WO2023221309A1

WO2023221309A1 - Dna methylation marker for evaluating onset risk of cerebral stroke, primer, and use thereof

Info

Publication number: WO2023221309A1
Application number: PCT/CN2022/111781
Authority: WO
Inventors: 彭浩; 陈立楠; 刘洋
Original assignee: 苏州大学
Priority date: 2022-05-19
Filing date: 2022-08-11
Publication date: 2023-11-23
Also published as: CN114807355A

Abstract

Provided is a DNA methylation marker for evaluating the onset risk of cerebral stroke, a primer, and use thereof. The DNA methylation marker comprises at least one of DNA methylation sites Chr4:47840038, Chr4:47839941, and Chr4:47839933 of the CORIN gene promoter region. Also provided is a kit for evaluating the onset risk of cerebral stroke based on the DNA methylation marker.

Description

A DNA methylation marker, primer and application for assessing the risk of stroke

Technical field

The present invention relates to the field of biomedicine technology, and in particular to a DNA methylation marker, primer and application for assessing the risk of stroke.

Background technique

Stroke is a sudden disorder of blood circulation in the brain tissue. It has become one of the leading diseases affecting human health worldwide. In 2019, the number of stroke patients worldwide reached 101 million, and about 6.55 million people died from it. Stroke has become the second leading cause of death in the world. There are great differences in the incidence and prevalence of stroke around the world. my country is an area with a high incidence of stroke. In 2019, the total number of people suffering from stroke in my country reached 28.76 million, and 2.19 million people died of stroke. This has brought great changes to our country’s medical system. Therefore, how to effectively prevent and treat stroke is a major challenge facing my country's public health field. It is urgent to discover more potential risk factors and treatment targets and promote their clinical transformation.

The main members of the Natriuretic Peptide system (NPs) include atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP), which play an important role in maintaining blood pressure through natriuresis, diuresis and vasodilation. Existing studies have shown that increased natriuretic peptide levels are related to the risk of stroke. Corin is a type II transmembrane serine protease highly expressed in cardiomyocytes. It is the main physiological activator of ANP and can also activate BNP. Therefore, Corin, as an upstream regulator of NPs, may be involved in the pathogenesis of stroke. Basic research and epidemiological studies suggest the cardiovascular effects of Corin. For example, overexpressing the protein Corin in mice with dilated cardiomyopathy improves cardiac function and delays the progression of heart failure. In contrast, CORIN knockout mice developed hypertension and cardiac hypertrophy. In humans, polymorphisms in the gene encoding Corin protein, CORIN, are associated with susceptibility to heart failure, cardiac hypertrophy, and hypertension. Some small cross-sectional clinical studies have found that soluble Corin is associated with cardiovascular diseases, such as atrial fibrillation, heart failure, and myocardial infarction. Previous studies from our laboratory found that lower serum Corin levels were significantly associated with the prevalence of stroke and poor stroke prognosis. The above studies suggest that Corin protein may be related to the pathogenesis of stroke, and Corin protein may become a therapeutic target or drug candidate for the prevention and treatment of stroke. However, no inhibitors of Corin protein have been found in human plasma, which reduces the safety of its clinical translation. Therefore, there is a need to better understand the molecular mechanisms underlying the association between Corin and stroke. Epigenetic factors serve as interfaces between the genome and the dynamic environment and may influence gene expression and function, thus having the potential to serve as the molecular mechanisms we need. As the most common and currently most intensively studied epigenetic modification, DNA methylation has been considered to be involved in the pathological process of disease by affecting the expression of related genes. For example, overall DNA methylation levels are associated with stroke, and methylation of the promoters of stroke-related genes, such as ABCG1, MMP2, ERα, thrombomodulin, and TP53, have been shown to be associated with stroke in some small case-control studies. related. However, there has been no research report on CORIN gene DNA methylation and stroke, nor has it been reported that a suitable methylation marker can be used as an intervention target to prevent and control stroke.

Contents of the invention

In order to solve the above technical problems, the present invention provides a DNA methylation marker related to stroke through research on the correlation between CORIN gene DNA methylation and stroke phenotype, which can be used to predict the risk of stroke and brain disease. It provides a basis for screening high-risk groups for stroke and is also expected to serve as an intervention target for the prevention and control of stroke.

