CN111286534A

CN111286534A - CORIN gene DNA methylation marker and application thereof

Info

Publication number: CN111286534A
Application number: CN201910722403.XA
Authority: CN
Inventors: 彭浩
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2019-08-06
Filing date: 2019-08-06
Publication date: 2020-06-16
Anticipated expiration: 2039-08-06
Also published as: CN111286534B

Abstract

The invention discloses a group of CORIN gene DNA methylation markers and application thereof in preparation of a kit for predicting stroke morbidity risk. The CORIN gene DNA methylation marker comprises 2 DNA methylation sites corresponding to a CORIN gene promoter region: chr4:47841408 and Chr4: 47841314. The kit comprises an upstream primer and a downstream primer which can simultaneously amplify 2 DNA methylation sites. The CORIN gene DNA methylation marker can provide important epidemiological evidence for the target of drugs for preventing and controlling cerebral apoplexy.

Description

CORIN gene DNA methylation marker and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a group of CORIN gene DNA methylation markers and application thereof in preparation of a kit for predicting stroke morbidity risk.

Background

The world health organization of 'stroke' (stroke) and 'cerebrovascular accident' (CVA) in 1984 and 2003 has investigated the epidemic situation of cardiovascular and cerebrovascular diseases such as stroke and coronary heart disease in 40 research center organizations in 28 countries all over the world according to the 'multi-country cardiovascular disease trend and determinant monitoring scheme' (WHO MONICA scheme for short). Stroke is defined by the WHO monaca protocol as: the sudden development of focal or whole brain dysfunction, including subarachnoid hemorrhage, cerebral thrombosis, cerebral embolism, not including transient cerebral blood supply insufficiency, stroke onset in 28 days of 1 or more times of 1 onset of disease, recurrence after 28 days of 1 new onset of disease.

The stroke is taken as a global health problem, is a primary disease threatening the life health of residents in China, and brings huge disease burden and economic loss to the residents in China every year. The result of the 'Chinese apoplexy epidemic report' issued for the first time by the Chinese apoplexy Association in 2015 shows that about 270 million new patients with cerebrovascular diseases in China every year, about 130 million patients dying from cerebrovascular diseases every year, one person has cerebral apoplexy every 12 seconds, and one person has cerebral apoplexy every 21 seconds. Therefore, how to effectively prevent and control stroke is a major public health challenge facing China at present, and searching and finding more potential risk factors and intervention targets of stroke is urgent.

The natriuretic peptide axis is an important heart endocrine regulation system for the body to respond to external environmental stimulation, and plays an important role in maintaining the water-sodium balance, blood pressure stability and energy metabolism balance of the body. The natriuretic peptide axis is mainly composed of Atrial Natriuretic Peptide (ANP), Brain Natriuretic Peptide (BNP), C-type natriuretic peptide (CNP), and their receptors. When blood volume is increased, a large amount of bioactive atrial natriuretic peptide (pro-ANP) precursors are secreted and released by cardiac muscle cells, and the pro-ANP is further activated into active ANP and is combined with a receptor thereof to activate a natriuretic peptide axis, so that water and sodium metabolism is promoted, blood volume is reduced, blood vessels are expanded, energy metabolism is promoted, and cardiovascular homeostasis is maintained. There is a great deal of epidemiological evidence that the natriuretic peptide axes, in particular ANP and BNP, play an important role in the development of stroke and its risk factors (obesity, hyperglycemia, hypertension, atherosclerosis, thrombosis, etc.).

The proteases that convert inactive pro-ANP and pro-BNP into active ANP and BNP are the key to the regulation of the natriuretic peptide axis function. After decades of efforts, scientists have finally discovered the convertase, corin, of pro-ANP in 1999. To date, several studies have reported the effects of corin on cardiovascular metabolism. Both basic research and population research results suggest that corin may be a potential intervention target for preventing and controlling stroke. As a medium for connecting genes and the environment, DNA methylation regulates the expression and the function of the genes and can be used as a potential and interventional medicine target, and a great deal of evidence shows that the DNA methylation of a gene promoter region can influence the transcription of the genes and inhibit the expression of the genes. Therefore, the CORIN gene promoter region DNA methylation as the coding gene of CORIN may inhibit CORIN expression, cause CORIN deficiency and thus participate in the pathogenesis of cerebral apoplexy.

Disclosure of Invention

The invention aims to provide a group of CORIN gene DNA methylation markers for predicting stroke onset risk and application thereof in predicting stroke onset risk.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application of a group of CORIN gene DNA methylation markers in preparing a kit for predicting stroke onset risk includes that the CORIN gene DNA methylation markers comprise 2 DNA methylation sites of a CORIN gene promoter region: chr4:47841408 and Chr4: 47841314.

Further, the kit comprises an upstream primer and a downstream primer for simultaneously amplifying 2 DNA methylation sites.

Further, the sequence of the upstream primer is shown as SEQ ID No. 1.

Further, the sequence of the downstream primer is shown as SEQ ID No. 2.

Further, the 2 DNA methylation sites increased the methylation level by more than 80% in stroke cases.

Has the advantages that: the CORIN gene DNA methylation marker provided by the invention can be used for predicting the stroke risk, provides a basis for further deep examination by a clinician, and achieves the effect of rapidly and accurately mastering the disease state and the disease severity of a patient. Meanwhile, support is provided for the next step of timely adopting a more personalized prevention and treatment scheme, and the disease progress is delayed and prevented. The invention not only helps to explain the molecular mechanism of CORIN lack acting on stroke, but also provides important epidemiological evidence for CORIN gene methylation serving as a drug target for preventing and controlling stroke.

Drawings

FIG. 1 is a schematic diagram showing methylation at two CpG sites in the promoter region of CORIN gene in example 1.

Detailed Description

The technical solution of the present invention is further explained below.

Example 1

According to a previous case control study (597 cases of stroke and 2498 community healthy controls), it was found that the level of corin protein in the serum of stroke patients is significantly lower than that of healthy controls (Stroke. 2015; 46:1758-1763), and the risk of stroke in the lowest quartile level group is increased by 2-5 times compared with that in the highest quartile level group. The research result suggests that corin protein deficiency may be the cause of stroke, however, the molecular mechanism of corin deficiency and stroke is not clear, but the research on the molecular mechanism of corin participating in the stroke pathogenesis process can help to find the drug target aiming at corin deficiency, thereby promoting the prevention and control of stroke. As a vector for connecting genes and the environment, DNA methylation regulates the expression and the function of the genes and can be used as a potential and interventional drug target. Therefore, the invention further researches the role of DNA methylation of CORIN gene in the attack of cerebral apoplexy.

853 patients with cerebral apoplexy and 918 healthy controls are selected as research objects by using frequency matching, a whole blood DNA sample of each research object is extracted, the methylation level of each CpG site in the CORIN gene promoter region is detected by using a target region sequencing technology, namely, an ENSEMBL database is used for inquiring the promoter region of a human CORIN gene (gene number: ENSG00000145244), the region is Chr4:47838400-47841966(GRCh37/hg19, distance from TSS-2000- +1566bp), the nucleic acid sequence of the region is intercepted on NCBI, the nucleic acid sequence is introduced into EMBOSS Cpgplot software for predicting CpG islands, then an Epidesegner program is used for carrying out primer design on the CpG islands and the CpG dense region sequences, and proper primers are selected for carrying out DNA methylation detection. By selection, the invention carries out methylation detection on 2 fragments of CORIN gene promoter region, and obtains the methylation level of 11 CpG sites.

Table 1 lists the fragments to be detected and the primer sequences:

TABLE 1 CORIN Gene promoter region DNA methylation assay fragments

The specific detection method comprises the following steps:

first, DNA samples were bisulfite-treated with EZ-96DNA methylation kit (Zymo Research, Orange, Calif.) to convert all cytosine C that was not methylated in the sample DNA into thymine U. Then, multiplex PCR amplification was performed using the designed primers and the bisulfite-treated sample genome as a template. Specific tag sequences compatible with the illumina platform were then introduced to the ends of the library by PCR amplification using primers with Index sequences. Finally, all sample Index PCR amplification products are equally mixed, and high-throughput sequencing is carried out on an Illumina Hiseq/Miseq platform in a double-end sequencing mode of 2 × 150bp/2 × 250bp, so as to obtain FastQ data. The methylation level at each CpG site is quantified as the number of reads methylated at that site (i.e., the number of reads in which base C is detected)/total number of reads for that site x 100%.

