CN101838683A - Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene - Google Patents
Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene Download PDFInfo
- Publication number
- CN101838683A CN101838683A CN 200910177851 CN200910177851A CN101838683A CN 101838683 A CN101838683 A CN 101838683A CN 200910177851 CN200910177851 CN 200910177851 CN 200910177851 A CN200910177851 A CN 200910177851A CN 101838683 A CN101838683 A CN 101838683A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- extension
- gene
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting the nucleotide mutation points of a KRAS gene and/or a BRAF gene, which comprises the following steps that: (1) the mutation points to be detected of the KRAS gene and/or the BRAF gene are determined; (2) according to the mutation points, an amplification primer and the extension primer of each mutation point are designed; (3) PCR amplification; (4) SAP enzyme treatment; (5) extension reaction; (6) resin is adopted to purify an extension reaction product; and (7) mass spectrometry detection, the mutant of the target sites of the KRAS gene and/or the BRAF gene to be detected is determined. The method solves the problems of low sensitivity, limited accuracy, low flux and high cost of a traditional detection method. In addition, the invention also provides a specific primer and a primer combination of the method and the purposes thereof for the detection method.
Description
Technical field
The invention belongs to organic-biological molecule field in genomics and the molecular biology, in particular to the detection method of the nucleotide mutant site of KRAS gene and/or BRAF gene.
Background technology
The genetic information of the most of organisms of nature all is included in the thymus nucleic acid (DNA), 3,000,000,000 bases in the human full genome, and about 40,000 genes are distributed on 24 pairs of karyomit(e)s.Each gene is by transcribing, translating, and the special protein of encoding is regulated and control specific biochemical reaction in the organism, brings into play special biological function.The change of dna sequence dna, i.e. transgenation can cause the change or the disappearance of protein structure, function, and then causes relevant genetic diseases.Transgenation comprises insertion, disappearance and the change (point mutation) that base pair takes place in the dna molecular.
Studies show that the generation of numerous disease, closely related as more than 3000 disease such as hemophilia, thalassemia, Du Shi type muscular dystrophy, Huntington chorea, senile dementia, diabetes, obesity, cardiovascular disorder and autoimmunization and transgenation.In addition, people recognize that gradually the generation development of cancer also is a gene accumulation results of mutation in recent years.
In human genome, about 90% difference is that the difference with single Nucleotide embodies, mainly conversion (transition) or the transversion (transversion) by single base caused, such difference site be called single nucleotide polymorphism (single nucleotide polymorphism, SNP).In the crowd, the occurrence frequency of this variation is greater than 1% at least, otherwise is considered to point mutation.SNP site great majority are bifurcation, and two kinds of manifestation are promptly only arranged on a site, and extensively exist in human genome, just have 1 in average every 500-1000 base pair, estimate that its sum can reach 3,000,000 even more.These differences very likely are to cause the inherited genetic factors of individual difference, find that therefore these sites can be widely used in research fields such as the research of genetic marker, assessment idiogenetics relation, assessment spore.
The method that detects SNP and transgenation at present has many kinds, as direct PCR order-checking, RFLP, gene chip and quantitative fluorescent PCR etc.Wherein, directly the PCR order-checking is least responsive, has only the medicament-resistant mutation strain to reach more than 20% and just can be detected; Be not suitable for extensive screening yet; Rflp analysis can only detect in virus is overall mutant strain greater than 5%, but for each interested sudden change, must the independent endonuclease of special design.Specificity restriction endonuclease at some sudden change may not exist, so rflp analysis and be not suitable for all sudden changes.Biochip technology is utilized the oligonucleotide microarray, can detect newfound sudden change, but this method costs dearly, and is not used widely.In a word, above-mentioned these methods do not waste time and energy, and sensitivity is low, and accuracy is low, is exactly the cost height, is not suitable for extensive examination.
KRAS gene and BRAF gene
Before entering individuation targeted therapy course of treatment as colorectal cancer patients, the KRAS detection in Gene Mutation needs the detection carried out, classified in " colorectal carcinoma clinical treatment guide " as requisite one, be used for assist clinicians and filter out the colorectal cancer patients that to benefit from Cetuximab (Erbitux) and Panitumumab specificss such as (handkerchief Buddhist nun monoclonal antibodies) by NCCN (american cancer integrated network).Studies show that the KRAS transgenation mainly occurs on coding 12 and 13 (being positioned at the 2nd exon) position in the tumor tissues, occurrence frequency is about 25.4%, 9.2%, in addition, the small part sudden change occurs on coding 61 and 146 positions, and occurrence frequency is about 0.4% and 1.3%.The do not undergo mutation patient of (somatic mutation) takes relevant target therapeutic agent, can obtain obvious result of treatment, and the sudden change patient is to this type of targeted drug resistance.
The BRAF gene is as an important step in the MAPK path, and its mutation type is mainly V600E, but its sudden change inducing cell propagation stops apoptosis; The existence of wild-type BRAF gene is that colorectal cancer patients is used Erbitux and the effective essential condition of Pa Ni monoclonal antibody.
Therefore the detection that the resistance in said mutation site is suddenlyd change has the important clinical meaning.
The detection of the nucleotide mutant site of KRAS gene and BRAF gene
Sudden change for KRAS gene and BRAF gene at present detects method, direct method and the mass spectrometric detection method that checks order that the method for using mainly contains quantitative fluorescent PCR.
7 kinds of mutation types that quantitative fluorescent PCR is primarily aimed at BRAF gene V600E, KRAS gene 12,13 bit codons detect, and judge that by the fluorescent signal of detected result described site has or not sudden change.The most frequently used probe type of quantitative fluorescent PCR is the Taqman probe, fluorophor commonly used has FAM, TET and VIC etc., when probe is complete, because the quenching of fluorescence group itself can cause background higher by the different fluorescence of emission wavelength when absorbing reporter group institute emitted fluorescence energy.
Directly the method for order-checking mainly obtains to contain the full length sequence in mutational site by order-checking.Be primarily aimed at KRAS gene 12,13 at present and 61 bit codons carry out, this method shortcoming is to need the content of mutant in the sample to be checked to reach higher proportion, and the 20-30% that generally needs the content of sudden change sample to account for whole sample sizes just can have quite good detecting effectiveness.
No matter be fluorescent quantitation or directly order-checking, all there is the not high problem of sensitivity.The detection limit of bibliographical information quantitative fluorescent PCR is about about 5% (be the ratio of mutant account for total sample ratio 5%), only is about 20% based on the detection limit of the detection method of order-checking.By comparison, mass-spectrometric technique can detect the sudden change that is low to moderate 1% ratio, and sensitivity is higher.
But mutational site and type that the mass spectrometry method that detects the KRAS gene at present can detect are less, cover incomplete.Because the mass spectroscopy cost is higher, therefore wish in a mass spectroscopy, to detect nucleotide mutant site as much as possible.
Therefore, need the method for the nucleotide mutant site of new detection KRAS gene and/or BRAF gene in this area badly, thereby realize a plurality of nucleotide mutant sites of KRAS gene and/or BRAF gene and the quick and easy detection of mutant.
Summary of the invention
The object of the present invention is to provide the detection method of the nucleotide mutant site of a kind of KRAS gene and/or BRAF gene, be intended to solve the lower and cost problem of higher of existing detection method efficient.
In a first aspect of the present invention, a kind of detection method of nucleotide mutant site is provided, comprise the steps:
(1), determines the position of mutational site in sequence to be checked at the mutational site of nucleotide sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) handle by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are to be that purpose was carried out four kinds of ddNTP molecules that quality is modified to enlarge molecular weight difference;
(6) adopt resin purification extension product;
(7) with product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then and carry out mass spectrometric detection, determine the genotype of sudden change;
The employed amplimer of wherein said step (2) is to being the combination with polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ IDNO:2;
And the employed extension primer of wherein said step (5) comprises polynucleotide with SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each one or more.
In a preferred embodiment of the invention, employed amplimer is to also comprising the one or more pairs of SEQ of having ID NO:3 and SEQ ID NO:4, and the combination of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6, and employed extension primer also comprises the polynucleotide with sequence shown in SEQ IDNO:13 to the SEQ ID NO:18.
In another preferred embodiment of the present invention, employed amplimer is to also comprising the combination with polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8, and employed extension primer also comprises the polynucleotide with sequence shown in the SEQ ID NO:19.
In another preferred embodiment of the present invention, use nucleotide mutant site that method of the present invention detects to be in 12,13,61 and 146 bit codons of KRAS gene one or more.
In another preferred embodiment of the present invention, also detect the sudden change of 600 bit codons of BRAF gene simultaneously.
In addition, the present invention also provides Auele Specific Primer and the combination of primers that is used for above-mentioned detection method, and this primer and combination of primers are used to detect the purposes of the nucleotide mutant site of KRAS gene and/or BRAF gene.
The mass spectrometric detection method of using the combination of method of the present invention and primer to carry out has covered drug-fast all hotspot location of present KRAS transgenation, and the highly sensitive characteristics of utilizing mass spectrum itself to detect realize the KRAS detection in Gene Mutation of highly sensitive, all standing.
In addition, the mass spectrometric detection method of using the combination of method of the present invention and primer to carry out can detect the sudden change of KRAS gene and BRAF gene simultaneously, can cover all hotspot location of present KRAS gene and BRAF gene medicament-resistant mutation.Not only improve the accuracy rate and the detection efficiency of detection in Gene Mutation greatly, also simplified schedule of operation, and saved time and cost.
Description of drawings
Fig. 1 is for use extending the result that primer KRAS12c2, KRAS13c2 detect 12 and 13 codons of test sample book KRAS gene.
Fig. 2 is for use extending the result that primer KRAS61c2# 1, KRAS61c2# 2 and KRAS146c1 detect 61 and 146 codons of test sample book KRAS gene.
Figure 3 shows that and use to extend the result that primer BRAF V600E detects 600 codons of test sample book BRAF gene.
Fig. 4 is for use extending the result that primer KRAS12C1, KRAS12C2, KRAS13C1, KRAS13C2 and BRAF V600E detect 600 codons of 12,13 codons of the KRAS gene of test sample book and BRAF gene simultaneously.
Fig. 5 is for use extending the result that primer KRAS61c2# 1, KRAS61c2#2, KRAS61c 3, KRAS146c1 and KRAS146c2 detect 61 and 146 codons of the KRAS gene of test sample book simultaneously.
Fig. 6 is for use extending the result that primer KRAS61c1 detects 61 codons of the KRAS gene of test sample book.
Embodiment
In a first aspect of the present invention, a kind of detection method of nucleotide mutant site is provided, comprise the steps:
(1), determines the position of mutational site in sequence to be checked at the mutational site of nucleotide sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) handle by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are to be that purpose was carried out four kinds of ddNTP molecules that quality is modified to enlarge molecular weight difference;
(6) adopt resin purification extension product;
(7) with product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then and carry out mass spectrometric detection, determine the genotype of sudden change;
The employed amplimer of wherein said step (2) is to for having the combination of the polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ IDNO:2,
And the employed extension primer of wherein said step (5) comprises polynucleotide with SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each one or more.
Specifically describe a plurality of preferred embodiments of the present invention below, it should be understood that these embodiments are intended to describe in detail the present invention, not in office where face constitutes limitation of the scope of the invention.
Determining of mutational site
In the step (1) of the inventive method,, determine the position of mutational site in sequence to be checked at the mutational site that nucleotide sequence to be checked may exist.
In human genome, about 90% difference is that the difference with single Nucleotide embodies, mainly conversion (transition) or the transversion (transversion) by single base caused, such difference site be called single nucleotide polymorphism (single nucleotide polymorphism, SNP).In the crowd, the occurrence frequency of this variation is greater than 1% at least, otherwise is considered to point mutation.SNP site great majority are bifurcation, and two kinds of manifestation are promptly only arranged on a site, and extensively exist in human genome, just have 1 in average every 500-1000 base pair, estimate that its sum can reach 3,000,000 even more.
