp2/Snp3 place sequence is:
... ..TCAGCGATAT[C/T] C[G/A] [T/G] AATTCGTACGATGATCGCTAGA......, Snp1[C/T then], SNP site, right side, the forward design, the extension primer is: ... TCAGCGATATSnp3[T/G], SNP site, left side, reverse design, the extension primer is: ... TACGAATTSnp2[G/A], middle SNP site, degenerate primer, extend primer and be: ... AGCGATATCC and ... AGCGATATTC.
As the detection method of each described nucleotide mutant site of claim 1～7, it is characterized in that 8, described mass spectrograph is a ground substance assistant laser desorption ionization time-of-flight mass spectrometer.
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102183444A CN101440407A (en) | 2008-12-12 | 2008-12-12 | Method for detecting nucleotide mutant site |
| CN 200910177851 CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
| CN200910178449.6A CN101760566B (en) | 2008-12-12 | 2009-09-29 | Detection method on mutant site of ribonucleotide of HBV gene |
| HK10108989.4A HK1142635A1 (en) | 2008-12-12 | 2010-09-21 | A method used for the detection of resistant gene mutations in hepatitis b virus |
| HK10110035.4A HK1143610A1 (en) | 2008-12-12 | 2010-10-25 | A method used for the detection of kras and/or braf gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102183444A CN101440407A (en) | 2008-12-12 | 2008-12-12 | Method for detecting nucleotide mutant site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101440407A true CN101440407A (en) | 2009-05-27 |
Family
ID=40725016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008102183444A Pending CN101440407A (en) | 2008-12-12 | 2008-12-12 | Method for detecting nucleotide mutant site |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101440407A (en) |
| HK (2) | HK1142635A1 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146486A (en) * | 2011-04-01 | 2011-08-10 | 上海邃志生物科技有限公司 | Group of nucleotide sequences for detecting gene mutants of hepatitis B virus (HBV) and use thereof |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN103602740A (en) * | 2013-11-06 | 2014-02-26 | 毅新兴业（北京）科技有限公司 | Method and kit for identifying free DNAs in serum by adopting mass spectrometer and applications of method and kit |
| CN105734118A (en) * | 2014-12-10 | 2016-07-06 | 博淼生物科技（北京）有限公司 | Establishment of SNP (Single Nucleotide Polymorphisms) genotyping method (MS-SSTA) based on time of flight mass spectrometry and combining with specific Tags sequence |
| CN106068329A (en) * | 2014-01-08 | 2016-11-02 | 基诺泰科有限公司 | Utilize 5 ' the repressed archaeal dna polymerases of flap endonuclease activity the method detecting mutant gene by real-time polymerase chain reaction |
| CN110527718A (en) * | 2018-05-25 | 2019-12-03 | 丰技生物科技股份有限公司 | The detection method of the SNP site of SMA gene |
-
2008
- 2008-12-12 CN CNA2008102183444A patent/CN101440407A/en active Pending
-
2010
- 2010-09-21 HK HK10108989.4A patent/HK1142635A1/en unknown
- 2010-10-25 HK HK10110035.4A patent/HK1143610A1/en unknown
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146486A (en) * | 2011-04-01 | 2011-08-10 | 上海邃志生物科技有限公司 | Group of nucleotide sequences for detecting gene mutants of hepatitis B virus (HBV) and use thereof |
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
| CN103013993B (en) * | 2012-12-26 | 2016-06-29 | 武汉康圣达医学检验所有限公司 | The method of primer and this primer Mass Spectrometer Method PIK3CA hotspot mutation |
| CN103602740A (en) * | 2013-11-06 | 2014-02-26 | 毅新兴业（北京）科技有限公司 | Method and kit for identifying free DNAs in serum by adopting mass spectrometer and applications of method and kit |
| CN106068329A (en) * | 2014-01-08 | 2016-11-02 | 基诺泰科有限公司 | Utilize 5 ' the repressed archaeal dna polymerases of flap endonuclease activity the method detecting mutant gene by real-time polymerase chain reaction |
| CN106068329B (en) * | 2014-01-08 | 2020-03-27 | 基诺泰科有限公司 | Method for detecting mutant gene by real-time polymerase chain reaction |
| CN105734118A (en) * | 2014-12-10 | 2016-07-06 | 博淼生物科技（北京）有限公司 | Establishment of SNP (Single Nucleotide Polymorphisms) genotyping method (MS-SSTA) based on time of flight mass spectrometry and combining with specific Tags sequence |
| CN110527718A (en) * | 2018-05-25 | 2019-12-03 | 丰技生物科技股份有限公司 | The detection method of the SNP site of SMA gene |
Also Published As
| Publication number | Publication date |
|---|---|
| HK1143610A1 (en) | 2011-01-07 |
| HK1142635A1 (en) | 2010-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Teer et al. | Systematic comparison of three genomic enrichment methods for massively parallel DNA sequencing | |
| US6660229B2 (en) | Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing | |
| AU2006272776B2 (en) | Methods for rapid identification and quantitation of nucleic acid variants | |
| CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
| CN101760566B (en) | Detection method on mutant site of ribonucleotide of HBV gene | |
| CN101440407A (en) | Method for detecting nucleotide mutant site | |
| Leushner et al. | Automated mass spectrometry: a revolutionary technology for clinical diagnostics | |
| WO2022033407A1 (en) | Product for detecting dna/rna by using nucleic acid mass spectrometry and detection method | |
| CN103261437B (en) | Genotyping method for hpa and primers used | |
| CN107513578A (en) | A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene | |
| KR102121570B1 (en) | KASP primer set based on SNP for discriminating or classifying Panax ginseng cultivar or resource and uses thereof | |
| CN108165618B (en) | DNA sequencing method containing nucleotide and 3' end reversible closed nucleotide | |
| EP2013366B1 (en) | Sequencing of the L10 codon of the HIV gag gene | |
| KR101287431B1 (en) | Primer composition for amplifying genetic region having various genetic variations in target genes, method for amplifying the target genes using the same, PCR amplification kit comprising the same and method for analyzing the genotype of the target genes | |
| KR101254663B1 (en) | The method for detecting resistance mutations of influenza virus gene against anti-viral agents using pyrosequencing | |
| WO2011145614A1 (en) | Method for designing probe for detecting nucleic acid reference material, probe for detecting nucleic acid reference material, and nucleic acid detection system having probe for detecting nucleic acid reference material | |
| CN102586472B (en) | Method and kit for assaying hepatitis B virus DNA (deoxyribonucleic acid) sequence | |
| de Paula Careta et al. | Recent patents on high-throughput single nucleotide polymorphism (SNP) genotyping methods | |
| Pettersson et al. | Allelotyping by massively parallel pyrosequencing of SNP‐carrying trinucleotide threads | |
| CN114480594B (en) | Method for detecting multiple single nucleotide polymorphisms, kit and application thereof | |
| CN110106231B (en) | Method for detecting methylation modification of adenine N6 or N1 bit in nucleic acid by using dUTP or dTTP | |
| Al-Turkmani et al. | Molecular assessment of human diseases in the clinical laboratory | |
| CN105648084A (en) | Method for detecting base continuous mutation sequence through realtime synthesis sequencing of dinuclear nucleotide | |
| Jamaluddin et al. | A review on the Variable copies of CC motif Chemokine Ligand 3 Like 1 (CCL3L1) Gene among Different Populations and Current Methods for Quantification. | |
| CN117247993A (en) | Pretreatment method for detecting mRNA capping efficiency, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |