CN107164510A - A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy - Google Patents
A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy Download PDFInfo
- Publication number
- CN107164510A CN107164510A CN201710473312.8A CN201710473312A CN107164510A CN 107164510 A CN107164510 A CN 107164510A CN 201710473312 A CN201710473312 A CN 201710473312A CN 107164510 A CN107164510 A CN 107164510A
- Authority
- CN
- China
- Prior art keywords
- methylation
- cerebral apoplexy
- dna
- detection kit
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection kit and detection method of auxiliary diagnosis cerebral apoplexy, described detection kit includes a pair of dihydrofolate reductase gene promoter zone methylation specificity amplification primers, and a pair of described dihydrofolate reductase gene promoter zone methylation specificity amplification primers include methylation-specific sense primer and methylation-specific anti-sense primer；It is by detecting the dihydrofolate reductase gene promoter zone methylation degree auxiliary diagnosis cerebral apoplexy related to cerebral apoplexy, simply, conveniently, detection efficiency is high, with strong points, have the advantages that accurately and reliably, flexibly quick and economy, be conducive to the early detection and treatment in time of cerebral apoplexy.
Description
Technical field
The present invention relates to the aided diagnosis technique field of cerebral apoplexy, the detection of more particularly to a kind of auxiliary diagnosis cerebral apoplexy is tried
Agent box and its detection method, it is especially a kind of to be used to detect the dihydrofolate reductase gene promoter region related to cerebral apoplexy
The detection kit and its detection method of methylation.
Background technology
Cerebral apoplexy (cerebral stroke) is a kind of acute cerebrovascular diseases, be due to cerebral vessels suddenly rupture or
Cause one group of disease of brain tissue impairment, including ischemic and hemorrhagic soldier because angiemphraxis causes blood to cannot flow into brain
In.The characteristics of cerebral apoplexy has the high incidence of disease, the high death rate and high disability rate, clinical manifestation is severe headache, faints, loses meaning
Know etc., this also becomes the disabled first cause of Chinese adult.Patients with cerebral apoplexy needs long-term taking depressor, periodically carries out
Routine inspection, controls intracranial pressure, it is seen that patients with cerebral apoplexy brings great financial burden to society and family.Cerebral apoplexy is one
Kind of Complex Diseases as caused by h and E factor collective effect, exploration to stroke onset mechanism and then are searched out suitable
Closing diagnoses and treatment medicine already becomes the focus studied now.And not yet clearly illustrated in the pathogenesis of cerebral apoplexy
In the case of, the prevention and early detection to cerebral apoplexy are even more very urgent.
Dihyrofolate reductase (dihydrofolate reductase,DHFR) it is a kind of protein coding gene, its energy
Enough catalysis dihydrofoilic acid are converted into tetrahydrofolic acid.The shortage of the albumen can cause homocysteine level to raise, and then improve
The risk of cerebral apoplexy.Dihyrofolate reductase is by the dihydrofolate reductase gene positioned at No. 5 chromosome
(dihydrofolate reductase gene,DHFR)(Chr5:79950220-79950350) encode.Now
Research both domestic and external have determined homocysteine level and cerebral apoplexy have it is larger associate, but to homotype partly
The influence factor of cystine level and the research of its regulatory mechanism are less.
At present, do not disclose also both at home and abroad any on for detecting the dihydrofolate reductase gene related to cerebral apoplexy
The detection kit correlative study report of promoter zone methylation degree.
The content of the invention
The technical problem to be solved by the invention for the present situation of prior art is to provide easy to detect, with strong points, inspection
Survey a kind of detection kit of the high auxiliary diagnosis cerebral apoplexy of accuracy rate；Examined by determining auxiliary to sample DNA methylation level
Disconnected cerebral apoplexy, detection method is simple, detection efficiency is high.
The present invention solve the technical scheme that is used of above-mentioned technical problem for：
A kind of detection kit of auxiliary diagnosis cerebral apoplexy, described detection kit includes a pair of dihydrofolate reductase genes
Promoter zone methylation specificity amplification primer, described a pair of dihydrofolate reductase gene promoter zone methylations specificity
Amplimer includes methylation-specific sense primer and methylation-specific anti-sense primer：
Described methylation-specific sense primer includes following nucleotide sequence：
5’- TATTTGAGCGGTGGTTAG -3’；
Described methylation-specific anti-sense primer includes following nucleotide sequence：
5’- TCTACTATAACGAACGAACTC -3’。
A kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy：It is characterized in that：Comprise the following steps：
Step 1: extracting the Whole Blood Genomic DNA of sample, and detect gained DNA concentration；
Step 2: carrying out bisulfite conversion to sample DNA using methylating reagent box；
Step 3: the real-time specific PCR early-stage preparations of fluorescent quantitation：Under the conditions of primer content is 10uM, it is separately added into
Primer TE or dd H2O are diluted；
Step 4: carrying out the real-time specific PCR of fluorescent quantitation：DNA sample 20ng transformed in step 2 is taken to be added to Zymo
TaqTM PreMix enzymes, and a pair of dihyrofolate reductase promoter zone methylation specificity amplification primers are added, enter performing PCR expansion
Increase；
Step 5: carrying out methylation analysis to result.