For the KRAS gene, studies show that the KRAS transgenation mainly occurs on codon 12 and 13 (being positioned at the 2nd exon) position in the tumor tissues, occurrence frequency is about 25.4%, 9.2%, in addition, the small part sudden change occurs on codon 61 and 146 positions, and occurrence frequency is about 0.4% and 1.3%.The do not undergo mutation patient of (somatic mutation) takes relevant target therapeutic agent, can obtain obvious result of treatment, and the sudden change patient is to this type of targeted drug resistance.
KRAS gene 12 bit codon wild-types are GGT, and its common mutations type comprises CGT, AGT, TGT and GCT, GAT, GTT; KRAS gene 13 bit codon wild-types are GGC, and its common mutations type comprises CGC, AGC, TGC and GCC, GAC, GTC; KRAS gene 61 bit codon wild-types are CAA, and its common mutations type comprises AAA, GAA, CCA, CGA, CTA, CAC and CAT; KRAS gene 146 bit codon wild-types are GCA, and its common mutations type comprises ACA, CCA, GTA.
For the BRAF gene, BRAF is an important step in the MAPK path, and its mutation type is mainly V600E, but this sudden change inducing cell increment stops apoptosis.Therefore the existence of wild-type BRAF gene is that colorectal cancer patients is used Erbitux and the effective essential condition of Pa Ni monoclonal antibody.The wild-type of the 600th bit codon of BRAF gene is GTG, and its common mutations type comprises GAG, GCG.
Therefore, embodiment of the present invention are above-mentioned each the mutational site design primers at KRAS gene and/or BRAF gene.
Design of primers
In the step (2) of the inventive method, according to the Position Design primer in mutational site, comprising a pair of amplimer, every primer length is 30bp at least, and its 5 ' end respectively contains the tag of 10bp; And the extension primer, its length is 17-28bp, just in time is positioned at the 5 ' end in mutational site, 3 ' must have 9 bases to mate fully.
In another preferred embodiment of the present invention, above-mentioned steps (2) can also comprise: according between primer, do not form dimer between primer and amplified production/extension products, primer self does not form hairpin structure, and the principle that mispairing does not take place between primer and template.
The extension primer that is used for mass spectrometric detection is greater than 30Da according to every mutual difference of molecular weight of extending primer, each molecular weight difference that extends between primer and each extension products is not less than 9Da, and the molecular weight that extends primer and extension products will be in the principle between 4,500 one 8500Da.
The amplimer of a plurality of detection site is mixed with amplimer, extend primer and mix with the extension primer.Can detect a plurality of discrete SNP site so simultaneously, improve efficient, provide cost savings.
In another preferred embodiment of the present invention, continuous a plurality of mutational sites can also be marked at same nucleotides sequence lists, and shared a pair of amplimer, both sides design is to the left and right taked in the mutational site at two ends, the extension primer in mutational site, left side is taked the forward design, and the extension primer in mutational site, right side is taked reverse design; The extension primer that is positioned at the intermediary mutational site has many, and comprises all Nucleotide situations that the mutational site of its upstream may exist.Like this, can detect a plurality of sites of continuous sudden change simultaneously, provide cost savings, shorten the cycle, improve efficient.Specifically, can adopt following method to design the extension primer in continuous a plurality of mutational sites: if mutational site, described left side is Snp1, the intermediary mutational site is Snp2, and the mutational site, right side is Snp3, and Snp1/Snp2/Snp3 place sequence is:
TCAGCGATAT[C/T] C[G/A] [T/G] AATTCGTACGATGATCGCTA GA ... Snp1[C/T then], SNP site, right side, the forward design, the extension primer is: ... TCAGCGATATSnp3[T/G], SNP site, left side, reverse design, the extension primer is: ... TACGAATTSnp2[G/A], middle SNP site, degenerated primer, the extension primer is: ... AGCGATATCC and ... AGCGATATTC.
In specific embodiments of the present invention, used following one or more pairs of following amplimer to and one or more following extension primers, the sequence of each primer and sequence numbering and explanation see the following form 1
Table 1: amplimer of the present invention and extension primer
| The extension primer (KRAS61c2#2) of base | ||
| ??SEQ?ID?NO：16 | ??GTCCCTCATTGCACTGTACTCCTC | Detect the extension primer (KRAS61c3) of KRAS61 codon the 3rd bit base |
| ??SEQ?ID?NO：17 | ??AATTCCTTTTATTGAAACATCA | Detect the extension primer (KRAS146c1) of KRAS146 codon first bit base |
| ??SEQ?ID?NO：18 | ??TACTTACCTGTCTTGTCTTT | Detect the extension primer (KRAS146c2) of KRAS146 codon second bit base |
| ??SEQ?ID?NO：19 | ??ACCCACTCCATCGAGATTTC | Detect the extension primer of BRAF600 codon GAG, GCG sudden change |
Pcr amplification
In the step (3) of present method, the purpose fragment is carried out pcr amplification, the condition of amplified reaction is well known to those skilled in the art, and also describes exemplary reaction conditions in an embodiment of the present invention in detail.And, the condition of amplified reaction is carried out certain variation or optimized also within those skilled in the art's limit of power according to the concrete sequence of employed primer of the present invention.
In amplification step of the present invention, the amplimer of use is to being the primer with SEQ ID NO:1 and SEQ ID NO:2.
In a preferred embodiment of the invention, the amplimer of use is to also comprising the one or more pairs of SEQ of having ID NO:3 and SEQ ID NO:4, and the mixture of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6.
In another preferred embodiment of the present invention, the amplimer of use is to also comprising the mixture with polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8.
The SAP enzyme is handled
In the step (4) of the inventive method, amplified production is carried out SAP enzyme (shrimp alkaline phosphotase) handle, remove the dNTP that contains in the described amplified production, can be with unreacted dNTP dephosphorylation, stop it to participate in the subsequent reactions, only extend a base when guaranteeing extension.
Extension
In the step (5) of the inventive method, the amplified production of handling through SAP is carried out extension, in extension, use extension primer of the present invention, a base (ddNTP) that how difference of resulting extension products and extension primer only has been its 3 ' end.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and the resolving power of total system is improved.
Use the ddNTP that modifies through quality in the method for the invention, carry out main purpose that quality modifies and be in order to make molecular weight differences between each extension products, thereby improve the resolving power of follow-up mass spectroscopy apart from increasing.The method of ddNTP being carried out the quality modification is known.
As a preferred embodiment of the present invention, the molecular weight of four kinds of ddNTP is respectively: ddATP, 271.2Da, ddTTP 327.1Da, ddCTP 247.2Da and ddGTP 287.2Da; Wherein molecular weight difference is more than 16Da.
In the method for the invention, employed extension primer comprises one or more of polynucleotide with SEQ ID NO:9 to SEQID NO:12 sequence shown in each.
In a preferred embodiment of the invention, employed extension primer comprises one or more of polynucleotide with SEQ IDNO:13 to SEQ ID NO:18 sequence shown in each.
In another preferred embodiment again of the present invention, employed extension primer also comprises the polynucleotide with sequence shown in the SEQ ID NO:19.
In other specific embodiments of the present invention, can use each combination of primers as described below to carry out extension and the order-checking of mass spectrum subsequently: (1) is with KRAS12c1, KRAS12c2, KRAS13c1, KRAS13c2, BRAF V600E combination is used for an extension system and places a mass spectrometric well to detect simultaneously reaction product, and the mutant that is detected is: KRAS gene 12 bit codon mutation types (comprise CGT, AGT, TGT and GCT, GAT, GTT) and KRAS gene 13 bit codon mutation types (comprise CGC, AGC, TGC and GCC, GAC, GTC) and BRAF gene the 600th codon mutation type (comprising GAG and GCG); (2) KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1, KRAS146c2 combination are used for an extension system and place a mass spectrometric well to detect simultaneously reaction product, the mutant that is detected is: KRAS gene 61 bit codon mutation types (comprising CCA, CGA, CTA, CAC and CAT) and KRAS gene 146 bit codon mutation types (comprising ACA, CCA, GTA); (3) use KRAS61c1 to carry out extension separately and place mass spectrometric independent well to detect reaction product, the mutant that is detected is 61 bit codon mutation types (comprising AAA, GAA).
Mass spectroscopy
In the step (7) of the inventive method, purified extension products is carried out mass spectroscopy, thereby determine the molecular weight of each extension products.
In preferred implementation of the present invention, mass spectrograph is selected ground substance assistant laser desorption ionization flight time mass spectrum (MALDI-TOF-MS).The reaction system of this flight time mass spectrum gene type system is non-hybridization dependency, does not exist potential hybridization mispairing to disturb, do not need to introduce various markers yet, thereby the accuracy height.
In described method, with purified product and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then, because substrate molecule absorbs energy through radiation, cause energy to be accumulated and heat production rapidly, thereby make the host crystal distillation, nucleic acid molecule will desorption and is changed metastable state ion into, the ion that produces mostly is single charge ion, these single charge ions obtain identical kinetic energy in accelerating field, and then are separated according to its mass-to-charge ratio rate in a non-electric field drift region, and flight arrives detector in the vacuum tubule.Like this, it is not only convenient to adopt mass spectrograph to detect mutational site to be detected, and highly sensitive, accuracy is high.
Compared with prior art, the present invention adopts matrix-assisted laser desorption/ionization flight time mass spectrum (MALDI-TOF-MS) system to detect, the reagent consumptive material that uses in mass-spectrometric technique is simple relatively and stable, do not need fluorescence dye, special expensive reagent such as enzyme, reaction can be carried out in micro-system, reduces the use of sample and various running stores.
Because mass-spectrometric technique directly detects the molecular weight (mass-to-charge ratio) of DNA, directly determine the type of base, do not need through any type of conversion of signals, as long as there is the SNP segment of a copy to be amplified and can to discern in theory, stopped the possibility that false negative takes place.Mass-spectrometric technique also has automatization, high throughput testing characteristics in addition.Mass-spectrometric technique combines with many primer extensions technology, can in a reaction system, detect a plurality of mutational sites simultaneously, the PCR reaction can be carried out in micro-system, automatically extract equipment, multiple PCR primer design software and data analysis software in conjunction with DNA, alleviate workload greatly, improved the detection flux.
In order to make purpose of the present invention, technical scheme and advantage clearer,, the present invention is further elaborated below in conjunction with accompanying drawing and following embodiment.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.
Embodiment 1: the nucleotide mutant site that detects the KRAS gene
(1) amplimer of design amplification KRAS gene the 12nd, 13,61 and 146 codons and being used to detects the extension primer of the coding mutation in each site
Mass spectrometric detection at the said mutation site, according to KRAS gene order (NCBI accession number: EU332849), design each amplimer and extend primer, each amplimer all has the sequence label of 10 base acgttggatg at 5 ' end, the sequence and the sequence numbering of described each amplimer and extension primer see the above table 1.
(2) pcr amplification
Sample is the DNA that extracts from the paraffin section tissue, and the picked at random sample is tested, and is provided with simultaneously and does not contain the dna sample of sudden change as negative control.
By pcr amplification, obtain to contain the target sequence amplified production in described mutational site.Reaction system is 5 μ l, wherein contains 2mM Mg2+, 1 * damping fluid, 100nM amplimer, 500 μ MdNTP, 0.5U HotstarTaq enzyme (except that amplimer, all the other are all available from U.S. Sequenom company); Reaction conditions is 94 ℃, 15min; 94 ℃ of sex change 20s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, coamplification 45 circulations; Final 72 ℃ are extended 3min.After the PCR reaction, the copy number that has the nucleotide sequence in mutational site in the KRAS genomic dna has obtained amplification.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up SAP and handle.
(3) SAP handles
The PCR reaction product is handled through SAP, removes unnecessary dNTPs.Concrete SAP reaction system: 1 * SAP damping fluid and 0.5U SAP enzyme (available from Fermentas company); The reaction cumulative volume is 7 μ l (2 μ l SAP+5 μ l PCR products).Reaction conditions is: 37 ℃ of 40min, 85 ℃ of 5min.SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.Purified product after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up extension.
(4) extension
The aforementioned reaction product of handling through SAP is carried out extension, connect a base at the 3 ' end that extends primer, molecular weight difference is not less than 9Da between extension products that obtains and the described extension primer, and the molecular weight difference between other extension products of each mutant is not less than 9Da.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and the resolving power of total system is improved.
The extension system is 9 μ l, the reaction density of damping fluid, ddNTPs (quality is through modifying), iPLEX enzyme all ingredients such as (all available from U.S. Sequenom companies) is different because of the difference of reaction times, the concentration of extending primer sees the following form 2, and the reaction cumulative volume is 9 μ l (2 μ l extension mixtures+7 μ l SAP handle product).Reaction conditions: 94 ℃ of 30s; 40 circulations [94 ℃ of 5s, 5 partial circulatings (52 ℃ of 5s, 80 ℃ of 5s)], 72 ℃ of 3min.Extension products after reaction is finished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, also can be directly used in follow-up resin purification.
Table 2: employed extension primer concentration
| The primer title | Concentration (μ M/9 μ l reaction system) |
| ??KRAS12c1 | ??0.726 |
| ??KRAS12c2 | ??0.964 |
| ??KRAS13c1 | ??0.753 |
| ??KRAS13c2 | ??0.837 |
| ??KRAS61c1 | ??0.731 |
| ?? |
??0.728 |
| ?? |
??0.715 |
| ??KRAS61c3 | ??1.061 |
| ??KRAS146c1 | ??0.985 |
| ??KRAS146c2 | ??0.882 |
(5) adopt resin purification extension product.
Add 6mg resin (available from U.S. Sequenom company, model 08040) in the product of extension, 30min turns upside down.Through the reaction of this step, resin combines positively charged ion abundant and in the reaction system, thereby makes the reaction system desalination.The purified product of reaction after finishing can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃, is directly used in mass spectrometric detection but also get supernatant behind the centrifugal 5min of 4000rpm.
(6) mass spectrometric detection
Product behind the purifying and chip matrix cocrystallization are put into the mass spectrometric valve tube of Sequenom with this crystal, excite with instantaneous nanosecond light laser then, and carry out MALDI-TOF-MS and analyze, thus the genotype in definite each mutational site of KRAS gene to be detected.
The result of mass spectrometric detection Figure 1 shows that and use to extend the result that primer KRAS12c2 and KRAS13c2 detect 12 and 13 codons of test sample book KRAS gene shown in following each figure.The negative check sample of sample 1A wherein, sample 1B and 1C are sample to be tested.For negative control sample 1A,, therefore use the extension products molecular weight that extends primer KRAS12c2 and KRAS13c2 gained to be 6819.5Da (Figure 1A-1) and 5393.5Da (Figure 1A-2) because codon is not undergone mutation; For sample 1B, the molecular weight of mass spectrometric detection KRAS12c2 product is 6819.5Da and 6803.5Da, can determine that the sudden change (Figure 1B) of KRAS12 bit codon second base has taken place sample 1B; For sample 1C, the molecular weight of mass spectrometric detection KRAS13c2 product is respectively 5393.5Da and 5473.5Da, can infer the sudden change (seeing Fig. 1 C) that has KRAS13 bit codon second base in this sample.
Figure 2 shows that and use to extend the result that primer KRAS61c2# 1, KRAS61c2# 2 and KRAS146c1 detect 61 and 146 codons of test sample book KRAS gene.The negative check sample of 2A wherein, sample 2B and 2C are sample to be tested.For negative control sample 2A, because codon is not undergone mutation, and KRAS61c2 is detected simultaneously with KRAS61c2# 1 and two primers of KRAS61c2# 2, so KRAS61c2# 1, KRAS61c2# 2, KRAS146c1 extension products molecular weight are respectively 5426.57Da (Fig. 2 A-1), 6016.81 (Fig. 2 A-2) and 6954.59Da (Fig. 2 A-3); For sample 2B, the molecular weight of mass spectrometric detection KRAS61c2# 1, KRAS61c2# 2 extension products is 5442.57Da and 5936.89Da, can determine that the sudden change (Fig. 2 B-1,2B-2) of KRAS61c2 bit codon second base has taken place sample 2B; For sample 2C, the molecular weight of mass spectrometric detection KRAS146c1 product is 6938.59Da, can infer the sudden change (seeing Fig. 2 C) that has KRAS146c1 bit codon first base in this sample.
From The above results as can be seen, use method of the present invention and primer to detect the drug-fast mutant sites of KRAS gene, can increase at the same time the KRAS gene the 12nd, 13,61 and 146 codons the various mutations type and carry out mass spectrometric detection, compared with prior art, improve detection efficiency greatly, and reduced the detection cost.
Embodiment 2: each mutational site of detecting KRAS and BRAF gene simultaneously.
In the present embodiment, detect the 12nd, 13,61 and 146 bit codons of KRAS gene and the 600th bit codon of BRAF gene simultaneously.
(1) is designed for the extension primer that the amplimer of amplification BRAF gene the 600th codon and being used to detects the coding mutation of this codon
The wild-type of BRAE gene the 600th codon is GTG, and its common mutations type comprises GAG and GCG.(the NCBI accession number: NG_007873), design each amplimer and extend primer, each amplimer all has the sequence label of 10 base acgttggatg at 5 ' end according to the BRAF gene order.The amplimer of each codon of KRAS gene of being used to increase is identical with embodiment 1.The sequence and the sequence numbering of described each amplimer and extension primer see the above table 1.
(2) pcr amplification
Reaction system is similar to embodiment 1 with condition, and difference only has been also to add concentration in reaction system be the BRAF amplimer mixture of 100nM, by pcr amplification, obtains to contain the target sequence amplified production in described mutational site.
(3) SAP handles
Aforesaid PCR mixture of reaction products is handled by SAP digestive ferment (shrimp alkaline phosphotase), and the system of described SAP reaction is identical with embodiment 1 with condition.
(4) extension
The extension system is similar to embodiment 1 with condition, difference only has been also to add the extension primer that is used to detect BRAE the 600th bit codon shown in the SEQ ID NO:19 in reaction system, the concentration of described extension primer is 0.879 μ M/9 μ l reaction system.
In the present embodiment, also used each combination of primers as described below to carry out extension and the order-checking of mass spectrum subsequently: (1) is with KRAS12c1, KRAS12c2, KRAS13c1, KRAS13c2, the BRAEV600E combination is used for an extension system and places a mass spectrometric well to detect simultaneously reaction product, and the mutant that is detected is: KRAS gene 12 bit codon mutation types (comprise CGT, AGT, TGT and GCT, GAT, GTT) and KRAS gene 13 bit codon mutation types (comprise CGC, AGC, TGC and GCC, GAC, GTC) and BRAE gene the 600th codon mutation type (comprising GAG and GCG); (2) KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1, KRAS146c2 combination are used for an extension system and place a mass spectrometric well to detect simultaneously reaction product, the mutant that is detected is: KRAS gene 61 bit codon mutation types (comprising CCA, CGA, CTA, CAC and CAT) and KRAS gene 146 bit codon mutation types (comprising ACA, CCA, GTA); (3) use KRAS61c1 to carry out extension separately and place mass spectrometric independent well to detect reaction product, the mutant that is detected is 61 bit codon mutation types (comprising AAA, GAA).
(5) adopt resin purification extension product.
The resin purification step is identical with embodiment 1.
(6) mass spectrometric detection
Carry out mass spectrometric detection according to the method identical, determine the genotype in each mutational site of KRAS gene and BRAF gene with embodiment 1.
Mass spectrometric detection the results are shown in following each figure.Figure 3 shows that and use to extend the result that primer BRAF V600E detects 600 codons of test sample book BRAF gene.The negative check sample of sample 3A, sample 3B are sample to be tested.For negative control sample 3A, owing to codon is not undergone mutation, so BRAF V600E extension products molecular weight is 6597.3Da (Fig. 3 A); For sample 3B, the molecular weight of mass spectrometric detection BRAF V600E extension products is 6597.3Da and 6653.2Da, can determine that BRAF V600E bit codon mutation (Fig. 3 B) has taken place sample 3B.
Fig. 4 is for use extending the result that primer KRAS12C1, KRAS12C2, KRAS13C1, KRAS13C2 and BRAF V600E detect 600 codons of 12,13 codons of the KRAS gene of test sample book and BRAF gene simultaneously.The detected result of sample 4A being shown the molecular weight of extension products is respectively 5574.6,6819.5,5995.9,5393.5 and 6597.3Da, does not undergo mutation in the above site of visible sample 4A.
Fig. 5 is for use extending the result that primer KRAS61c2# 1, KRAS61c2# 2, KRAS61c3, KRAS146c1 and KRAS146c2 detect 61 and 146 codons of the KRAS gene of test sample book simultaneously.Detected result to sample 5 shows that the molecular weight of extension products is respectively 5426.57Da, 6016.81Da, 7517.8Da, 6954.59Da and 6902.1Da, does not undergo mutation in the above site of visible sample 5.
Fig. 6 is for use extending the result that primer KRAS61c1 detects 61 codons of the KRAS gene of test sample book.Detected result to sample 6 shows that the molecular weight of extension products is respectively 5417.6Da, does not undergo mutation in this site of visible sample 6.
From The above results as can be seen, use method of the present invention and primer to detect the drug-fast mutant sites of KRAS gene and BRAF gene, can in a mass spectrometric detection, detect the 12nd, 13,61 and 146 codons of KRAS gene and the various mutations type of BRAF gene the 600th bit codon simultaneously, compared with prior art, improve detection efficiency greatly, and reduced the detection cost.
The above only is a preferred and specific embodiment of the present invention, not in order to restriction the present invention, all any modifications of being done within the spirit and principles in the present invention, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.
Sequence table
＜110〉Shenzhen Huada Genetic Technology Co., Ltd
＜120〉detection method of the nucleotide mutant site of a kind of KRAS gene and/or BRAF gene
<130>CP1091108/CB
<160>19
<170>PatentIn?version?3.3
<210>1
<211>30
<212>DNA
＜213〉artificial sequence
<400>1
acgttggatg?ggcctgctga?aaatgactga??????????????????????????????????????30
<210>2
<211>30
<212>DNA
＜213〉artificial sequence
<400>2
acgttggatg?gttggatcat?attcgtccac??????????????????????????????????????30
<210>3
<211>29
<212>DNA
＜213〉artificial sequence
<400>3
acgttggatg?ggagaaacct?gtctcttgg???????????????????????????????????????29
<210>4
<211>29
<212>DNA
＜213〉artificial sequence
<400>4
acgttggatg?atgtactggt?ccctcattg???????????????????????????????????????29
<210>5
<211>29
<212>DNA
＜213〉artificial sequence
<400>5
acgttggatg?tcagtgttac?ttacctgtc???????????????????????????????????????29
<210>6
<211>29
<212>DNA
＜213〉artificial sequence
<400>6
acgttggatg?ctcaggactt?agcaagaag???????????????????????????????????????29
<210>7
<211>29
<212>DNA
＜213〉artificial sequence
<400>7
acgttggatg?tcaaactgat?gggacccac???????????????????????????????????????29
<210>8
<211>29
<212>DNA
＜213〉artificial sequence
<400>8
acgttggatg?cttcatgaag?acctcacag???????????????????????????????????????29
<210>9
<211>17
<212>DNA
＜213〉artificial sequence
<400>9
ttgtggtagt?tggagct????????????????????????????????????????????????????17
<210>10
<211>21
<212>DNA
＜213〉artificial sequence
<400>10
aacttgtggt?agttggagct?g???????????????????????????????????????????????21
<210>11
<211>19
<212>DNA
＜213〉artificial sequence
<400>11
aaggcactct?tgcctacgc??????????????????????????????????????????????????19
<210>12
<211>17
<212>DNA
＜213〉artificial sequence
<400>12
aggcactctt?gcctacg????????????????????????????????????????????????????17
<210>13
<211>17
<212>DNA
＜213〉artificial sequence
<400>13
ttctcgacac?agcaggt????????????????????????????????????????????????????17
<210>14
<211>17
<212>DNA
＜213〉artificial sequence
<400>14
tctcgacaca?gcaggtc????????????????????????????????????????????????????17
<210>15
<211>19
<212>DNA
＜213〉artificial sequence
<400>15
cattgcactg?tactcctct??????????????????????????????????????????????????19
<210>16
<211>24
<212>DNA
＜213〉artificial sequence
<400>16
gtccctcatt?gcactgtact?cctc????????????????????????????????????????????24
<210>17
<211>22
<212>DNA
＜213〉artificial sequence
<400>17
aattcctttt?attgaaacat?ca??????????????????????????????????????????????22
<210>18
<211>20
<212>DNA
＜213〉artificial sequence
<400>18
tacttacctg?tcttgtcttt?????????????????????????????????????????????????20
<210>19
<211>20
<212>DNA
＜213〉artificial sequence
<400>19
acccactcca?tcgagatttc?????????????????????????????????????????????????20
Claims (9)
1. the detection method of a nucleotide mutant site comprises the steps:
(1), determines the position of mutational site in sequence to be checked at the mutational site of nucleotide sequence to be checked;
(2) according to the position in mutational site and genotype design of amplification primers to at least one extend primer, wherein, the length of amplimer is 30bp at least, its 5 ' end respectively contains the tag of 10bp; The length of extending primer is 17-28bp, and its 3 ' terminal bases base adjacent with mutational site 3 ' end mated fully;
(3) use described amplimer to carrying out pcr amplification, obtain to contain the target sequence amplified production in described mutational site;
(4) handle by the SAP enzyme, remove the dNTPs that contains in the described amplified production;
(5) use described extension primer to carry out extension, connect a base at the 3 ' end that extends primer, and the base complementrity on this base and the mutational site, the employed raw material of extension are to be that purpose was carried out four kinds of ddNTP molecules that quality is modified to enlarge molecular weight difference;
(6) adopt resin purification extension product;
(7) with product behind the purifying and chip matrix cocrystallization, this crystal is put into mass spectrometric valve tube, excite with instantaneous nanosecond light laser then and carry out mass spectrometric detection, determine the genotype of sudden change;
The employed amplimer of wherein said step (2) is to being the combination with polynucleotide of sequence shown in SEQ ID NO:1 and the SEQ IDNO:2;
And the employed extension primer of wherein said step (5) comprises polynucleotide with SEQ ID NO:9 to SEQ ID NO:12 sequence shown in each one or more.
2. the method for claim 1, the employed amplimer of wherein said step (2) is to also comprising the one or more pairs of SEQ of having ID NO:3 and SEQ ID NO:4, the combination of the polynucleotide of sequence shown in SEQ ID NO:5 and the SEQ ID NO:6.
3. method as claimed in claim 2, employed extension primer also comprises the polynucleotide with sequence shown in SEQ ID NO:13 to the SEQ ID NO:18 in the wherein said step (5).
4. the method for claim 1, the employed amplimer of wherein said step (2) is to also comprising the combination with polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8.
5. method as claimed in claim 4, employed extension primer also comprises the polynucleotide with sequence shown in the SEQ ID NO:19 in the wherein said step (5).
6. the method for claim 1, wherein said nucleotide mutant site are one or more in the 600th bit codon of the 12nd, 13,61 and 146 codons of KRAS gene and BRAF gene.
7. polynucleotide have the nucleotide sequence of SEQ ID NO:1 to SEQ ID NO:19 shown in each.
8. the combination of primers of detection method that is used for the nucleotide mutant site of KRAS gene and/or BRAF gene, comprise being selected from and have SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, or one or more pairs of polynucleotide of sequence shown in SEQ ID NO:7 and the SEQ ID NO:8 are as amplimer, and be selected from have SEQ ID NO:9 to SEQ ID NO:19 sequence shown in each one or more polynucleotide as extending primer.
9. described polynucleotide of claim 7 or the described combination of primers of claim 8 are used to detect the purposes of the nucleotide mutant site of KRAS gene and/or BRAF gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910177851 CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102183444A CN101440407A (en) | 2008-12-12 | 2008-12-12 | Method for detecting nucleotide mutant site |
| CN200810218344.4 | 2008-12-12 | ||
| CN 200910177851 CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101838683A true CN101838683A (en) | 2010-09-22 |
| CN101838683B CN101838683B (en) | 2013-09-18 |
Family
ID=42742358
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910177851 Active CN101838683B (en) | 2008-12-12 | 2009-09-28 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101838683B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012049279A1 (en) * | 2010-10-14 | 2012-04-19 | Universitaet Des Saarlandes | MEANS AND METHODS APPLYING SINGLE NUCLEOTIDE PRIMER EXTENSION WITH ION PAIR-, REVERSED-PHASE HPLC (SIRPH) FOR THE DIAGNOSIS OF SNPs |
| CN102758012A (en) * | 2012-06-15 | 2012-10-31 | 向华 | Nucleic acid fingerprint feature atlas database of mycobacterium tuberculosis rpoB gene and use of nucleic acid fingerprint feature atlas database |
| CN102925555A (en) * | 2012-09-19 | 2013-02-13 | 长沙三济生物科技有限公司 | Sequencing primer pair for qualitatively detecting human BRAF V600E gene mutation and kit thereof |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN103184270A (en) * | 2011-12-28 | 2013-07-03 | 北京宏微特斯生物科技有限公司 | Method and kit for detecting drug resistance gene mutant type of tuberculous bacillus (TB) |
| CN103602740A (en) * | 2013-11-06 | 2014-02-26 | 毅新兴业（北京）科技有限公司 | Method and kit for identifying free DNAs in serum by adopting mass spectrometer and applications of method and kit |
| CN111378751A (en) * | 2018-12-29 | 2020-07-07 | 成都华青精准医疗科技有限公司 | Nucleotide sequence group for detecting KRAS gene mutation and application thereof |
| CN111500727A (en) * | 2020-04-30 | 2020-08-07 | 北京和合医学诊断技术股份有限公司 | Primer group for detecting KRAS gene and BRAF gene mutation and application method thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2015287550A1 (en) * | 2014-07-11 | 2017-01-12 | Expression Pathology, Inc. | SRM/MRM assay for the Serine/Threonine-Protein Kinase B-raf (BRAF) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BRPI0419002A (en) * | 2004-08-13 | 2007-12-11 | Indivumed Gmbh | method for detecting and differentiating between colorectal adenoma and / or colorectal carcinoma, method for monitoring the course of colorectal adenoma, use of transthyretin as a biomarker, testing system, arrangement comprising detection molecules |
