WO2013049975A1

WO2013049975A1 - Kit and method for detecting mutation of predetermined site in dna sample and use thereof

Info

Publication number: WO2013049975A1
Application number: PCT/CN2012/001382
Authority: WO
Inventors: 冯大飞; 邹婧; 刘兴旺; 王夏曼; 汪建; 王俊; 杨焕明
Original assignee: 深圳华大基因科技有限公司; 深圳华大基因研究院
Priority date: 2011-10-08
Filing date: 2012-10-12
Publication date: 2013-04-11
Also published as: TW201315812A; CN102409089B; CN102409089A

Abstract

Provided in the present invention are a primer, a kit and a method for detecting the mutation of a predetermined site in a DNA sample, and the use thereof. The method for detecting the mutation of a predetermined site in a DNA sample comprises the following steps: a PCR amplification reaction is carried out on the DNA samples using an amplification primer; an oligonucleotide extension reaction is carried out using an extension primer and ddNTP and taking the resulting amplification product as a template, so as to obtain an extension product with one base on the 3' terminus of the extension primer; and the mutation type of the predetermined site is determined based on the molecular weight of the extension product.

Description

Kit, method and application for detecting mutation of a predetermined site in a DNA sample

The present invention relates to kits, primer combinations, methods and uses for detecting mutations at predetermined sites in a DNA sample.

Background technique

The formation of mutations at specific sites is a commonly used research tool in molecular biology experiments and can help to analyze the effect of point mutations at specific sites on gene function. In general, it is a problem faced by those skilled in the art how to mutate the site correctly after constructing the target mutant.

However, in the field of molecular biology, the detection of specific site mutations still needs to be improved.

Summary of the invention

The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, it is an object of the present invention to provide a method for efficiently detecting a mutation at a predetermined site in a DNA sample.

According to a first aspect of the invention, the invention provides a method of detecting a mutation in a predetermined site in a DNA sample. According to an embodiment of the present invention, the method comprises the steps of: performing a PCR amplification reaction on the DNA sample using an amplification primer to obtain an amplification product, the amplification product comprising the predetermined site; using an extension primer and Dd TP, using the amplification product as a template, performing an oligonucleotide extension reaction to obtain an extension product linking one base at the 3' end of the extension primer, wherein the 3' end of the extension primer is in close proximity The predetermined site; performing molecular weight detection on the extension product to obtain a molecular weight of the extension product; and determining a mutation type of the predetermined site based on a molecular weight of the extension product. Since the extension reaction is based on an amplification product containing a predetermined site, and the 3' end of the extension primer for performing the extension reaction is immediately adjacent to the predetermined site, and ddNTP is used as a raw material in the extension reaction, the extension reaction can be ensured. It is possible to extend only one base, that is, to correspond to a predetermined site, and there is a significant difference based on the molecular weight of each different base. Therefore, by detecting the molecular weight of the extension product, it can be determined by the molecular weight of the obtained extension product. Whether a mutation has occurred at a predetermined site, and the type of mutation that has occurred. Thus, it can be widely applied to the field of molecular biology, for example, to detect whether a corresponding mutant has been successfully constructed.

According to an embodiment of the present invention, the above method of detecting a mutation at a predetermined site in a DNA sample may further have the following additional technical features:

According to an embodiment of the invention, the DNA sample is human whole genome DNA. Thereby, it is possible to effectively detect mutations in genes in humans.

According to an embodiment of the present invention, the mutation at the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and mtDNA. Thereby, gene mutations related to deafness can be effectively detected.

According to an embodiment of the present invention, the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, and 176-191dell6.

At least one of 299_300delAT and 235delC, wherein the mutation of the GJB3 gene is one less than one selected from the group consisting of 5380T and 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A. >G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and at least one of IVS15+5G>A, and the mutation of the mtDNA is selected from 1494 T and 1555A> At least one of G. Thereby, gene mutations related to hereditary deafness can be effectively detected.

According to an embodiment of the present invention, the amplification primer comprises a first panel and a second panel, wherein, for the 35ddG mutation of the GJB2 gene, the first primer is as SEQ ID NO: As shown in Figure 1, the second primer is as set forth in SEQ ID NO: 2, the extension primer is as set forth in SEQ ID NO: 33; and the 167delT mutation is directed to the GJB2 gene, the first primer is SEQ. ID NO: 3, the second primer is as shown in SEQ ID NO: 4, the extension primer is as shown in SEQ ID NO: 34; the 176-191dell6 mutation against the GJB2 gene, the One primer is as shown in SEQ ID NO: 5, the second primer is as shown in SEQ ID NO: 6, and the extension primer is as SEQ ID NO: 35; for the 299_300delAT mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 7, and the second primer is as SEQ ID NO: 8; f indicates that the extension The primer is as set forth in SEQ ID NO: 36; for the 235delC mutation of the GJB2 gene, the first bow is as shown in SEQ ID NO: 9, and the second bow is as SEQ ID NO: As shown in Figure 10, the extension primer is as set forth in SEQ ID NO: 37; for the 538C>T mutation of the GJB3 gene, the first primer is as shown in SEQ ID NO: 11, and the second primer is As shown in SEQ ID NO: 12, the extension primer is as set forth in SEQ ID NO: 38; for the 547G>A mutation of the GJB3 gene, the first primer is as shown in SEQ ID NO: 13, The second primer is as set forth in SEQ ID NO: 14, and the extension primer is as set forth in SEQ ID NO: 39; for the 2810T mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: 15. The second primer is as set forth in SEQ ID NO: 16, the extension primer is as set forth in SEQ ID NO: 40; and the 589G>A mutation is directed to the SLC26A4 gene, the first primer is as SEQ ID NO: 17, the second primer is as set forth in SEQ ID NO: 18, the extension primer is as set forth in SEQ ID NO: 41; the 919-2A>G mutation against the SLC26A4 gene, The first primer is set forth in SEQ ID NO: 19, the second primer is set forth in SEQ ID NO: 20, and the extension primer is as set forth in SEQ ID NO: 42; for the SLC26A4 gene 1174A>T mutation, the first primer is as shown in SEQ ID NO: 21, the second primer is as shown in SEQ ID NO: 22, and the extension primer is as shown in SEQ ID NO: 43; The 1226G>A mutation of the SLC26A4 gene, the first primer is set forth in SEQ ID NO: 21, the second primer is set forth in SEQ ID NO: 22, and the extension primer is SEQ ID NO: 44; for the 12290T mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 21, the second primer is as shown in SEQ ID NO: 22, and the extension primer is as SEQ. ID NO: 45; for the 1975G>C mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 25, and the second primer is as shown in SEQ ID NO: The extension primer is as set forth in SEQ ID NO: 47; for the 2027T>A mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 25, and the second primer is as SEQ ID NO: : 26, the extension primer is as set forth in SEQ ID NO: 48; for the 21620T mutation of the SLC26A4 gene, the first bow is as shown in SEQ ID NO: 27, the second bow The first substance is as shown in SEQ ID NO: 28, and the extension is as shown in SEQ ID NO: 49; for the 2168A>G mutation of the SLC26A4 gene, the first element is as SEQ ID NO: 27, the second bow is as set forth in SEQ ID NO: 28, the extension primer is as set forth in SEQ ID NO: 50, and the IVS15+5G>A mutation is directed to the SLC26A4 gene, The first primer is set forth in SEQ ID NO: 23, the second primer is set forth in SEQ ID NO: 24, and the extension primer is as set forth in SEQ ID NO: 46; a 14940T mutation, the first primer is set forth in SEQ ID NO: 29, the second primer is set forth in SEQ ID NO: 30, and the extension primer is as set forth in SEQ ID NO: 51; mtD a 1555 A>G mutation of the NA gene, the first primer is set forth in SEQ ID NO: 31, the second primer is set forth in SEQ ID NO: 32, and the extension primer is as SEQ ID NO: 52 Shown.

For convenience of presentation, the above primer combinations are summarized in Tables 1 and 2, respectively.

Table 1: Amplification primers for the above 20 deafness gene mutation sites.

Sequence number * Primer sequence 5' 3'** Primer description

SEQ ID NO: l AGATCTTTCCAATGCTGGTG

Amplification primer for amplification site 35delG

SEQ ID NO: 2 AGAGTAGAAGATGGATTGGG

SEQ ID NO: 3 AAAGGAGGTGTGGGGAGATG amplification primer for amplification site 167delT

SEQ ID NO:4 GATCGTAGCACACGTTCTTG

SEQ ID NO 5 AGGCCGACTTTGTCTGCAAC for amplification site 176 191dell6 amplification primer

SEQ ID NO: 6 TGGGAGATGGGGAAGTAGTG

SEQ ID NO: 7 CTTCGATGCGGACCTTCTG for amplification site 299 300delAT amplification primer

SEQ ID NO: 8 CTCCTAGTGGCCATGCACG

SEQ ID NO: 9 TGGCGTGGACACGAAGATCA

Amplification primer for amplification site 235delC

SEQ ID NO: 10 ACTTCCCCATCTCCCACATC

SEQ ID NO: 11 CCAACATCGTGGACTGCTAC Amplification Primer for Amplification Site 5380T SEQ ID NO: 12 CCACCATGAAGTAGGTGAAG

SEQ ID NO: 13 CCACCATGAAGTAGGTGAAG

Amplification primer for amplification site 547G>A

SEQ ID NO: 14 CAACATCGTGGACTGCTACA

SEQ ID NO: 15 TAGTGACGTCATTTCGGGAG

Amplification primer for amplification site 281C>T

SEQ ID NO: 16 ACCAGAACTCTCAATCTGCC

SEQ ID NO: 17 CTTGTAAGTTCATTACCTG

Amplification primer for amplification site 589G>A

SEQ ID NO: 18 TAGAGATACAGCTAGAGTCC

SEQ ID NO: 19 CCAGGTTGGCTCCATATGAA

Amplification primer for amplification site 919-2A>G

SEQ ID NO: 20 CCAATGGAGTTTTTAACATC

SEQ ID NO: 21 CCAGTCTCTTCCTTAGGAAT for amplification sites 1174A>T, 1226G>A and

SEQ ID NO:22 Amplification Primer for GTTCCTACCTGTGTCTTTCC 1229C>T

SEQ ID NO:23 AGAAAACAAATTTCTAGGG amplification site for amplification site IVS15+5G>A

SEQ ID NO: 24 TTCTATGGCAATGTCGATGG

SEQ ID NO:25 CAGAAAACCAGAACCTTACC for amplification site 1975G>C禾 P 2027T>A

SEQ ID NO:26 Amplification Primer for ACGTTCCCAAAGTGCCAATC

SEQ ID NO:27 GACAACATTAGAAAGGACAC for amplification sites 2162C>T and 2168A>G

SEQ ID NO:28 Amplification Primer for GATTTCACTTGGTTCTGTAG

SEQ ID NO:29 TACGATAGCCCTTATGAAAC

Amplification primer for amplification site 14940T

SEQ ID NO: 30 GGGGTTTTAGTTAAATGTCC

SEQ ID NO:31 AGCTCAGAGCGGTCAAGTTA

Amplification primer for amplification site 1555A>G

SEQ ID NO:32 CTAAAACCCCTACGCATTTA

*: For every water

The first primer (sometimes referred to as the upstream primer) and the second primer (sometimes referred to as the downstream primer).

**: According to one embodiment of the present invention, the first primer of the amplification primer and the 5' end of the second primer may both have a tag sequence of 10 bases acgttggatg (SEQ ID NO: 53), the inventors found that By adopting the above-described tag sequence, the molecular weights of the above-described first primer and second primer can be made to be out of the detection range of the mass spectrometer, whereby the accuracy and efficiency of detection can be further improved.

Table 2: Extension primers for the above 20 deafness gene mutation sites.

Sequence number primer sequence primer description

SEQ ID NO:33 TTTGTTCACACCCCC Site Extension primer for 35delG

SEQ ID NO:34 gggcCTTTGTCTGCAACACCC Site Extension primer for 167delT

SEQ ID NO: 35 ctccGCAACACCCTGCAGCCAG Site Extension primer for 176_191dell6

SEQ ID NO: 36 gcTGAACTTCCTCTTCTTCTC site EZ_300delAT extension primer

SEQ ID NO:37 ggATCCTGCTATGGGCC Site Extension primer for 235delC

SEQ ID NO:38 ccctaGTGGACTGCTACATTGCC Site 538 T Extension Primer

SEQ ID NO: 39 ctgcAGTAGGTGAAGATTTTCTTCT locus 547G>A extension primer

SEQ ID NO: 40 GTCATTTCGGGAGTTAGTA Site Extension primer for 2810T

SEQ ID NO:41 CTTGTAAGTTCATTACCTGTATAATTC Site Extension primer for 589G>A

SEQ ID NO:42 GCAGTAGCAATTATCGTC Site Extension primer for 919-2A>G

SEQ ID NO: 43 GCCTTTGGGATCAGC Site Extension primer for 1174A>T

SEQ ID NO:44 CACCACTGCTCTTTCCC Site Extension primer for 1226G>A

SEQ ID NO:45 ttCCACCACTGCTCTTTCCCCCA Site Extension primer for 12290T

SEQ ID NO:46 AAAACAAATTTCTAGGGATAAAATA Site Extension primer for IVS15+5G>A

SEQ ID NO:47 CTCCACAGTCAAGCA Site Extension primer for 1975G>C

SEQ ID NO:48 AGAACCTTACCACCCGC Extension primer for site 2027T>A SEQ ID NO:49 Extension primer for CAGAGTATAGCATCAAGGACC site 2162C>T

SEQ ID NO:50 TCTGTAGATAGAGTATAGCATCA Site 2168A>G Extension Primer

SEQ ID NO: 51 CGTACACACCGCCCGTCAC Site Extension primer for 14940T

SEQ ID NO: 52 ACTTACCATGTTACGACTTG locus 1555A>G extension primer

As shown in Tables 1 and 2, the length of the amplification primer is about 30 bases, and the length of the extension primer is 17-28 bases. Further, the inventors have found that, based on the aforementioned primer combination, the molecular weight difference between the extended primer at different sites and the extension product, the extension product and the extension product is not less than 30D. The inventors of the present invention have surprisingly found that by using the primer combinations described above, it is possible to detect the listed mutation types very efficiently, and is suitable for simultaneously detecting a plurality of mutation types of a plurality of sites, according to an embodiment of the present invention, At the same time, the above 20 mutation types were accurately and quickly detected.

According to an embodiment of the present invention, before the performing the oligonucleotide extension reaction, the method further comprises the step of treating the amplification product with alkaline phosphatase. Thus, by treating the amplified product with alkaline phosphatase, the dNTP remaining in the amplified product can be removed, whereby the efficiency of the subsequent extension reaction can be improved, and the mutation of the predetermined site in the DNA sample can be efficiently detected.

According to one embodiment of the invention, the extension product is subjected to molecular weight detection by MALDI-TOF mass spectrometry. Thus, the molecular weight of the extended product can be accurately and efficiently detected, and the inventors have surprisingly found that detection of a heterozygous or homozygous mutation in a DNA sample can be achieved by MALDI-TOF mass spectrometry.

According to one embodiment of the invention, the step of purifying the extension product is further included prior to the MALDI-TOF mass spectrometry detection of the extension product. Thereby, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample.

According to a specific example of the invention, the extension product is purified using an anionic resin. As a result, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample.

According to a second aspect of the invention, the invention proposes a system for detecting a mutation in a predetermined site in a DNA sample. According to an embodiment of the present invention, the system for detecting a mutation at a predetermined site in a DNA sample comprises: a DNA sample amplification device, wherein the DNA sample amplification device is configured to perform PCR amplification on the DNA sample, so that Obtaining an amplification product, the amplification product comprising the predetermined site; an amplification product extension device, the amplification product extension device being coupled to the DNA sample amplification device for receiving from the DNA sample amplification device Amplifying the product, and subjecting the amplification product to an oligonucleotide extension reaction to obtain an extension product linking one base at the 3' end of the extension primer, wherein the 3' end of the extension primer is adjacent to the a predetermined molecular site; the molecular weight detecting device is coupled to the amplification product extension device to determine a molecular weight of the extension product; and a mutation analysis device, wherein the mutation analysis device is based on a molecular weight of the extension product , determining the type of mutation of the predetermined site. With this system, a method of detecting a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention can be effectively carried out, thereby effectively determining a mutation at a predetermined site in a DNA sample.

According to an embodiment of the present invention, the above system for detecting a mutation in a predetermined site in a DNA sample may further have the following additional technical features:

According to an embodiment of the present invention, the DNA sample amplification device is provided with an amplification primer pair, and the amplification product extension device is provided with an extension primer. Thereby, it is convenient for the DNA sample amplification device and the amplification product extension device to respectively amplify the DNA sample and perform an oligonucleotide extension reaction.

According to an embodiment of the present invention, the mutation of the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and an mtDNA, and the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, and 176. At least one of 191dell6, 299_300delAT, and P235delC, wherein the mutation of the GJB3 gene is at least one selected from the group consisting of 5380T and P547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A , 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and at least one of IVS15+5G>A, and the mutation of the mtDNA is selected from 14940T And at least one of 1555A>G, the amplification primer comprises a first primer and a second primer, wherein for these mutations, the primer combinations listed in Table 1 and Table 2 can be used (described in detail above). I will not repeat them here). The inventors of the present invention have found that Using the combination of the above, it is possible to detect the listed mutation types very efficiently.

According to an embodiment of the present invention, the method further includes: an amplification product purification device, wherein the amplification product purification device is respectively connected to the DNA sample amplification device and the amplification product extension device, so as to the amplification product A purification treatment is performed, and the purified amplification product is input to the amplification product extension device. Thereby, the dNTP remaining in the amplified product can be removed, whereby the efficiency of the subsequent extension reaction can be improved, and the mutation of the pre-localization point in the DNA sample can be efficiently detected.

According to an embodiment of the invention, the molecular weight detecting device is a MALDI-TOF mass spectrometer device.

According to an embodiment of the present invention, further comprising an extension product purification device, wherein the extension product purification device is separately coupled to the amplification product extension device and the MALDI-TOF mass spectrometer device to purify the extension product The purified extension product is processed and fed to the MALDI-TOF mass spectrometer.

According to an embodiment of the invention, the extension product purification device is an anion resin.

According to a third aspect of the invention, the invention proposes a kit for determining a mutation in a predetermined site in a DNA sample. According to an embodiment of the present invention, the kit comprises: an amplification primer pair, the amplification primer pair being adapted to perform a PCR amplification reaction on the DNA sample to obtain an amplification product, the amplification product comprising the a pre-localization point; and an extension primer, the extension product being adapted to utilize dd TP, using the amplification product as a template, performing an oligonucleotide extension reaction to obtain a base attached to the 3' end of the extension primer An extension product, wherein the 3' end of the extension primer is immediately adjacent to the predetermined site. With the kit, the prepared extension product can be effectively used for determining a mutation at a predetermined site in a DNA sample, thereby carrying out a method of determining a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention.

According to an embodiment of the present invention, the kit for determining a mutation at a predetermined site in a DNA sample may further have the following additional technical features:

According to an embodiment of the present invention, the mutation of the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and an mtDNA, and the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, and 176. At least one of 191dell6, 299_300delAT, and P235delC, wherein the mutation of the GJB3 gene is at least one selected from the group consisting of 5380T and P547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A , 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and at least one of IVS15+5G>A, and the mutation of the mtDNA is selected from 14940T And at least one of 1555A>G, the amplification primer comprises a first primer and a second primer, wherein the amplification primer comprises a first primer and a second primer, wherein for these mutations, Table 1 and The primer combinations listed in Table 2 have been described in detail above and will not be described herein. The inventors of the present invention surprisingly found that by using the primer combinations described above, the listed mutation types can be detected very efficiently.

According to a fourth aspect of the invention, the invention provides a method of diagnosing hereditary deafness. According to an embodiment of the present invention, the method comprises the steps of: extracting a DNA sample of a subject suspected of having hereditary deafness; and determining a predetermined site in the DNA sample according to the aforementioned method for determining a mutation at a predetermined site in the DNA sample Mutating for analysis; and determining that the subject has hereditary deafness based on a mutation in the DNA sample in which the predetermined site is present, wherein the mutation at the predetermined site is selected from the group consisting of a GJB2 gene, a GJB3 gene, a mutation of the SLC26A4 gene and at least one gene of mtDNA, wherein the mutation of the GJB2 gene is at least one selected from the group consisting of 35delG, 167delT, 176-191dell6, 299_300delAT, and 235delC, wherein the mutation of the GJB3 gene is selected from the group consisting of 538 T There is one less than the 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A, At least one of 2162C>T, 2168A>G and IVS15+5G>A, and the mutation of the mtDNA is at least one selected from the group consisting of 1494 T and 1555A>G. Thus, the method for diagnosing hereditary deafness according to an embodiment of the present invention can effectively diagnose whether a subject belongs to hereditary deafness, and can assist in confirming the cause of deafness, and thus can adopt corresponding treatment and auxiliary measures for the cause.

According to an embodiment of the present invention, the above method for diagnosing hereditary deafness may further have the following additional technical features: According to an embodiment of the present invention, the amplification primer comprises a first primer and a second primer, wherein, for the mutation, Primer combinations listed in Tables 1 and 2 can be used (described in detail above and will not be described again). The inventors of the present invention have surprisingly found that by using the primer combinations described above, the listed mutation types can be detected very efficiently, Thereby, it is possible to efficiently determine whether the subject has hereditary deafness.

According to a fifth aspect of the invention, the invention provides a method of prenatal diagnosis of hereditary deafness. According to an embodiment of the present invention, the method for prenatal diagnosis of hereditary deafness comprises the steps of: isolating a fetal DNA sample; and determining a predetermined site in the fetal DNA sample according to the aforementioned method for determining a mutation at a predetermined site in the DNA sample Mutation is performed; and the fetus is presumed to have hereditary deafness based on a mutation in the fetal DNA sample in which the predetermined site is present, wherein the mutation at the predetermined site is selected from the group consisting of GJB2 gene, GJB3 gene, SLC26A4 a mutation of at least one gene of mtDNA, wherein the mutation of the GJB2 gene is at least one selected from the group consisting of 35delG, 167delT, 176-191 del 16 299 3 OOdel AT and 235delC, wherein the mutation of the GJB3 gene is selected from the group consisting of One of the points 538 T and 547G>A, the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T> At least one of A 2162C>T 2168A>G and IVS15+5G>A, and the mutation of the mtDNA is at least one selected from the group consisting of 1494 T and 1555A>G. Thus, the method for diagnosing hereditary deafness according to an embodiment of the present invention can assist in estimating that the fetus has hereditary deafness, and can assist in confirming the cause of deafness, and accordingly can adopt corresponding treatment and auxiliary measures for the cause.