The first object of the present invention is to provide a DNA methylation marker for assessing the risk of stroke. The DNA methylation marker includes the DNA methylation site Chr4 in the promoter region of the CORIN gene: At least one site among 47840038, Chr4:47839941 and Chr4:47839933.

Further, the DNA methylation markers include a combination of DNA methylation sites in the promoter region of the CORIN gene, and the combination of DNA methylation sites is any one of the following combinations (1)-(4):

(1) Chr4:47840038 and Chr4:47839941, (2) Chr4:47840038 and Chr4:47839933, (3) Chr4:47839941 and Chr4:47839933, (4) Chr4:47840038, Chr4:47839941 and Chr4:47 839933.

Further, the upstream primer for amplifying DNA methylation markers is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2.

The second object of the present invention is to provide the application of the above-mentioned DNA methylation markers in preparing a kit for assessing the risk of stroke.

Furthermore, the kit for assessing the risk of stroke includes a primer pair that amplifies at least one of the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the CORIN gene promoter region. Preferably, a primer pair that simultaneously amplifies the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 is included.

Further, in the primer pair, the upstream primer is as shown in SEQ ID NO.1, and the downstream primer is as shown in SEQ ID NO.2. This primer pair can simultaneously amplify the Chr4:47840038, Chr4:47839941 and Chr4:47839933 sites. When used, the methylation level of each site is separately detected to determine the risk of stroke.

Further, the application includes the following steps:

(5) Extract DNA samples and perform sulfite treatment on the DNA samples;

(6) Use the above primer pair to amplify the sample treated with sulfite in step (1) to obtain an amplification product;

(7) Carry out transcription and enzyme digestion on the amplification product of step (2) to obtain the transcription and enzyme digestion products;

(8) Detect the transcription and enzyme digestion products of step (3) to obtain the methylation degree of Chr4:47840038, Chr4:47839941 and Chr4:47839933 sites in the sample sequence.

Furthermore, DNA samples are derived from blood, making sampling easy.

The third object of the present invention is to provide the application of a primer pair for amplifying the above-mentioned DNA methylation marker in preparing a kit for assessing the risk of stroke. The upstream primer is as shown in SEQ ID NO.1, and the downstream primer is as shown in SEQ As shown in ID NO.2, specifically,

F: GGGTGGGATTTGTAGAGTAGATAA

R: ACTTAAAAACCCRACTCTACRACAA, where R represents base A/G.

The fourth object of the present invention is to provide a kit for assessing the risk of stroke, which kit includes: amplifying the DNA methylation sites Chr4:47840038 and Chr4:47839941 in the promoter region of the CORIN gene, respectively or simultaneously. and Chr4:47839933, and reagents for detecting the methylation level of at least one site in Chr4:47840038, Chr4:47839941 and Chr4:47839933.

Further, the upstream primer is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2.

The fifth object of the present invention is to provide the application of the above-mentioned DNA methylation markers in the preparation of stroke therapeutic drugs. The therapeutic drugs target the DNA methylation sites Chr4:47840038, Chr4:47839941 and By designing at least one site in Chr4:47839933, DNA methylation is changeable. Targeted drugs designed based on the above DNA methylation sites can regulate the expression of the CORIN gene and the secretion of Corin, thereby achieving the goal of treating brain disease. purpose of stroke.

Through the above solutions, the present invention at least has the following advantages:

The CORIN gene DNA methylation markers provided by the present invention can be used to predict the risk of stroke, provide a basis for the screening of high-risk groups for stroke, and can also be used as intervention targets for the prevention and control of stroke, which not only helps to explain The molecular mechanism by which Corin upregulates stroke will also provide important epidemiological evidence for CORIN gene methylation as a drug target for the prevention and control of stroke.

The above description is only an overview of the technical solutions of the present invention. In order to have a clearer understanding of the technical means of the present invention and implement them according to the content of the description, the preferred embodiments of the present invention are described below with detailed drawings.

Description of the drawings

In order to make the content of the present invention easier to understand clearly, the present invention will be described in further detail below based on specific embodiments of the present invention and in conjunction with the accompanying drawings.

Figure 1 shows the target sequence and primers for targeted sulfite sequencing, as well as the predicted 9 CpG sites;

Figure 2 shows the detection results of DNA methylation levels of 9 CpG sites in stroke patients and healthy controls;

Figure 3 shows the receiver operating characteristic curve corresponding to the CpG3 site;

Figure 4 shows the receiver operating characteristic curve corresponding to the CpG8 site;

Figure 5 shows the receiver operating characteristic curve corresponding to the CpG9 site;

Figure 6 shows the receiver operating characteristic curve corresponding to the CpG3+CpG8 model;

Figure 7 shows the receiver operating characteristic curve corresponding to the CpG3+CpG9 model;

Figure 8 shows the receiver operating characteristic curve corresponding to the CpG8+CpG9 model;

Figure 9 shows the receiver operating characteristic curve corresponding to the CpG3+CpG8+CpG9 model.

Detailed ways

The present invention will be further described below in conjunction with the accompanying drawings and specific examples, so that those skilled in the art can better understand and implement the present invention, but the examples are not intended to limit the present invention.

Example 1

A total of 1,771 research subjects were included in this experiment, including 853 stroke patients and 918 healthy controls. Whole blood DNA samples of each research subject were extracted, and target region sequencing technology was used to detect the methylation level of each CpG site in the promoter region of the CORIN gene. That is, the ENSEMBL database was used to query the promoter region of the human CORIN gene (gene number: ENSG00000145244). , the region is Chr4:47840136-47839906 (GRCh37.p13, distance from TSS: -13bp to 217bp), intercept the nucleic acid sequence of this region on NCBI, import the nucleic acid sequence into EMBOSS Cpgplot software to predict CpG islands, and then use the Epidesigner program to map CpG Design primers based on the sequences of islands and CpG dense regions, and select appropriate primers for DNA methylation detection (see Table 1 for primer sequence information). After selection, CORIN methylation obtained a total of methylation levels of 9 CpG sites. The 9 CpG sites are shown in Figure 1.

Table 1 Primer sequences for DNA methylation detection in CORIN gene promoter region

The specific detection methods for DNA methylation are:

First, the DNA sample was treated with bisulfite using the EZ-96 DNA Methylation Kit (Zymo Research, Inc., CA, United States) to convert all the unmethylated cytosine C in the sample DNA into uracil. U. Then use the primers in Table 1 and use the bisulfite-treated sample genome as a template to perform multiplex PCR amplification. In order to distinguish different samples, primers with Index sequences are used to introduce specific tag sequences compatible with the Illumina platform to the end of the library through PCR amplification. Finally, the Index PCR amplification products of all samples were mixed in equal amounts, and high-throughput sequencing was performed on the Illumina Hiseq/Miseq platform in the paired-end sequencing mode of 2×150bp/2×250bp to obtain FastQ data. The methylation level of each CpG site was quantified as the number of methylated reads at the site (i.e., the number of reads with base C detected)/the total number of reads at the site × 100%.

The research results are as follows:

1. Clinical characteristics of the research subjects

This example included 853 ischemic stroke patients (average age 62 years old, 53% males) and 918 age and gender-matched healthy controls (average age 61 years, 55% males). It was found that ischemic stroke patients in the study had more metabolic risk factors such as hypertension, diabetes, lipids, and obesity than healthy controls (all P<0.05).

Table 2 Clinical characteristics of study subjects

2. The relationship between methylation of CORIN gene promoter region and ischemic stroke

The DNA methylation levels of the above 9 CpG sites were detected, and it was found that the DNA methylation levels of the 9 CpG sites tested were lower in stroke patients than in healthy controls (see Figure 2, ns: P>0.05 ;*:P<0.05; **:P<0.01; ***:P<0.001).

After adjusting for age, gender, education level, smoking, alcohol consumption, body mass index, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, diabetes and hypertension (see Table 3), all 9 methylation sites were associated with deficiencies. Hemorrhagic stroke was significantly associated (P<0.05), and these associations remained after multiple correction (q<0.05).

In order to test whether the methylation levels of 9 sites can improve the predictive ability of traditional risk factors for ischemic stroke, the receiver operating characteristic curve (receiver operating characteristic curve ROC) was drawn and the area under the curve (Area Under Curve AUC), it was found that all 9 sites can improve the prediction ability of traditional risk factors for ischemic stroke. Figures 3 to 5 show that the methylation levels of 3 sites improve the prediction ability of traditional risk factors for ischemia. Predictive ability of stroke: Chr4:47840038 (0.8578vs 0.8515, P=0.0076); Chr4:47839941 (0.8598vs 0.8515, P=0.0019); Chr4:47839933 (0.8568vs 0.8515, P=0.01 44). Figures 6 to 9 show the ROC curves of the combined model of multiple methylation sites. It is found that the combined model can also improve the prediction ability of traditional risk factors for ischemic stroke.

At the same time, the calculation results of the net reclassification improvement (NRI) and the integrated discrimination index (IDI) also show that the methylation levels of the three CpG sites can improve the impact of traditional risk factors on ischemic disease. Predictive ability of stroke (Table 4).

Table 3 Relationship between methylation level of CORIN gene promoter region and ischemic stroke

Table 4 Net reclassification index and comprehensive discrimination improvement index of each CpG site

Example 2

Based on the above research results, we found that methylation in the CORIN gene promoter region may be a predictor of stroke risk. In order to verify this conclusion, we conducted a prospective cohort study. The inventors enrolled 2,498 research subjects who did not have stroke at baseline in 2010, followed up on stroke events every 2 years, and ended the follow-up in 2020. The method for detecting the methylation level of the CORIN gene promoter region is as described in Example 1.

1. Clinical characteristics of the research subjects

A total of 2,498 research subjects who did not suffer from stroke at baseline (average age 53 years, 39% male) were included in the study, and 88 of them developed stroke during the follow-up period. Compared with the research subjects who did not suffer from stroke during the follow-up period, Stroke research subjects have more metabolic risk factors, such as hypertension, diabetes, and lipids (see Table 5).

Table 5 Clinical characteristics of study subjects

2. The relationship between methylation of CORIN gene promoter region and stroke

During the 10-year follow-up of the Gusu cohort, 88 people suffered from stroke, 71 died of non-stroke causes, and 214 were lost to follow-up (follow-up rate 91.43%). After adjusting for the above traditional risk factors, we found that the methylation level of three of the nine CpG sites was associated with a lower risk of stroke. They were CpG3 (located at Chr4:47840038, HR=0.74, P=0.015 ), CpG8 (located at Chr4:47839941, HR=0.80, P=0.047), CpG9 (Chr4:47839933, HR=0.82, P=0.050)) (see Table 6).

In order to test whether the methylation levels of Chr4:47840038, Chr4:47839941, and Chr4:47839933 can improve the prediction ability of traditional risk factors for stroke, the NRI and IDI were calculated. The calculation results showed that the methylation levels of Chr4:47840038 and Chr4:47839933 The level of risk factors can improve the prediction ability of traditional risk factors for ischemic stroke (Table 7).

Table 6 The relationship between the methylation level of CORIN gene promoter region and the incidence of stroke

Table 7 Net reclassification index and comprehensive discrimination improvement index of each CpG site

Example 3 Construction of methylation detection kit

Based on the above studies, it can be known that: as shown in Figure 1, after the CpG3, CpG8, and CpG9 sites located in the promoter region are methylated, it may inhibit CORIN gene expression and Corin protein secretion, and then participate in the pathogenesis of stroke. As a predictive marker and potential drug target for stroke risk. Therefore, the present invention constructs a methylation detection kit based on CpG3, CpG8 and CpG9 sites.

The specific detection methods are:

① Whole blood DNA extraction and quality inspection

a. Agarose gel electrophoresis detects the integrity of genomic DNA: the electrophoresis band is clearly visible, with no obvious degradation and no RNA contamination.

b. Nanodrop 2000 detects the quality of genomic DNA: concentration ≥20ng/μL, total amount ≥1μg, OD260/280=1.7~2.0, OD260/230≥1.8.

②Sulfite treatment

The EZ-96 DNA methylation kit (Zymo Research, Orange, CA) was used to perform sulfite treatment on the DNA samples that passed the quality inspection, and all the unmethylated cytosine C in the sample DNA was converted into uracil U.

③Multiple PCR amplification

Then, the designed primers (F: GGGTGGGATTTGTAGAGTAGATAA; R: ACTTAAAAACCCRACTCTACRACAA) were used to amplify the DNA of the sulfite-treated specimen, and an amplification product containing the T7 RNA polymerase promoter sequence was obtained.

④CpG fragment cleavage

The amplified DNA product is then transcribed into an RNA fragment using T7 RNA polymerase, and the resulting RNA fragment is cut into small fragments containing CpG using RNase A.

⑤Flight mass spectrometry analysis

Finally, within each small RNA fragment, the final product of unmethylated CpG is CpA, and the final product of methylated CpG is CpG. The molecular weight of this final product is detected using the Agena MassArray flight mass spectrometry analysis system.

⑥Calculation of methylation levels and prediction of stroke risk

The methylation level of the CpG site is quantified as product quality CpG/(CpG+CpA)×100%, and the methylation level of each site is brought into the prediction model: Logit(p)=-9.421495+0.041777*Age+-0.507642 *Gender+2.063699*Education level+0.063120*Smoking+0.036780*Drinking+0.238716*Body mass index+-0.327117*LDL+0.327616*HDL+1.935708*Diabetes+1.594185*Hypertension+-0.028011*CpG3 methylation level+-0.0719 86 Calculate the predicted value p from *CpG8 methylation level + 0.045531 * CpG9 methylation level. When the predicted incidence rate p ≥ 0.5131, it indicates a higher risk of stroke, and you should pay close attention and take preventive treatment measures.

Table 8 Comparison of various site methylation combination models for the diagnosis of stroke

The specific information of each model is as follows:

Table 9 Specific information of the model

Obviously, the above-mentioned embodiments are only examples for clear explanation and are not intended to limit the implementation. For those of ordinary skill in the art, other changes or modifications may be made based on the above description. An exhaustive list of all implementations is neither necessary nor possible. The obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

A DNA methylation marker for assessing the risk of stroke, characterized in that: the DNA methylation marker includes at least one of the following DNA methylation sites in the CORIN gene promoter region: Chr4: 47840038, Chr4:47839941, Chr4:47839933.
The DNA methylation marker according to claim 1, characterized in that: the DNA methylation marker includes a combination of DNA methylation sites in the CORIN gene promoter region; the DNA methylation site The combination is any one of the following combinations (1)-(4):

(1)Chr4:47840038 and Chr4:47839941,

(2)Chr4:47840038 and Chr4:47839933,

(3)Chr4:47839941 and Chr4:47839933,

(4) Chr4:47840038, Chr4:47839941 and Chr4:47839933.
The DNA methylation marker according to claim 1, characterized in that: the upstream primer for amplifying the DNA methylation marker is as shown in SEQ ID NO.1, and the downstream primer is as shown in SEQ ID NO.2 .
Application of the DNA methylation marker according to any one of claims 1 to 3 in the preparation of a kit for assessing the risk of stroke.
The application according to claim 4, characterized in that: the kit for assessing stroke risk includes DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 that amplify the promoter region of the CORIN gene. Primer pairs for at least one site in .
The application according to claim 5, characterized in that: the upstream primer is as shown in SEQ ID NO.1, and the downstream primer is as shown in SEQ ID NO.2.
The application according to claim 4, characterized in that the application includes the following steps:

(1) Extract DNA samples and perform sulfite treatment on the DNA samples;

(2) Use the primer pair to amplify the sample treated with sulfite in step (1) to obtain an amplification product;

(3) Transcribe and digest the amplified product of step (2) to obtain the transcription and enzyme digestion products;

(4) Detect the transcription and enzyme digestion products of step (3) to obtain the methylation level of Chr4:47840038, Chr4:47839941 or Chr4:47839933.
The application of a primer pair for amplifying the DNA methylation marker described in any one of claims 1-3 in the preparation of a kit for assessing the risk of stroke, characterized in that: the upstream primer is as shown in SEQ ID NO.1 , the downstream primer is shown in SEQ ID NO.2.
A kit for assessing the risk of stroke, characterized in that: the kit for assessing the risk of stroke includes: amplifying the DNA methylation sites Chr4:47840038 and Chr4 in the promoter region of the CORIN gene, respectively or simultaneously :47839941 and Chr4:47839933 primers, and reagents for detecting the methylation level of at least one site in Chr4:47840038, Chr4:47839941 and Chr4:47839933.
The kit according to claim 9, characterized in that: the upstream primer is as shown in SEQ ID NO.1, and the downstream primer is as shown in SEQ ID NO.2.