-
2009
- 2009-09-28 CN CN 200910177851 patent/CN101838683B/en active Active
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012049279A1 (en) * | 2010-10-14 | 2012-04-19 | Universitaet Des Saarlandes | MEANS AND METHODS APPLYING SINGLE NUCLEOTIDE PRIMER EXTENSION WITH ION PAIR-, REVERSED-PHASE HPLC (SIRPH) FOR THE DIAGNOSIS OF SNPs |
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN103184270A (en) * | 2011-12-28 | 2013-07-03 | 北京宏微特斯生物科技有限公司 | Method and kit for detecting drug resistance gene mutant type of tuberculous bacillus (TB) |
| CN102758012A (en) * | 2012-06-15 | 2012-10-31 | 向华 | Nucleic acid fingerprint feature atlas database of mycobacterium tuberculosis rpoB gene and use of nucleic acid fingerprint feature atlas database |
| CN102758012B (en) * | 2012-06-15 | 2013-06-05 | 毅新兴业（北京）科技有限公司 | Nucleic acid fingerprint feature atlas database of mycobacterium tuberculosis rpoB gene and use of nucleic acid fingerprint feature atlas database |
| CN102925555A (en) * | 2012-09-19 | 2013-02-13 | 长沙三济生物科技有限公司 | Sequencing primer pair for qualitatively detecting human BRAF V600E gene mutation and kit thereof |
| CN103013993A (en) * | 2012-12-26 | 2013-04-03 | 武汉康圣达医学检验所有限公司 | Primer and method for mass spectrometric detection of hotspot mutation of PIK3CA genes by using primer |
| CN103013993B (en) * | 2012-12-26 | 2016-06-29 | 武汉康圣达医学检验所有限公司 | The method of primer and this primer Mass Spectrometer Method PIK3CA hotspot mutation |
| CN103602740A (en) * | 2013-11-06 | 2014-02-26 | 毅新兴业（北京）科技有限公司 | Method and kit for identifying free DNAs in serum by adopting mass spectrometer and applications of method and kit |
| CN111378751A (en) * | 2018-12-29 | 2020-07-07 | 成都华青精准医疗科技有限公司 | Nucleotide sequence group for detecting KRAS gene mutation and application thereof |
| CN111500727A (en) * | 2020-04-30 | 2020-08-07 | 北京和合医学诊断技术股份有限公司 | Primer group for detecting KRAS gene and BRAF gene mutation and application method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101838683B (en) | 2013-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
| EP3524688B1 (en) | Multiple detection method of methylated dna | |
| CN104293920B (en) | A kind of kit and using method thereof for fast detecting mankind VKORC1 and CYP2C9 gene pleiomorphism | |
| CN101760566B (en) | Detection method on mutant site of ribonucleotide of HBV gene | |
| CN111893216A (en) | Product for detecting DNA/RNA by nucleic acid mass spectrum and detection method | |
| CN101440407A (en) | Method for detecting nucleotide mutant site | |
| CN113174438B (en) | ALDH2 gene polymorphism detection kit and detection method | |
| CN111197076A (en) | Antihypertensive drug irbesartan medication guidance and gene detection kit | |
| CN107937493A (en) | A kind of hair clip Mdification primer for allele PCR | |
| CN111187815A (en) | Method for distinguishing individual administration of losartan by detecting product and performing mass spectrometry | |
| CN111172268A (en) | Method for distinguishing individual drug administration of verapamil by detecting product and performing mass spectrometry | |
| CN111235257A (en) | Method for distinguishing lacidipine personalized medicine by mass spectrometry through product detection | |
| CN111206083A (en) | Detection kit for medication guidance gene of telmisartan medicament for reducing hypertension | |
| CN111235258A (en) | Method for distinguishing lacidipine personalized medicine by using primer composition to perform mass spectrometry | |
| CN111172266A (en) | Kit for detecting drug-using guide gene of antihypertensive drug verapamil | |
| CN111197077A (en) | Kit for detecting medication guidance gene of nifedipine serving as antihypertensive drug | |
| CN111197080A (en) | Detection product for distinguishing nifedipine individualized medication type | |
| CN116790783B (en) | Universal polymorphic microsatellite molecular markers of two kinds of strong parasitic armillaria mellea, and primers and application thereof | |
| CN117025803A (en) | Method for detecting rifampicin resistance genotype of mycobacterium tuberculosis and detection product | |
| CN111009288A (en) | Probe design method of CEBPA gene and application thereof | |
| CN111154855A (en) | Method for conducting personalized amlodipine medication guidance by detecting products | |
| CN111154856A (en) | Method for conducting individual medication guidance of amlodipine through primer composition | |
| CN111154854A (en) | Primer composition for distinguishing individual dosage form of amlodipine | |
| CN111187817A (en) | Method for carrying out losartan personalized medication guidance by detecting product | |
| CN111187818A (en) | Detection product for distinguishing individual administration of losartan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1143610 Country of ref document: HK |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1143610 Country of ref document: HK |
|
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20100922 Assignee: Shenzhen Huada clinical inspection center Co., Ltd. Assignor: BGI-Shenzhen Co., Ltd. Contract record no.: 2014440020113 Denomination of invention: Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene Granted publication date: 20130918 License type: Exclusive License Record date: 20140414 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model | ||
| ASS | Succession or assignment of patent right |
Owner name: SHENZHEN BGI CORPORATION Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD. Effective date: 20150803 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20150803 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Patentee after: BGI SHENZHEN CO LTD Address before: 11, 8 floor, Beishan Industrial Zone, Yantian District, Guangdong, Shenzhen 518000, China Patentee before: BGI-Shenzhen Co., Ltd. |