According to an embodiment of the present invention, the amplification primer comprises a first primer and a second primer, wherein, for the aforementioned mutation, the primer combination listed in Table 1 and Table 2 can be used (described in detail above, This will not be repeated here). The inventors of the present invention have surprisingly found that by using the primer combinations described above, it is possible to detect the listed mutation types very efficiently, and it can be inferred whether or not the fetus J L has hereditary deafness.

According to an embodiment of the invention, the fetal DNA is extracted from chorionic, amniotic fluid or cord blood of a pregnant woman. Thereby, it is possible to presume whether the fetus has hereditary deafness in the early pregnancy, and there is no accident such as fetal abortion due to sampling directly from the fetal tissue.

According to a sixth aspect of the invention, the invention proposes a method of predicting the effect of an electronic cochlear. According to an embodiment of the present invention, the method for predicting an electrocochlear effect comprises the steps of: extracting a DNA sample of a deaf patient; and mutating a predetermined site in the DNA sample according to the method for determining a mutation at a predetermined site in the DNA sample as described above Performing an analysis; determining that the deaf patient has hereditary deafness based on a mutation in the DNA sample in which the predetermined site exists; and based on the deafness patient having hereditary deafness, predicting that the cochlear implant is effective for the deaf patient, Wherein the mutation of the predetermined site is a mutation of at least one gene selected from the group consisting of GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA, and the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, 176-191dell6, 299_300delAT and 235delC. At least one of the mutations of the GJB3 gene is at least one selected from the group consisting of 5380T and 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G 1174A>T , 1226G>A 1229C>T 1975G>C, 2027T>A, 2162C>T, 2168A>G and at least one of IVS15+5G>A, and the mutation of the mtDNA is selected from 1494 T And at least one of 1555A>G. Thus, it is possible to determine whether an electronic cochlear implant can be used to assist a deaf patient to obtain hearing by determining the cause of the deafness patient.

According to an embodiment of the present invention, the above method for predicting an electronic cochlear effect may have the following additional technical features: According to an embodiment of the present invention, the amplification primer comprises a first primer and a second primer, wherein, for the aforementioned mutation, The combination of primers listed in Tables 1 and 2 (described in detail above has been described and will not be described herein). The inventors of the present invention have surprisingly found that by using the primer combinations described above, the listed mutation types can be detected very efficiently, so that it is possible to efficiently estimate whether the fetus has hereditary deafness.

According to a seventh aspect of the present invention, the present invention provides a kit, comprising: an amplification primer pair, wherein the amplification primer pair is adapted to perform a PCR amplification reaction on a DNA sample to obtain an amplification product And the amplification product comprises the extension site, and the extension product is adapted to utilize an ddNTP, the amplification product as a template, and an oligonucleotide extension reaction to obtain the extension primer The 3' end is ligated to a base extension product, wherein the 3' end of the extension primer is immediately adjacent to the predetermined site, and the mutation at the predetermined site is selected from the group consisting of a GJB2 gene, a GJB3 gene, a SLC26A4 gene, and mtDNA. a mutation of at least one gene, wherein the mutation of the GJB2 gene is at least one selected from the group consisting of 35delG, 167delT, 176-191dell6, 299_300delAT, and 235delC, and the mutation of the GJB3 gene is selected from the group consisting of 5380T and 547G>A at least one The mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and At least one of IVS15+5G>A, and the mutation of the mtDNA is at least one selected from the group consisting of: 14940T and 1555A>G, wherein the amplification primer comprises a first primer and a second primer, wherein, for the aforementioned mutation, The combination of primers listed in Tables 1 and 2 (described in detail above has been described and will not be described herein). The inventors of the present invention have surprisingly found that an extension product prepared by using the above-described primer combination can be used very effectively for detecting the type of mutation listed, so that hereditary deafness can be efficiently determined.

According to an embodiment of the present invention, the kit may be used for at least one selected from the group consisting of diagnosing hereditary deafness, prenatal diagnosis of hereditary deafness, and predicting the effect of an electronic cochlear. Thus, with the kit, the aforementioned method for diagnosing hereditary deafness, prenatal diagnosis of hereditary deafness, and predicting the effect of the electronic cochlear according to the embodiment of the present invention can be effectively carried out.

The additional aspects and advantages of the invention will be set forth in part in the description which follows.

DRAWINGS

The above and/or additional aspects and advantages of the present invention will become apparent and readily understood from

1 is a schematic flow chart of a method for detecting a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention; FIG. 2 is a schematic diagram of a system for detecting a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention; 3-14 are mass spectrometric test results for detecting genetic deafness-related gene mutations in accordance with an embodiment of the present invention.

detailed description

The embodiments of the present invention are described in detail below, and the examples of the embodiments are illustrated in the drawings, wherein the same or similar reference numerals are used to refer to the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the drawings are intended to be illustrative only and not to be construed as limiting.

The terms "first" and "second" used in the present invention are used for the purpose of description only, and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, features defining "first", "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, "multiple" means two or more than two unless otherwise stated.

The present invention has been completed based on the following findings of the inventors: For a gene mutation at a known site, since the type of mutation is known, by detecting a specific length of the oligonucleotide sequence containing the known site The molecular weight of the molecular weight can be judged based on the value of the molecular weight to determine whether or not there is a mutation at the site, and the type of the mutation can be known by calculation.

Method for detecting mutations at predetermined sites in a DNA sample

According to a first aspect of the invention, the invention provides a method of detecting a mutation in a predetermined site in a DNA sample. The term "predetermined site" as used herein refers to a target site for mutation analysis of a DNA sample, and generally refers to a site where the type of mutation at that site has been well studied and its function has been clarified. As used herein, the term "mutation", as used herein, refers to a situation that differs from a wild-type DNA sequence, which may include insertions, substitutions, deletions of one or more bases, either point mutations or sequences. The overall change.

Referring to Figure 1, a method for detecting a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention includes the following steps: S100: performing a PCR amplification reaction on a DNA sample using an amplification primer to obtain an amplification product, The product of addition contains a predetermined site. The source of the DNA sample which can be employed according to an embodiment of the present invention is not particularly limited. According to one example of the invention, the DNA sample that can be employed is human whole genome DNA. According to an embodiment of the present invention, a DNA sample containing a DNA fragment of a site to be detected can be used for detection, which can improve the efficiency and accuracy of the detection. For example, whole genome DNA in a biological sample can be first extracted, and then a DNA fragment containing a specific site can be obtained by a conventional separation method.

According to an embodiment of the present invention, mutation of a predetermined site which can be studied by the method of the present invention is not particularly limited. According to some embodiments of the present invention, the mutation of the predetermined site which can be detected by the method of the present invention is a mutation of at least one gene selected from the group consisting of a human GJB2 gene, a GJB3 gene, an SLC26A4 gene, and mtDNA. The inventors of the present invention have surprisingly found that by means of the method of the present invention, mutation sites in the above genes can be efficiently detected. According to a specific example of the present invention, the mutation sites that can be detected and the common mutation types are any of those listed in Table 3 below:

It should be noted that the expression methods of these mutation sites are all expressions known to those skilled in the art. Given that the mutation site can occur either on the cDNA sequence or on the intron. To this end, the inventors provided mutation instructions to describe the precise site of the mutation. Where the description rule is:

1) Add a letter in front of the site to distinguish the type of reference sequence:

1 "c" indicates the sequence of the reference cDNA, eg: c.235delC, indicating the 25th base of the cDNA sequence.

2 "m." indicates the sequence of the reference mitochondria, such as: m.l494C>T, indicating that the 1494th base of the mitochondrial DNA sequence was replaced with D.

2) Start with an intron: exon number + position of the intron in the locus such as: IVS15+5G>A, indicating that the 5th base G of the downstream of the 15th exon of the SLC26A4 gene is replaced by A.

3) c.l76-191dell6 indicates the deletion of 16 bases from position 176 to position 191.

4) c.299_300delAT indicates the deletion of 2 bases (ΑΓ bases) from position 299 to position 300.

The above genes for human twins can be obtained by the NCBI request number. The NCBI request number for human wild type GJB2 is NG_008358.1, the NCBI request number for GJB3 is NG_008309.1, the NCBI request number for SLC26A4 is NG_008489.1, and the NCBI number for mtDNA (mitochondrial DNA) is NC_012920.

For ease of understanding, GJB2, GJB3 SLC26A4, and mtDNA (linear DNA) are briefly described below. GJB2 gene: This gene is located in the autosomal 13qll-12 region. The DNA is 4804__bp in length and contains two exons. The coding region is 678 bp, which encodes the gap junction protein Connexin 26, which is composed of 266 amino acid residues. 2 protein, which is part of the potassium ion cycling pathway. The GJB2 gene mutation is the most common cause of hereditary deafness. The deafness caused by GJB2 gene mutation is pre-lingual, bilateral, and symmetrical deafness. The degree of hearing loss varies greatly, from mild to very severe, but most of them are severe or extremely severe. deaf. In the Chinese population, the common GJB2 gene mutation types are mainly 235ddC, 299 300delAT, 176 191dell6, etc., which can account for more than 80% of the GJB2 gene mutation population. Details about the gene For a description, see Dai P, Yu F, Han B, et al. GJB2 mutation spectrum in 2,063 Chinese patients with nonsyndromic hearing imp∑drment [J]. J Transl Med, 2009, 7:26, incorporated herein by reference. .

GJB3 gene: This gene is located at 1ρ33-ρ35 and has two exons encoding a 270-amino acid gap junction protein C ₀ nn _eX in 31. Mutations in the GJB3 gene can cause autosomal dominant or recessive hereditary non-syndromic hearing loss, which is thought to be associated with high frequency hearing loss. For a detailed description of the gene, see 3⁄4& JH, Liu CY, Tang BS, et al. Mutations in the gene encoding gap junction protein beta-3 associated with autosomal dominant hearing impairment. Nat ewet, 1998, 20: 370-373, This is incorporated herein by reference.

SLC26A4 gene: Also known as PDS gene, this gene is located in the autosomal 7q31 region, contains 21 exons, and encodes a multi-transmembrane protein Pendrin consisting of 780 amino acid residues, belonging to the ion transporter family. Mainly related to iodine/chloride ion transport. Clinical manifestations of congenital or acquired deafness, deafness or exacerbation is related to trauma and cold. There are many types of PDS mutations, but 919-2A>G, 2168A>G, 1226G>A, 1975G>C, 1229C>T, 1174A>T, 1687_1692insA, IVS15+5G>A, 2027T>A 589G>A and 281C The >T mutant frequency is as high as 82.51%. For a detailed description of the gene, see Yuan Yongyi, Wang Guojian, Huang Deliang, et al. Discussion on the screening scheme of SLC26A4 gene hotspot mutation in large vestibular water pipes. ^" Xue 2010, 8(3):292-295, passed here This is incorporated herein by reference.

Mitochondrial DNA genes: Mitochondrial gene mutations are associated with drug-induced deafness caused by aminoglycoside antibiotics (AmAn). Mitochondrial gene mutations cause mitochondrial defects, affecting the lack of capacity of mitochondria in cochlear hair cells directly related to hearing, leading to cochlear Injury or death with vestibular cells. Mutations in the mitochondrial DNA gene are maternal inheritance, often occurring in early adulthood, manifesting as bilateral symmetry, sensorineural deafness with varying degrees of high-frequency hearing loss and varying degrees. The main sites of mitochondrial gene mutations are 1555A>G and 1494C>T.

For a detailed description of the types of mutations described above, reference may be made to the relevant research literature, which is incorporated herein by reference.

Gene mutation reference site corresponding position in the full length sequence of the wild type gene

GJB2 35delG Mahdieh N, Rabbani B. Statistical study of 35delG mutation site

35delG mutation of GJB2 gene A corresponds to meta-analysis of carrier frequency. Int J NG 008358 Medium Audiol.2009;48(6):363-70.

167delT Al-Achkar W, Moassass F, Al-Halabi B, et, 3429

al.Mutations of the Connexin 26 gene in

Families with non-syndromic hearing loss. Mol 167delT mutations Med Report. 2011 Mar-Apr;4(2):331-5.

176-191dell6, Chen Y, Tudi M, Lu HL, et al. Common gene NG 008358 235delC and mutations study in Uyghur population with 299_300delAT deafness in Kashgar region of Xinjiang.

Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za

Zhi. 2011 Mar;46(3):205-8. The 176_191dell6 sudden change point corresponds to the 3570-3585 bit in the full length sequence of NG 008358.

235delC mutation site corresponds 3639th in the full length sequence in NG 008358

The 299_300delAT sudden change point corresponds to the 3693-3694 bit in the full length sequence of NG 008358

GJB3 538C>T Chen Y, Tudi M, Sun J, et al. Genetic 5380T mutation

Mutations in Non-syndromic Deafness Patients corresponds to Uyghur and Han Chinese Ethnicities in NG 008309. Xinjiang, China: A Comparative Study. J Transl Med. 2011 Sep 14;9(1): 154. ;

547G>A Xia JH, Liu CY, Tang BS, et al. Mutations in

The gene encoding gap junction protein beta-3 547G>A mutation associated with autosomal candidate point corresponds to impairment. Nat Genet. 1998 Dec;20(4):370-3. NG 008309 shows the 4121th in the long sequence

SLC26A4 281C>T Wu CC, Lu YC, Chen PJ, et al. Phenotypic 2810T mutation

Analyses and Mutation Screening of the point SLC26A4 and FOXI1 Genes in 101 NG 008489 Taiwanese Families with Bilateral Nonsyndromic Enlarged Vestibular Aqueduct 2778; (DFNB4) or Pendred Syndrome. Audiol

Neurotol 2010;15:57-66. 589G>A mutation

589G>A Wang QJ, Zhao YL, Rao SQ, et al. A distinct point corresponds to spectrum of SLC26A4 mutations in patients NG 008489 with enlarged vestibular aqueduct in China. Clin Genet. 2007 Sep;72(3) :245-54. No. 13703;

Xiao Mei Ouyang, Denise Yan, Hui Jun Yuan, 919-2A>G mutation et al. The genetic bases for non-syndromic sites correspond to hearing loss among Chinese Genetics of NG 008489. Hearing loss in the Chinese population. Journal Of Human Genetics 54, 131-140. (in this document, number 22819; in amino acid nomenclature: P.G197R)

1174A>T mutation

2027T>A Park HJ, Shaukat S, Liu XZ, et al. Origins and points corresponding to fractions of SLC26A4 (PDS) mutations in NG 008489 both east and south Asians: global implications for the epidemiology of deafness. J Med Genet. No. 29514; 2003 Apr; 40(4): 242-8.

919-2A>G Wu CC, Hung CC, Lin SY, et "/.Newborn 1226G>A Mutation Genetic screening for hearing impairment: a site corresponds to a preliminary study at a tertiary center. PLoS NG 008489 One. 2011;6(7):e22314.

Dai P, Yuan Y Huang D, Zhu X, et al. 29566; Molecular Etiology of Hearing Impairment in

Inner Mongolia mutations in SLC26A4 gene 12290T mutation Λ Λ Λ and relevant phenotype analysis. J Transl Med.

2008 Nov 30;6:74. NG 008489

1226G>A Fugazzola L, Cirello V, Dossena S, et al. High shows phenotypic intrafamilial variability in patients in full-length sequence 29569; with Pendred syndrome and a novel

Duplication in the SLC26A4 gene: clinical IVS 15+5G>A characterization and functional studies of the mutated point corresponding to muted SLC26A4 protein. Eur J Endocrinol. NG 008489 2007 Sep;157(3):331-8. In the sequence

2162C>T Fugazzola L, Mannavola D, Cerutti N, et al.

Molecular Analysis of the Pendred's Syndrome

Gene and Magnetic Resonance Imaging 1975G>C Mutation Studies of the Inner Ear Are Essential for the Site corresponds to Diagnosis of True Pendred's Syndrome. J Clin NG 008489 Endocrinol Metab. 2000 Jul;85(7):2469-75. middle

2168A>G Li H, Li HB, Mao J, Liu MJ, et al. Genetic 41364; screening of mutation hot-spots for

Nonsyndromic hearing loss in southern Jiangsu 2027T>A mutation province with SNaPshot. Zhonghua Yi Xue Yi point corresponds to Chuan Xue Za Zhi. 2011 Aug;28(4):383-6. NG 008489

IVS15+5G>A Iwasaki S, Tsukamoto K, Usami S, et al.

Association of SLC26A4 mutations with 41416; clinical features and thyroid function in deaf

Infants with enlarged vestibular aqueduct. J 21620T mutation Hum Genet. 2006;51(9):805-10.

The 49492th in the long sequence shown by NG 008489;

The 2168A>G mutation site corresponds to the 49498th position in the long sequence shown by NG 008489; mtDNA 1494C>T Zhao H, Li R, Wang Q, Yan Q, Deng JH, et 1494C>T mutation

(mitochondrial α/.Maternally inherited point corresponding to DNA) aminoglycoside-induced and nonsyndromic NC 012920 shown deafness is associated with the novel C1494T in the entire sequence of the mutation in the mitochondrial 12S rRNA gene 1494; in a large Chinese family. Am J Hum Genet. 2004 Jan;74(l): 139-52. 1555A>G mutation

1555A>G Prezant TR, Agapian TV, Bohlman MC, et al.

Mitochondrial ribosomal RNA mutation NC 012920 is shown with both antibiotic-induced and full non-syndromic deafness. Nat Genet. 1993 1555;

Jul; 4(3): 289-94.

Thus, with the method according to the embodiment of the present invention, the gene mutation related to deafness can be effectively detected, and further, the subject can be effectively predicted to have hereditary deafness, for example, can assist in diagnosing the cause of the deafness of the patient, and thus can be targeted. The corresponding treatment plan is adopted.

It will be understood by those skilled in the art that DNA amplification can be carried out by any PCR method as long as the predetermined amplification site contains a predetermined site. According to a specific example of the present invention, in order to diagnose the types of mutations listed in Table 3 above, the primer pairs listed in Table 1 can be used as the first primer and the second primer, respectively, as amplification primers. The inventors of the present invention have surprisingly found that by using the above-described amplification primers, amplification of a predetermined site can be efficiently achieved, and the efficiency and accuracy of detecting a mutation type can be effectively improved in the subsequent, so that the receptor can be efficiently determined. Whether the tester has hereditary deafness. According to an embodiment of the present invention, the first primer and the second primer 5' shown in Table 1 may each have a tag sequence of 10 bases acgttggatg (SEQ ID NO: 53), the inventors found that By adopting the above-described tag sequence, the molecular weights of the above-described first primer and second primer can be made to be out of the detection range of the subsequent mass spectrometry, whereby the accuracy and efficiency of detection can be further improved.

S200: After obtaining the amplification product comprising the predetermined site, the extension primer and the ddNTP can be used, and the obtained amplification product is used as a template, and an oligonucleotide extension reaction is performed to obtain the 3′ end of the extension primer. Connect one base extension product. According to an embodiment of the invention, the 3' end of the extension primer is adjacent to the predetermined site. Thus, the base corresponding to the 3' end of the obtained extension product contains mutation information of a predetermined site, and can be subsequently determined by molecular weight analysis whether the site has a mutation event, and the mutation event can be determined. Types of. Those skilled in the art will appreciate that the amplification products described above can be subjected to the above oligonucleotide extension reaction by any known PCR method. According to one embodiment of the present invention, the above oligonucleotide extension reaction can be carried out using the primers listed in Table 2 as extension primers. The inventors of the present invention have surprisingly found that by using the combination of the labels listed in Tables 1 and 2, the listed mutation types can be detected very efficiently.

According to an embodiment of the present invention, the step of treating the obtained amplification product using a basic phosphatase may be further included before the oligonucleotide extension reaction. Thus, by treating the amplified product with alkaline phosphatase, the dNTP remaining in the amplified product can be removed, whereby the efficiency of the subsequent extension reaction can be improved, and the mutation of the predetermined site in the DNA sample can be efficiently detected.

S300: After obtaining the above extension product, the extension product may be subjected to molecular weight detection to obtain the molecular weight of the extension product. According to an embodiment of the present invention, the molecular weight of the extension product can be detected by any known method. According to one embodiment of the invention, the extension product is subjected to molecular weight detection by MALDI-TOF mass spectrometry (Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry). MALDI-TOF mass spectrometry is a new type of soft ionization biomass developed in recent years. It consists of two parts: matrix-assisted laser desorption ionization ion source (MALDI) and time-of-flight mass analyzer (TOF). The principle of MALDI is to use a laser to illuminate a eutectic film formed by a sample and a matrix. The matrix absorbs energy from the laser and transmits it to the biomolecule. During the ionization process, the proton is transferred to or obtained from the biomolecule, and the biomolecule is ionized. process. The principle of TOF is that ions accelerate through the flight pipeline under the action of electric field, and are detected according to the flight time of the arrival detector. That is, the mass-to-charge ratio (M/Z) of the measured ions is proportional to the flight time of the ions, and the ion is realized. Detection.

Thereby, the molecular weight of the extension product can be accurately and efficiently detected. The inventors have surprisingly found that detection of heterozygous or homozygous mutations in DNA samples can even be achieved by MALDI-TOF mass spectrometry. According to one embodiment of the invention, the step of purifying the extension product is further included prior to the MALDI-TOF mass spectrometric detection of the extension product. Thereby, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample. According to a specific example of the present invention, an anion resin pair is used. The extension product is purified. Thereby, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample.

S400: Finally, based on the molecular weight of the extension product obtained, the type of mutation of the predetermined site is determined. Since the extension reaction is based on an amplification product containing a predetermined site, and the 3' end of the extension primer for performing the extension reaction is adjacent to the predetermined site, and dd TP is used as a raw material in the extension reaction, the extension can be ensured. The reaction may extend only one base, that is, corresponding to a predetermined site, and there is a significant difference based on the molecular weight of each different base. Therefore, by detecting the molecular weight of the extension product, the molecular weight of the obtained extension product can be used. It is determined whether a mutation has occurred at a predetermined site, and the type of mutation that has occurred. It should be noted that the analysis herein can be obtained by comparing the molecular weight of the extension product with a standard reference. The term "standard reference" as used herein may be a molecular weight value obtained by performing a parallel test on a sample having a known mutation in advance.

Compared to the prior art, the method according to an embodiment of the invention has at least one of the following advantages:

(1) The reagents used are relatively simple and stable, and do not require expensive reagents such as fluorescent dyes and special enzymes;

(2) The reaction can be carried out in a trace system, reducing the use of samples and various consumables;

(3) Since mass spectrometry directly detects the molecular weight (mass-to-charge ratio) of DNA and directly determines the type of base (ie, does not require any form of signal conversion), theoretically, as long as there is a copy of a mutant fragment such as a single core Glycosidic acid polymorphism (SNP) can be identified by amplification, thus eliminating the possibility of false positives;

(4) Mass spectrometry technology also has the characteristics of automation, high-throughput detection, etc. Therefore, mass spectrometry technology combined with multi-primer extension technology can simultaneously detect multiple deafness mutation sites in one reaction system, combined with DNA automatic extraction equipment, multiple PCR primer design software and data analysis software greatly reduce workload, increase detection throughput, and reduce detection costs; (5) Compared with gene sequencing, it has the advantages of simple operation, accurate results, high throughput and low price.

System for detecting mutations at predetermined sites in a DNA sample

According to a second aspect of the invention, the invention proposes a system for detecting a mutation in a predetermined site in a DNA sample. Referring to FIG. 2, according to an embodiment of the present invention, the system 1000 for detecting a mutation at a predetermined site in a DNA sample includes: a DNA sample amplification device 100, an amplification product extension device 200, a molecular weight detection device 300, and a mutation analysis device. 400.

According to an embodiment of the present invention, the DNA sample amplifying device 100 is for performing PCR amplification on a DNA sample to obtain an amplification product containing a predetermined site. According to an embodiment of the present invention, the DNA sample amplifying device 100 is provided with an extension pair, and the amplification product extension device is provided with an extension primer. Thereby, it is convenient for the DNA sample amplification device and the amplification product extension device to respectively amplify the DNA sample and perform an oligonucleotide extension reaction. As described above, according to the embodiment of the present invention, the DNA sample amplifying device 100 is not particularly limited, and it may be any device suitable for amplifying a DNA sample. According to an embodiment of the present invention, a known PCR device can be employed as the DNA sample amplifying device 100. Further, according to the embodiment of the present invention, the amplification primer pair can be previously set in the DNA sample amplification device 100, whereby the operation can be facilitated. One skilled in the art can determine the amplified primer sequences that can be employed based on the locus to be analyzed. According to an embodiment of the present invention, the mutation of the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and an mtDNA, and the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, and 176. At least one of 191dell6, 299_300delAT and 235delC, wherein the mutation of the GJB3 gene is at least one selected from the group consisting of 5380T and 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919- 2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and at least one of IVS15+5G>A, and the mutation of the mtDNA is selected from 14940T and 1555A> At least one of G. These mutations have been described in detail above and will not be described again. For these mutations, the combination of primers listed in Tables 1 and 2 (described in detail above, which will not be described herein) can be used as the amplification pair. The inventors of the present invention have surprisingly found that the listed mutant types can be detected very efficiently by using the primer combinations described above. It should be noted that the term "connected" as used in the present invention should be understood broadly, and it may be directly connected or indirectly connected through a medium as long as a functional connection can be achieved.

According to an embodiment of the present invention, the amplification product extension device 300 is connected to the DNA sample amplification device 100 so as to

The DNA sample amplification device 100 receives the amplification product, and performs an oligonucleotide extension reaction on the amplification product to obtain The 3' end of the extension primer is joined to an extension product of one base, wherein the 3' end of the extension primer is immediately adjacent to the predetermined site. According to an embodiment of the present invention, an amplification product purification device (not shown) may be further included, and the amplification product purification device may be connected to the DNA sample amplification device 100 and the amplification product extension device 200, respectively, so as to expand The product is subjected to purification treatment, and the purified amplification product is input to the amplification product extension device 200. Thereby, the d TP remaining in the amplified product can be removed, whereby the efficiency of the subsequent extension reaction can be improved, and further, the mutation of the predetermined site in the DNA sample can be efficiently detected.

According to an embodiment of the present invention, the molecular weight detecting device 300 may be coupled to the amplification product extension device 200 to determine the molecular weight of the extension product. According to an embodiment of the invention, the molecular weight detecting device is a MALDI-TOF mass spectrometer device. Thus, the molecular weight of the extended product can be accurately and efficiently detected, and the inventors have surprisingly found that detection of heterozygous or homozygous mutations in the sample can be achieved even by MALDI-TOF mass spectrometry. According to an embodiment of the invention, an extension product purification device (not shown) is further included. The extension product purification apparatus may be coupled to the amplification product extension apparatus 200 and the MALDI-TOF mass spectrometer apparatus 300, respectively, to purify the extension product, and to input the purified extension product to the MALDI-TOF mass spectrometer apparatus. Thereby, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample. According to an embodiment of the invention, the extension product purification device is an anion resin. Thereby, the accuracy of the MALDI-TOF mass spectrometry detection can be further improved, thereby improving the efficiency and accuracy of detecting mutations at predetermined sites in the DNA sample.

According to an embodiment of the present invention, the mutation analyzing device 400 may be connected to the molecular weight detecting device 300 to determine the type of mutation of the predetermined site based on the molecular weight of the obtained extension product. According to an embodiment of the present invention, the mutation analysis device 400 can be compared with a standard reference by comparing the molecular weight of the extension product with a standard reference to determine whether or not there is a mutation and a type of mutation. The term "standard reference" as used herein may be a molecular weight value obtained by performing a parallel test on a sample having a known mutation in advance. Additionally, in accordance with an embodiment of the present invention, the mutation analysis device 400 can also be adapted to perform various statistical test analyses to achieve a more accurate and accurate analysis.

Thus, with the system according to an embodiment of the present invention, a method of detecting a mutation at a predetermined site in a DNA sample according to an embodiment of the present invention can be effectively carried out, thereby effectively determining a mutation at a predetermined site in a DNA sample. It should be noted that the functions of the above-mentioned respective devices can be completed in the same container as long as the above functions can be realized.

Application

According to an embodiment of the present invention, a method of determining a mutation at a predetermined site in a DNA sample can be applied to various detections related to gene mutation. For example, mutation types of mutants constructed in the laboratory can be effectively detected.

According to an embodiment of the present invention, the above method can also be applied to a method for diagnosing hereditary deafness, a method for prenatal diagnosis of hereditary deafness, and a method for prenatal diagnosis of hereditary deafness.

Specifically, in accordance with one aspect of the present invention, the present invention provides a method of diagnosing hereditary deafness. According to an embodiment of the present invention, a method of diagnosing hereditary deafness comprises the steps of: extracting a DNA sample of a subject suspected of having hereditary deafness; and according to the aforementioned method for determining a mutation at a predetermined site in a DNA sample, the DNA Mutation of a predetermined site in the sample is analyzed; and the subject is determined to have hereditary deafness based on a mutation in the DNA sample in which the predetermined site is present, wherein the mutation at the predetermined site is as shown in Table 3. At least one of the listed mutations. Thus, the method for diagnosing hereditary deafness according to an embodiment of the present invention can effectively diagnose whether a subject is hereditary deafness, and can assist in confirming the cause of deafness, and can accordingly adopt corresponding treatment and auxiliary measures for the cause. According to an embodiment of the present invention, the type of the DNA sample that can be employed is not particularly limited, and the whole genome DNA of the subject may be employed, or a DNA fragment derived from a specific gene may be employed, and the specific gene referred to herein refers to It is a deafness related gene. According to an embodiment of the present invention, for the mutations listed in Table 3, the primer combinations listed in Tables 1 and 2 can be used (the foregoing has been described in detail, and will not be described herein). The inventors of the present invention have surprisingly found that by using the primer combinations described above, the listed mutation types can be detected very efficiently, so that it is possible to efficiently determine whether the subject has hereditary deafness. For details of each step, refer to the related description above, and details are not described herein again.

Further, the present invention proposes a method of prenatal diagnosis of hereditary deafness. According to an embodiment of the present invention, the method for prenatal diagnosis of hereditary deafness comprises the steps of: isolating a fetal DNA sample; determining a predetermined DNA sample according to the foregoing a method of mutating a site, analyzing a mutation at a predetermined site in the fetal DNA sample; and determining that the fetus has hereditary deafness based on a mutation in the fetal DNA sample in which the predetermined site is present, wherein The mutation at the predetermined site is at least one of the mutations listed in Table 3. Thus, the method for diagnosing hereditary deafness according to an embodiment of the present invention can assist in estimating that the fetus has hereditary deafness, and can assist in confirming the cause of deafness, and thus can adopt corresponding treatment and auxiliary measures for the cause. For the mutations listed in Table 3, the primer combinations listed in Tables 1 and 2 can be used (described in detail above and will not be described herein). The inventors of the present invention have surprisingly found that by using the primer combinations described above, the listed mutation types can be detected very efficiently, so that it is possible to speculate whether the fetus has hereditary deafness. According to an embodiment of the present invention, the type of the DNA sample that can be used is not particularly limited, and the whole genome DNA of the fetus may be used, or a DNA fragment containing a specific gene derived from the fetus may be used, and the specific gene referred to herein refers to It is a deafness related gene. According to an embodiment of the present invention, the source of fetal genomic DNA is not particularly limited. According to one embodiment of the invention, fetal whole genomic DNA is extracted from chorionic, amniotic fluid or cord blood of a pregnant woman. Thus, it is possible to effectively predict whether the fetus has hereditary deafness in the early pregnancy. Further, according to an embodiment of the present invention, a free DNA derived from a fetus can be separated from a peripheral blood of a pregnant woman as a DNA sample for performing deafness-related detection.

According to still another aspect of the present invention, the present invention also provides a method of predicting an effect of an electronic cochlear. According to an embodiment of the present invention, the method for predicting an electrocochlear effect comprises the steps of: extracting a DNA sample of a deaf patient; and mutating a predetermined site in the DNA sample according to the method for determining a mutation at a predetermined site in the DNA sample as described above Performing an analysis; determining that the deaf patient has hereditary deafness based on a mutation in the DNA sample in which the predetermined site exists; and based on the deafness patient having hereditary deafness, predicting that the cochlear implant is effective for the deaf patient, Wherein the mutation of the predetermined site is at least one of the mutations listed in Table 3. Thus, it is possible to determine whether an electronic cochlear implant can be used to assist a deaf patient to obtain hearing by determining the cause of the deafness patient. For the mutations listed in Table 3, the primer combinations listed in Tables 1 and 2 can be used (described in detail above and will not be described again). The inventors of the present invention have surprisingly found that by using the combination of primers described above, it is possible to detect the listed mutation types very efficiently, thereby predicting whether a deaf patient has a residual spiral ganglion so that the disease is not treated. Using an electronic cochlea to bypass the damaged hair cells directly using the current to stimulate the auditory nerve to reconstruct the hearing. According to an embodiment of the present invention, the type of the DNA sample that can be used is not particularly limited, and the whole genome DNA of the fetus may be used, or a DNA fragment containing a specific gene derived from the fetus may be used, and the specific gene referred to herein refers to It is a deafness related gene.

Kit

The invention also proposes a kit, comprising: an amplification primer pair and an extension primer. According to an embodiment of the present invention, the amplification primer pair is adapted to perform a PCR amplification reaction on the DNA to obtain an amplification product comprising a predetermined site, and the extension product is suitable for using the ddNTP, using the obtained amplification product as a template. An oligonucleotide extension reaction to obtain an extension product linking one base at the 3' end of the extension primer, wherein the 3' end of the extension primer is immediately adjacent to the predetermined site, and the mutation of the predetermined site is a table At least one of the mutations listed in 3. For the mutations listed in Table 3, the primer combinations listed in Tables 1 and 2 (described in detail above, which will not be described herein) can be used as the amplification primer pair and the extension primer, respectively. The inventors of the present invention have surprisingly found that an extended product prepared by using the above-described primer combination can be used very effectively for detecting the type of mutation listed, so that hereditary deafness can be efficiently determined. According to an embodiment of the present invention, the kit for detecting a mutation in a predetermined site in a DNA sample, diagnosing hereditary deafness, prenatal diagnosis of hereditary deafness, and predicting electrons according to an embodiment of the present invention can be effectively carried out by using the kit. The method of cochlear effect. According to an embodiment of the invention, the invention also proposes a set of primer combinations that can be used in the kits described above. Using this primer combination, it is possible to efficiently detect mutations at predetermined sites in DNA samples, diagnose hereditary deafness, prenatal diagnosis of hereditary deafness, and methods for predicting the effects of electronic cochlear implants.

The invention will now be described in accordance with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not to be construed as limiting the invention in any way. Further, unless otherwise specified, the methods referred to in the following examples are conventional methods, and the materials and formulations involved are also commercially available.

Example 1

1 primer design According to the selected 20-point mutation site of the deafness gene to be detected and/or typed, including 4 genes, namely: GJB2 gene (including sites 35delG, 167delT, 176-191dell6, 299_300delAT and 235delC), GJB3 gene ( Included sites 538C>T and 547G>A), SLC26A4 gene (including site 281C>T, 589G>A, 919-2A>G 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C> T 2168A>G and IVS15+5G>A) 1494C>T and 1555A>G with mtDNA.

According to the position and genotype of the mutation site, the amplification pair and the extension primer are designed, wherein the amplification primer is about 30 bases in length, and the amplification primer has 10 bases at the 5' end acgttggatg. The tag sequence; the extension primer is 17-28 bases in length, allowing 1-5 bases at the 5' end to be incompletely paired with the template, and the 3' terminal base and the 3' end adjacent base of the mutation site Exact match. In addition, the molecular weight difference between the extended primer at different sites and the extension product, the extension product and the extension product is not less than 30D. The amplification primers designed for the above 20 deafness gene mutation sites of the present invention are shown in Table 1 (the tag sequence acgttggatg is carried out at the 5' end of the first sequence and the second sequence), and the extension primers are shown in Table 2.

2 DNA extraction

Eight normal clinical blood samples (named clinical samples 1-8) were collected from normal human blood samples and clinically collected. DNAODNA was extracted from water as template DNA using a whole blood genomic DNA extraction kit, and the concentration was uniformly adjusted to 50 ng/cm.

3 PCR amplification

The PCR amplification product of the target sequence is obtained by PCR amplification. See Table 4 for the PCR amplification reaction system. Among them, all reagents were purchased from Sequenom, USA, and the PCR instrument was GeneAmp® PCR System 9700 Dual 384-Well Sample Block Module o

Table 4

The PCR reaction conditions were 94 ° C for 2 minutes; denaturation at 94 ° C for 20 seconds, annealing at 56 ° C for 30 seconds, and extension at 72 ° C for 1 minute.

The sex control is normal human genomic DNA of known sequence and the negative control is sterile double distilled water.

4 SAP processing

The dNTP contained in the amplification product obtained in the step 3 was removed by the SAP enzyme (shrimp alkaline phosphatase) treatment to ensure that only one base was extended in the extension reaction. The SAP enzyme reaction system is shown in Table 5 below. All reagents were purchased from Sequenom, USA, and the PCR instrument was a GeneAmp® PCR System 9700 Dual 384-Well Sample Block Module.

table 5

Among them, SAP enzyme and SAP enzyme buffer were from iPLEX® Gold Reagent Kit 384. The SAP enzyme reaction conditions were incubated at 37 ° C for 40 minutes to remove the remaining dNTPs in the PCR amplification reaction; incubation at 85 ° C for 5 minutes to inactivate the SAP enzyme.

5 extension reaction

Using the PCR amplification product obtained in 4 as a template, an extension product was obtained by linking one base at the 3' end of the extension primer by an extension reaction. The material used in the extension reaction is a mass-modified ddNTP, which ensures that the extension reaction is linked to only one base and the resolution of the entire system is improved. The extension reaction system is shown in Table 6. All reagents were purchased from Sequenom, USA, and the PCR instrument was GeneAmp® PCR System 9700 Dual 384-Well Sample Block Module

Table 6

Among them, iPLEX enzyme, iPLEX ddNTP mixture and iPLEX buffer come from iPLEX® Gold Reagent Kit

384.

* wherein the extension primer mixture is linearly adjusted according to the molecular weight of each primer (i.e., the amount of each primer is calculated according to the molecular weight of each extension primer) to achieve an optimal extension reaction, and an optimal mass spectrum peak map is obtained.

The extension reaction conditions were 94 ° C for 30 seconds; denaturation at 94 ° C for 5 seconds, annealing at 52 ° C for 5 seconds, extension at 80 ° C for 5 seconds, a total of 40 cycles of amplification, and annealing and extension in each cycle. A small cycle; finally extended at 72 ° C for 3 minutes.

6 resin purification

The extension product obtained in the step 5 was purified using a resin (Model 08040, purchased from Sequenom, USA). Add 6 mg of resin to the extended product, 18.00 μl of water, and shake vertically for 40 min. After the reaction in this step, the resin is sufficiently combined with the cation in the reaction system to desalinate the reaction system. The purified product after completion of the reaction can be stored at 4 ° C for several days or at -20 ° C for several weeks. After the obtained purified product was centrifuged at 4000 rpm for 5 minutes, the supernatant was taken directly for mass spectrometry.

7 mass spectrometry

The extended product from step 6 was transferred to a 384-well spectroCHIP lI chip by a spotter (model MassARRAYNanodispenser RSlOOO, purchased from Sequenom, USA), and the chip matrix was co-crystallized with the product on a Sequenom MALDI-TOF mass spectrometer ( The mass spectrometry was performed on the MassARRAY Analyzer Compact, purchased from Sequenom, USA, to determine the genotype of the mutation site to be detected.

The results of mass spectrometry are shown in Figure 3-8.

Figure 3 shows the results of detection of the test sample site 299_300ddAT using the extension primer SEQ ID NO:36. As can be seen from Fig. 3-1, the MALDI-TOF mass spectrometric detection detected 3⁄4 at the molecular weight of 6545.3, and the peak was confirmed to be wild type by analysis (the sample was derived from a normal person), and the results were consistent with the actual results. As can be seen from Fig. 3-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 6545.3 and 6561.3, which were confirmed by analysis to be heterozygous deletion mutations (samples were derived from clinical samples 1), and the results were consistent with the actual results. As can be seen from Fig. 3-3, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 6561.3, which was confirmed to be a homozygous deletion mutation (sample derived from clinical sample 2), and the results were consistent with the actual results.

Figure 4 shows the results of detection of test sample site 2810T using extension primer SEQ ID NO:40. As can be seen from Fig. 4-1, a peak was detected at a molecular weight of 6121 by MALDI-TOF mass spectrometry, and the peak was confirmed to be wild type C by analysis (sample source is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 4-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 6121 and 6200.9, which were confirmed by analysis to be heterozygous CT (samples were derived from clinical sample 3). The result is consistent with the actual situation.

Figure 5 shows the results of detection of the test sample site 1229 T using the extension primer SEQ ID NO:41. As can be seen from Figure 5-1, the MALDI-TOF mass spectrometry detected a peak at a molecular weight of 7053.6, which was confirmed to be wild-type C by analysis (sample source is the same as the sample source of Figure 3-1), and the results were consistent with the actual results. As can be seen from Fig. 5-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 7053.6 and 7133.5, and the peaks were confirmed to be heterozygous CT (samples were derived from clinical sample 4), and the results were consistent with the actual results.

Figure 6 shows the results of detection of the test sample site IVS15+5G>A using the extension primer SEQ ID NO:46. As can be seen from Fig. 6-1, the MALDI-TOF mass spectrometry detected a peak at a molecular weight of 7961.3, which was confirmed to be a wild type G by analysis (the sample source is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 6-2, the MALDI-TOF mass spectrum detection detected peaks at molecular weights of 7961.3 and 8041.2, and the peaks were confirmed to be heterozygous GA by analysis (samples were derived from clinical sample 5), and the results were consistent with the actual results.

Figure 7 shows the results of testing the test sample site 2168A > G using the extension SEQ ID NO:50. As can be seen from Fig. 7-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 7413.7, and the peak was confirmed to be wild type A by analysis (the source of the sample was the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 7-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 7333.8 and 7413.7, and the peaks were confirmed to be heterozygous AGs (samples were derived from clinical samples 6), and the results were consistent with the actual results.

Figure 8 shows the results of detection of the test sample site 1494 T using the extension primer SEQ ID NO:51. As can be seen from Fig. 8-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5925.9, and the peak was confirmed to be wild type C by analysis (the sample source is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 8-2, the MALDI-TOF mass spectrometry detected a peak at a molecular weight of 6005.8, which was confirmed to be a homozygous mutation T (sample derived from clinical sample 7), and the results were consistent with the actual results.

Example 2

1 primer design

According to the selected 14 mutations of the deafness gene to be detected and/or typed, distributed in 3 genes, namely: GJB2 gene (including sites 299_300delAT and 235delC), SLC26A4 gene (including site 281C>T 919-2 A>G, 1174A>T, 1226G>A 1229C>T 1975G>C, 2027T>A 2162C>T 2168A>G and IVS15+5G>A) 1494 T and 1555A>G with mtDNA. The amplification primers designed for the above 14 deafness gene mutation sites designed in the present invention are selected from the amplification primers designed in Example 1 (see Table 7). The extension primers designed for the above 14 deafness gene mutation sites designed in the present invention are selected from the extension primers designed in Example 1 (see Table 8).

Table 7: 3 broadly amplified primers for the above 14 deafness gene mutation sites.

Primer sequence 5 primer description

acgttggatgCTTCGATGCGGACCTTCTG

Amplification primer for amplification site 299 300delAT acgttggatgCTCCTAGTGGCCATGCACG

acgttggatgTGGCGTGGACACGAAGATCA

Amplification primer for amplification site 235delC acgttggatgACTTCCCCATCTCCCACATC

acgttggatgTAGTGACGTCATTTCGGGAG

Amplification primer for amplification site 2810T acgttggatgACCAGAACTCTCAATCTGCC

acgttggatgCCAGGTTGGCTCCATATGAA

Amplification primer for amplification site 919-2A>G acgttggatgCCAATGGAGTTTTTAACATC

acgttggatgCCAGTCTCTTCCTTAGGAAT for amplification sites 1174A>T, 1226G>A and acgttggatgGTTCCTACCTGTGTCTTTCC 1229C>T amplification primers

acgttggatgAGAAAACAAATTTCTAGGG

Amplification primer for amplification site IVS15+5G>A acgttggatgTTCTATGGCAATGTCGATGG

acgttggatgCAGAAAACCAGAACCTTACC Amplified agttggatgACGTTCCCAAAGTGCCAATC primer for amplification sites 1975G>C and 2027T>A acgttggatgGACAACATTAGAAAGGACAC Expanded agttggatgGATTTCACTTGGTTCTGTAG primer for amplification site 2162C>T and 2168A>G

acgttggatgTACGATAGCCCTTATGAAAC

Amplification primer for amplification site 14940T acgttggatgGGGGTTTTAGTTAAATGTCC

acgttggatgAGCTCAGAGCGGTCAAGTTA

Amplification primer for amplification site 1555A>G acgttggatgCTAAAACCCCTACGCATTTA

Table 8: Extension primers for the above 14 deafness gene mutation sites.