The results of the study are as follows:

1. clinical characteristics of the study subject

As shown in table 2, stroke patients were older and had more of the traditional risk factors for stroke, such as hypertension, diabetes, obesity, and hyperlipidemia, than healthy controls.

TABLE 2 clinical characteristics of the subjects

2. Methylation sites most strongly associated with stroke

The invention totally detects the methylation level of 11 CpG sites, and after adjusting the traditional risk factors of stroke such as age, sex, education degree, smoking, drinking, obesity, blood pressure, blood sugar, blood fat and the like, 2 of the CpG sites are still obviously associated with the stroke and are positioned in the promoter region of CORIN gene. As shown in table 3, the methylation levels at these two sites increased by 12% and 24% for every 5% of the increase in the risk of stroke, respectively. Higher methylation levels mean lower corin expression, i.e. lower serum corin protein levels, and it can be seen that the results of this study are consistent with the previously found lack of serum corin levels associated with an increased risk of stroke onset. Accordingly, these two methylation sites can be used to predict the risk of stroke onset.

TABLE 3 methylation sites strongly associated with stroke

^*Every 5% increase in methylation levels increases the risk of stroke by a factor of two.

3. Construction of methylation assay kit

Based on the above studies, it can be known that: as shown in figure 1, after two CpG sites located in a promoter region are methylated, CORIN gene expression and CORIN protein secretion can be inhibited, and the gene can be involved in the onset of stroke, and can be used as a prediction marker and a potential drug target for the onset risk of stroke. Therefore, the invention constructs a methylation detection kit based on the two CpG sites.

The specific detection method comprises the following steps:

① Whole blood DNA extraction and quality control

a. Agarose gel electrophoresis for genomic DNA integrity: the electrophoresis strip is clearly visible, has no obvious degradation and has no RNA pollution.

Nanodrop 2000 detection of genomic DNA quality: the concentration is more than or equal to 20 ng/mu L, the total amount is more than or equal to 1 mu g, OD260/280 is 1.7-2.0, and OD260/230 is more than or equal to 1.8.

② sulfite treatment

The qualified DNA samples were sulfite-treated with EZ-96DNA methylation kit (Zymo Research, Orange, Calif.) to convert all unmethylated cytosine C in the sample DNA to uracil U.

③ multiplex PCR amplification

Then, the sulfite-treated specimen was subjected to DNA amplification using the designed primer (F: GTAGATTTAGGGAGTTGAAGTGAAGTAA; R: ACCTTAACAATTAAATCCAACCCTTAT) to obtain an amplification product having a T7 RNA polymerase promoter sequence.

④ CpG fragment cleavage

The amplified DNA product is then transcribed into RNA fragments using T7 RNA polymerase, and the resulting RNA fragments are cleaved into CpG-bearing small fragments using RNaseA.

⑤ flight mass spectrometry

Finally, within each small RNA fragment, the unmethylated CpG end-product was CpA and the methylated CpG end-product was CpG, and the molecular weights of these two end-products were determined using the Agena MassArray flight mass spectrometry system.

⑥ calculation of methylation level and prediction of stroke risk

The methylation level at each CpG site was quantified as the product mass CpG/(CpG + CpA). times.100%. The methylation level of any CpG locus is more than 80 percent, which indicates that the stroke is high in risk, and the attention should be paid closely and preventive treatment measures should be taken.

Claims

1. The application of a group of CORIN gene DNA methylation markers in preparing a kit for predicting stroke onset risk is characterized in that: the CORIN gene DNA methylation marker comprises 2 DNA methylation sites corresponding to a CORIN gene promoter region: chr4:47841408 and Chr4: 47841314.

2. Use according to claim 1, characterized in that: the kit comprises an upstream primer and a downstream primer which can simultaneously amplify 2 DNA methylation sites.

3. Use according to claim 2, characterized in that: the sequence of the upstream primer is shown as SEQ ID No. 1.

4. Use according to claim 3, characterized in that: the sequence of the downstream primer is shown as SEQ ID No. 2.

5. Use according to claim 1, characterized in that: the methylation level of the 2 DNA methylation sites is obviously increased by more than 80% in stroke cases.