Subsequent experimental steps (ie, DNA extraction, PCR amplification, SAP treatment, extension reaction, resin purification, and mass spectrometry detection) were the same as in Example 1, except that the template used was a known site 235delC, 1226G>A, 2027T> A and 1555A>G showed mutations in human genomic DNA (normal human samples and clinical samples 8-11).

The results of mass spectrometry are shown in Figures 9-12.

Figure 9 shows the results of detection of the test sample site 235ddC using the extension primer SEQ ID NO:37. As can be seen from Fig. 9-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5449.6, and the peak was confirmed to be wild type C by analysis (the sample source was the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 9-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 5449.6 and 5529.5, which were confirmed by analysis to be heterozygous deletion mutations (samples were derived from clinical sample 8), and the results were consistent with the actual results.

Figure 10 shows the results of detection of test sample site 1226G > A using the extension primer SEQ ID NO:44. As can be seen from Fig. 10-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5304.5, which was confirmed to be a wild type G by analysis (the source of the sample is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 10-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 5288.5 and 5304.5, which were confirmed by analysis to be heterozygous GA (samples derived from clinical sample 9), and the results were consistent with the actual results.

Figure 11 shows the results of detection of the test sample site 2027T > A using the extension primer SEQ ID NO:48. As can be seen from Fig. 11-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5355.5, and the peak was confirmed to be wild type G by analysis (the sample source is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 11-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 5355.5 and 5411.4, which were confirmed by analysis to be heterozygous GA (samples derived from clinical sample 10), and the results were consistent with the actual results.

Figure 12 shows the results of detection of test sample site 1555A > G using extension primer SEQ ID NO:52. As can be seen from Fig. 12-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 6394.1, which was confirmed to be wild type A by analysis (sample source is the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 12-2, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 6314.2, and the peak was confirmed to be a mutant homozygous G (the sample was derived from a clinical sample). The sample source of this 11), the results are consistent with the actual.

Example 3

1 primer design

According to the selected four mutations of the deafness gene to be detected and/or typed, distributed in three genes, namely: GJB2 gene (including site 235delC;), SLC26A4 gene (including site 919-2A> G) 14940T with mtDNA and 1555A>G. For the amplification primers designed for the above four deafness gene mutation sites designed in the present invention, see Table 9, and the extension primers are shown in Table 10.

Table 9: Amplification primers for the above four deafness gene mutation sites.

Table 10: Extension primers for the above four deafness gene mutation sites.

Subsequent experimental steps (ie: DNA extraction, PCR amplification, SAP treatment, extension reaction, resin purification, and mass spectrometry detection) were the same as in Example 1, except that the template used was a known site 919-2A>G and 1555A> G mutated human genomic DNA (normal human samples and clinical samples 12-13).

The results of mass spectrometry are shown in Figures 13-14.

Figure 13 shows the results of detection of test sample site 919-2A > G using the extension primer SEQ ID NO:42. As can be seen from Fig. 13-1, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5825.7, and the peak was confirmed to be wild type A by analysis (the source of the sample was the same as the sample source of Fig. 3-1), and the results were consistent with the actual results. As can be seen from Fig. 13-2, MALDI-TOF mass spectrometry detected peaks at molecular weights of 5745.8 and 5825.7, and the peaks were confirmed to be heterozygous AGs by analysis, and the results were in agreement with reality. As can be seen from Fig. 13-3, the MALDI-TOF mass spectrometric detection detected a peak at a molecular weight of 5745.8, and the peak was confirmed by analysis to confirm the homozygous G (sample derived from clinical sample 13), and the results were consistent with the actual results.

Figure 14 shows the results of detection of the test sample site 1555A > G using the extension primer SEQ ID NO:52. D

As for 14-1, MALDI-TOF mass spectrometry detected a peak at a molecular weight of 6394.1, which was confirmed to be wild-type A by analysis (sample source is the same as the sample source of Figure 3-1), and the results were consistent with the actual results. As can be seen from Fig. 14-2, MALDI-TOF mass spectrometry detected a peak at a molecular weight of 6314.2, which was confirmed by analysis to be a homozygous mutation G (sample derived from clinical sample 13), and the results were consistent with the actual results. In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" and the like means a specific feature described in connection with the embodiment or example. A structure, material or feature is included in at least one embodiment or example of the invention. In the present specification, the schematic representation of the above terms does not necessarily mean the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples.

While the embodiments of the present invention have been shown and described, the embodiments of the invention may The scope of the invention is defined by the claims and their equivalents.

Claims

A method for detecting a mutation at a predetermined site in a DNA sample, comprising the steps of: performing a PCR amplification reaction on the DNA sample using an amplification primer to obtain an amplification product, the amplification product Including the predetermined site;

Using an extension primer and ddNTP, using the amplification product as a template, performing an oligonucleotide extension reaction to obtain an extension product linking one base at the 3' end of the extension primer, wherein the extension primer 3 'end adjacent to the predetermined site;

Performing molecular weight detection on the extension product to obtain a molecular weight of the extension product;

Determining the type of mutation of the predetermined site based on the molecular weight of the extension product,

among them,

Preferably, the DNA sample is human whole genome DNA,

Preferably, the mutation at the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, a SLC26A4 gene, and mtDNA,

More preferably, the mutation of the GJB2 gene is at least one selected from the group consisting of 35delG, 167delT, 176-191dell6 299_300delAT and 235delC, and the mutation of the GJB3 gene is at least one selected from the group consisting of 538C>T and 547G>A. The mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G, 1174A>T, 1226G>A, 1229C>T, 1975G>C, 2027T>A, 2162C>T, 2168A>G And at least one of IVS15+5G>A, and the mutation of the mtDNA is at least one selected from the group consisting of 14940T and 1555A>G,

The amplification primer comprises a first primer and a second primer, preferably, a 35delG mutation to the GJB2 gene, the first primer is as shown in SEQ ID NO: 1, and the second primer is as SEQ ID NO: : 2, the extension primer is as shown in SEQ ID NO: 33; for the 167delT mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 3, and the second primer is as SEQ ID NO: 4, the extension primer is as set forth in SEQ ID NO: 34; for the 176-191dell6 mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 5, The second primer is as set forth in SEQ ID NO: 6, the extension primer is as set forth in SEQ ID NO: 35; and the 299-300delAT mutation is SEQ ID NO: 7 for the GJB2 gene. As shown, the second primer is as set forth in SEQ ID NO: 8, and the extension primer is as set forth in SEQ ID NO: 36; for the 235delC mutation of the GJB2 gene, the first primer is as SEQ ID NO: 9, the second primer is as shown in SEQ ID NO: 10, the extension primer is as shown in SEQ ID NO: 37; and the GJB3 gene is 538C>T mutation, the first primer is as shown in SEQ ID NO: 11, the second primer is as shown in SEQ ID NO: 12, and the extension primer is as shown in SEQ ID NO: 38 For the 547G>A mutation of the GJB3 gene, the first primer is as shown in SEQ ID NO: 13, the second primer is as shown in SEQ ID NO: 14, and the extension primer is as SEQ ID NO: 39; for the 281C>T mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 15, and the second primer is as shown in SEQ ID NO: The extension primer is as set forth in SEQ ID NO: 40; for the 589G>A mutation of the SLC26A4 gene, the first one is as shown in SEQ ID NO: 17, and the second one is as SEQ ID NO: 18, the extension primer is as set forth in SEQ ID NO: 41; for the 919-2A>G mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: The second primer is as set forth in SEQ ID NO: 20, the extension primer is as set forth in SEQ ID NO: 42; and the 1174A>T mutation is directed to the SLC26A4 gene, the first primer is SEQ. ID NO: 21, the number The primer is as set forth in SEQ ID NO: 22, the extension primer is as set forth in SEQ ID NO: 43; and the 1226G>A mutation is directed to the SLC26A4 gene, which is SEQ ID NO: 21 As shown, the second primer is as set forth in SEQ ID NO: 22, and the extension primer is as set forth in SEQ ID NO: 44; for the 1229C>T mutation of the SLC26A4 gene, the first primer is as SEQ ID NO: 21, the second primer is as set forth in SEQ ID NO: 22, the extension primer is as set forth in SEQ ID NO: 45, and the 1975G>C mutation of the SLC26A4 gene, The first primer is as set forth in SEQ ID NO: 25, the second primer is as set forth in SEQ ID NO: 26, and the extension primer is as set forth in SEQ ID NO: 47; for the SLC26A4 a 2027T>A mutation of the gene, the first primer is set forth in SEQ ID NO: 25, the second primer is set forth in SEQ ID NO: 26, and the extension primer is set forth in SEQ ID NO: 48 ; 21620T against the SLC26A4 gene Mutant, the first primer is set forth in SEQ ID NO: 27, the second primer is set forth in SEQ ID NO: 28, and the extension primer is as set forth in SEQ ID NO: 49; for the SLC26A4 a 2168A>G mutation of the gene, the first primer is set forth in SEQ ID NO: 27, the second primer is set forth in SEQ ID NO: 28, and the extension primer is set forth in SEQ ID NO: 50 For the IVS15+5G>A mutation of the SLC26A4 gene, the first primer is shown in SEQ ID NO: 23, and the second primer is as shown in SEQ ID NO: 24, the extension primer Is shown in SEQ ID NO: 46; for the 1494C>T mutation of the mtDNA gene, the first primer is as shown in SEQ ID NO: 29, and the second primer is as SEQ ID NO: 30 As shown, the extension primer is as set forth in SEQ ID NO: 51; and the 1555A>G mutation for the mtDNA gene, the first primer is set forth in SEQ ID NO: 31, and the second primer is As shown in SEQ ID NO: 32, the extension primer is as set forth in SEQ ID NO: 52.

Preferably, the first primer and the second primer have a tag sequence at the 5' end, and the tag sequence is preferably SEQ ID

NO: 53,

Preferably, before the performing the oligonucleotide extension reaction, the method further comprises the step of treating the amplification product using alkaline phosphatase.

The method according to claim 1, wherein the molecular weight detection of the extended product is carried out by MALDI-TOF mass spectrometry.

Preferably, prior to the MALDI-TOF mass spectrometric detection of the extension product, the step of purifying the extension product is further included, and the extension product is preferably purified using an anion resin.

3. A system for detecting a mutation in a predetermined site in a DNA sample, comprising:

a DNA sample amplifying device, wherein the DNA sample amplifying device is configured to perform PCR amplification on the DNA sample to obtain an amplification product, wherein the amplification product comprises the predetermined site;

An amplification product extension device, the amplification product extension device being coupled to the DNA sample amplification device to receive an amplification product from the DNA sample amplification device, and performing oligonucleotide extension on the amplification product Reacting to obtain an extension product linking one base at the 3' end of the extension primer, wherein the 3' end of the extension primer is adjacent to the predetermined site;

a molecular weight detecting device, the molecular weight detecting device being coupled to the amplification product extension device to determine a molecular weight of the extension product;

a mutation analysis device that determines a type of mutation of the predetermined site based on a molecular weight of the extension product,

among them,

Preferably, the DNA sample amplification device is provided with an amplification primer pair, and the amplification product extension device is provided with an extension primer.

Preferably, the mutation at the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and mtDNA, and more preferably, the mutation of the GJB2 gene is selected from the group consisting of 35delG, 167delT, 176-191dell6, 299_300delAT, and At least one of 235delC, wherein the mutation of the GJB3 gene is at least one selected from the group consisting of 538C>T and 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A> G, 1174A>T, 1226G>A, 1229C>T, 1975G>C, 2027T>A, 2162C>T, 2168A>G and IVS15+5G>A in at least one of, and the mutation of the mtDNA is selected from At least one of 14940T and 1555A>G,

The amplification primer comprises a first primer and a second primer, preferably a 35delG mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 1, and the second primer is as SEQ ID NO: 2, the extension primer is as shown in SEQ ID NO: 33; for the 167delT mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 3, and the second primer is As shown in SEQ ID NO: 4, the extension primer is as set forth in SEQ ID NO: 34; for the 176-191dell6 mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 5 The second primer is as set forth in SEQ ID NO: 6, the extension primer is as set forth in SEQ ID NO: 35; and the 299_300delAT mutation of the GJB2 gene is SEQ ID NO: 7 The second primer is as set forth in SEQ ID NO: 8, and the extension is shown in SEQ ID NO: 36; for the 235delC mutation of the GJB2 gene, the first primer is as SEQ. ID NO: 9, the second primer is as shown in SEQ ID NO: 10. The extension primer is as set forth in SEQ ID NO: 37; for the 538C>T mutation of the GJB3 gene, the first primer is as shown in SEQ ID NO: 11, and the second primer is as SEQ ID As indicated by NO: 12, the extension primer is as set forth in SEQ ID NO: 38; for the 547G>A mutation of the GJB3 gene, the first primer is as shown in SEQ ID NO: 13, the second The primer is as set forth in SEQ ID NO: 14, the extension primer is as set forth in SEQ ID NO: 39; the 281C>T mutation against the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: 15. The second primer is as set forth in SEQ ID NO: 16, the extension primer is as set forth in SEQ ID NO: 40, and the 589G>A mutation is directed to the SLC26A4 gene. For the SEQ ID NO: 17, the second primer is as set forth in SEQ ID NO: 18, the extension primer is as set forth in SEQ ID NO: 41; and the 919-2A is directed against the SLC26A4 gene. >G mutation, the first primer is as shown in SEQ ID NO: 19, the second primer is as shown in SEQ ID NO: 20, and the extension primer is as shown in SEQ ID NO: 42; 1174A>T of the SLC26A4 gene The first primer is as shown in SEQ ID NO: 21, the second primer is as shown in SEQ ID NO: 22, and the extension primer is as shown in SEQ ID NO: 43; The 1226G>A mutation of the SLC26A4 gene, the first primer is shown in SEQ ID NO: 21, the second primer is shown in SEQ ID NO: 22, and the extension primer is as SEQ ID NO: : 44; for the 1229C>T mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 21, and the second primer is as shown in SEQ ID NO: 22, the extension primer Is shown in SEQ ID NO: 45; for the 1975G>C mutation of the SLC26A4 gene, the first bow is as shown in SEQ ID NO: 25, and the second is SEQ ID NO: : 26, the extension primer is as set forth in SEQ ID NO: 47; for the 2027T>A mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 25, the second primer For example, as shown in SEQ ID NO: 26, the extension primer is as set forth in SEQ ID NO: 48; for the 21620T mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: Second lead As shown in SEQ ID NO: 28, the extension primer is as set forth in SEQ ID NO: 49; for the 2168A>G mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: The second primer is as set forth in SEQ ID NO: 28, and the extension primer is as set forth in SEQ ID NO: 50; the IVS15+5G>A mutation against the SLC26A4 gene, the first primer is SEQ. ID NO: 23, wherein the second primer is as set forth in SEQ ID NO: 24, the extension primer is as set forth in SEQ ID NO: 46; and the 14940T mutation is directed to the mtDNA gene, a primer is set forth in SEQ ID NO: 29, said second primer is as set forth in SEQ ID NO: 30, said extension primer is as set forth in SEQ ID NO: 51; and for said mtDNA gene 1555A>G mutation, the first primer is as shown in SEQ ID NO: 31, the second primer is as shown in SEQ ID NO: 32, and the extension primer is as shown in SEQ ID NO: 52.

Preferably further comprising:

An amplification product purification device, wherein the amplification product purification device is respectively connected to the DNA sample amplification device and the amplification product extension device to purify the amplification product and to purify the amplification The product is input to the amplification product extension device.

The system according to claim 3, wherein said molecular weight detecting means is a MALDI-TOF mass spectrometer.

The system according to claim 4, further comprising an extension product purification device, wherein

The extension product purification device is coupled to the amplification product extension device and the MALDI-TOF mass spectrometer device, respectively, to purify the extension product, and input the purified extension product to the MALDI-TOF mass spectrometer Device,

Preferably, the extension product purification device is an anion resin.

6. A method of diagnosing hereditary deafness, comprising the steps of:

Extracting DNA samples from subjects suspected of having hereditary deafness;

Mutating a mutation at a predetermined site in the DNA sample according to the method of claims 1 and 2; and determining that the subject is hereditary based on a mutation in the DNA sample in which the predetermined site is present deaf.

7. A method for prenatal diagnosis of hereditary deafness, characterized by comprising the steps of:

Isolating the fetal DNA sample, preferably the fetal DNA sample is extracted from the chorion, amniotic fluid or cord blood sample Take

A method for amplifying a predetermined site in a DNA sample of the fetus according to the method of claim 1 or 2;

The fetus is presumed to have hereditary deafness based on the presence of a mutation in the predetermined site in the DNA sample of the fetus.

8. A method for predicting an effect of an electronic cochlear, comprising the steps of:

Extracting DNA samples from patients with deafness;

The method according to claim 1 or 2, wherein the mutation of a predetermined site in the DNA sample is analyzed; and the deafness patient is determined to have hereditary deafness based on the mutation of the predetermined site in the DNA sample; Based on the deafness of the deaf patient, it is predicted that the electronic cochlear is effective for the deaf patient.

9. A primer combination characterized by comprising:

Amplifying a primer pair, the amplification primer pair being adapted to perform a PCR amplification reaction on the DNA sample to obtain an amplification product, the amplification product comprising a predetermined site;

An extension product, wherein the extension product is adapted to utilize an ddNTP, and the amplification product is used as a template, and an oligonucleotide extension reaction is performed to obtain an extension product connecting one base at the 3′ end of the extension primer, wherein The 3' end of the extension primer is adjacent to the predetermined site,

The mutation at the predetermined site is a mutation of at least one gene selected from the group consisting of a GJB2 gene, a GJB3 gene, an SLC26A4 gene, and a mtDNA, and the mutation of the GJB2 gene is at least one selected from the group consisting of 35delG, 167delT, 176-191dell6 299_300delAT, and 235delC. The mutation of the GJB3 gene is at least one selected from the group consisting of 538C>T and 547G>A, and the mutation of the SLC26A4 gene is selected from the group consisting of 281C>T, 589G>A, 919-2A>G, 1174A> At least one of T, 1226G>A, 1229C>T, 1975G>C, 2027T>A, 2162C>T, 2168A>G, and IVS15+5G>A, and the mutation of the mtDNA is selected from the group consisting of 14940T and 1555A>G At least one of the amplification primers, the first primer and the second primer,

among them,

For the 35delG mutation of the GJB2 gene, the first primer is set forth in SEQ ID NO: 1, the second primer is set forth in SEQ ID NO: 2, and the extension primer is SEQ ID NO: 33 Shown; for the 167delT mutation of the GJB2 gene, the first construct is as shown in SEQ ID NO: 3, and the second construct is as shown in SEQ ID NO: 4, the extension primer Is shown in SEQ ID NO: 34; for the 176-191dell6 mutation of the GJB2 gene, the first primer is as shown in SEQ ID NO: 5, and the second primer is as shown in SEQ ID NO: 6. , the extension bow is as shown in SEQ ID NO: 35; for the 299_300delAT mutation of the GJB2 gene, the first bow is as shown in SEQ ID NO: 7, the second bow As shown in SEQ ID NO: 8, the extension primer is as set forth in SEQ ID NO: 36; for the 235delC mutation of the GJB2 gene, the first primer is as set forth in SEQ ID NO: 9, The second primer is as set forth in SEQ ID NO: 10, the extension primer is as set forth in SEQ ID NO: 37; the 538C>T mutation against the GJB3 gene, the first primer is SEQ ID NO: 11 Shown The second primer is as set forth in SEQ ID NO: 12, the extension primer is as set forth in SEQ ID NO: 38, and the 547G>A mutation is directed to the GJB3 gene, the first primer being SEQ ID NO : 13, the second primer is as set forth in SEQ ID NO: 14, the extension primer is as set forth in SEQ ID NO: 39; the 281C>T mutation against the SLC26A4 gene, the first primer As shown in SEQ ID NO: 15, the second primer is as set forth in SEQ ID NO: 16, the extension primer is as set forth in SEQ ID NO: 40; the 589G>A mutation against the SLC26A4 gene, The first primer is as set forth in SEQ ID NO: 17, the second primer is as set forth in SEQ ID NO: 18, and the extension primer is as set forth in SEQ ID NO: 41; for the SLC26A4 a 919-2A>G mutation of the gene, the first primer is set forth in SEQ ID NO: 19, the second primer is set forth in SEQ ID NO: 20, and the extension primer is SEQ ID NO: 42 Shown; for the 1174A>T mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: 21, and the second primer is as set forth in SEQ ID NO: 22, the extension primer As SEQ I D NO: 43; for the 1226G>A mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 21, and the second primer is as shown in SEQ ID NO: The extension primer is as set forth in SEQ ID NO: 44; for the 1229C>T mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: 21, and the second primer is as SEQ ID NO: : 22, The extension primer is as set forth in SEQ ID NO: 45; for the 1975G>C mutation of the SLC26A4 gene, the first primer is as set forth in SEQ ID NO: 25, and the second primer is as SEQ. ID NO: 26, the extension primer is as shown in SEQ ID NO: 47; for the 2027T A mutation of the SLC26A4 gene, the first primer is as shown in SEQ ID NO: 25, the second The primer is as set forth in SEQ ID NO: 26, the extension primer is as set forth in SEQ ID NO: 48, and the first primer is as shown in SEQ ID NO: 27 for the 21620T mutation of the SLC26A4 gene. The second primer is as set forth in SEQ ID NO: 28, and the extension primer is as set forth in SEQ ID NO: 49; for the 2168A>G mutation of the SLC26A4 gene, the first primer is as SEQ ID NO: As shown in Figure 27, the second primer is as set forth in SEQ ID NO: 28, the extension primer is as set forth in SEQ ID NO: 50; the IVS15+5G>A mutation against the SLC26A4 gene, the first The primer is as set forth in SEQ ID NO: 23, the second primer is as set forth in SEQ ID NO: 24, and the extension primer is as set forth in SEQ ID NO: 46; a 14940T mutation, the first primer is set forth in SEQ ID NO: 29, the second primer is set forth in SEQ ID NO: 30, the extension primer is as set forth in SEQ ID NO: 51; a 1555A>G mutation of the mtDNA gene, the first primer is as set forth in SEQ ID NO: 31, the second primer is as set forth in SEQ ID NO: 32, and the extension is as SEQ ID NO: 52,

Preferably, the 5' end of the first and second objects has a tag sequence, and the tag sequence is as SEQ ID NO:

53 shows.

10. A kit, comprising:

A combination of objects according to claim 9,

Preferably, the kit is for use in at least one selected from the group consisting of detecting a mutation at a predetermined site in a DNA sample, diagnosing hereditary deafness, prenatal diagnosis of hereditary deafness, and predicting the effect of an electronic cochlear.