For optimization above-mentioned technical proposal, the concrete measure taken also includes：
Whole Blood Genomic DNA is extracted using the Full automatic instrument for extracting nucleic acid of Lab-Aid 820 in above-mentioned step one, then passed through
NanoDrop2000 ultramicrospectrophotometers detect DNA concentration.
Bisulfite is carried out to sample DNA using EZ DNA Methylation-Gold kits in above-mentioned step two
Salt is converted.
PCR amplification conditions are in above-mentioned step four：95 DEG C first 10min pre-degeneration；Then 95 DEG C of 20s, Tm
20s, 72 DEG C of 30s, totally 45 circulations annealing reaction；Then 40 DEG C of 10min of extension.
The present invention a kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy, described detection kit are included
A pair of dihydrofolate reductase gene promoter zone methylation specificity amplification primers, a pair of described dihyrofolate reductase bases
Because promoter zone methylation specificity amplification primer includes methylation-specific sense primer and methylation-specific anti-sense primer；
By detecting the dihydrofolate reductase gene promoter zone methylation degree auxiliary diagnosis cerebral apoplexy related to cerebral apoplexy, letter
Single, conveniently, detection efficiency is high, with strong points, have the advantages that accurately and reliably, flexible quick and economy, be conducive to brain soldier
In early detection and in time treatment.
It has advantages below：
1）Efficiently, accurately
This product uses quantitative fluorescent PCR technology, with real-time monitoring, high specificity, the advantage of accurate quantification, it is ensured that diagnosis
As a result accuracy.
2）It is convenient, fast
This product is the kit checked based on body fluid such as blood plasma, saliva, urines, and patient's body fluid censorship is extracted whenever and wherever possible, and
And diagnostic result can be obtained within a short period of time.
3）Comfortably, safety
This product uses Noninvasive testing, takes leave of the pain of invasive.Meanwhile, in detection process, human body is not present and appointed
What recessive or dominant danger.
4) economic, saving
This product only needs relatively low economic cost compared to existing diagnostic mode, it is easy to is big well-established, and avoids human relations
Manage infringement problem.
Brief description of the drawings
Fig. 1 is the dependency diagram for being detected sequence region and CpG sites；
Fig. 2 is the comparison sheet figure (table 1) between Shenzhen area case group and control group；
Fig. 3 is the comparison sheet figure (table 2) between Ningbo area case group and control group；
Fig. 4 is the comparison sheet figure (table 3) between Shenzhen and Ningbo area case group；
Fig. 5 is the comparison sheet figure (table 4) between Shenzhen and Ningbo area control group；
Fig. 6 is Shenzhen and each disease group in Ningbo area and the correlation comparison sheet figure (table 5) between control group.
Embodiment
The present invention is described in further detail below in conjunction with accompanying drawing embodiment.
A kind of detection kit of auxiliary diagnosis cerebral apoplexy, described detection kit includes a pair of dihyrofolate reductases
Gene promoter zone methylation specificity amplification primer, a pair of described dihydrofolate reductase gene promoter zone methylations are special
Specific amplification primers include methylation-specific sense primer and methylation-specific anti-sense primer：
Described methylation-specific sense primer includes following nucleotide sequence：
5’- TATTTGAGCGGTGGTTAG -3’；
Described methylation-specific anti-sense primer includes following nucleotide sequence：
5’- TCTACTATAACGAACGAACTC -3’。
A kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy：It is characterized in that：Comprise the following steps：
Step 1: extracting Whole Blood Genomic DNA using the Full automatic instrument for extracting nucleic acid of Lab-Aid 820, then pass through
NanoDrop2000 ultramicrospectrophotometers detect DNA concentration；Whole Blood Genomic DNA come from detected person blood plasma,
The body fluid such as saliva, urine.
Step 2: carrying out bisulfite conversion to sample DNA using methylating reagent box；
Cytimidine (C) in complete genome DNA and bisulfite reaction can make it is single-stranded in unmethylated cytimidine change
For thymidine (T), and it is single-stranded in the cytimidine that has methylated then be not transitioning to thymidine.According to this principle, lead to
The EZ DNA Methylation-Gold kits using Zymo Research companies are crossed, through loading, washing, elution etc.
Step converted after DNA.
Step 3: the real-time specific PCR of fluorescent quantitation (QMSP) early-stage preparations：Under the conditions of primer content is 10uM,
Primer TE or dd H2O is separately added into be diluted.Material needed for QMSP include water, enzyme, primer, template, wherein, base
Because promoter zone methylation specificity amplification primer (containing sense primer and anti-sense primer) has been included in detection reagent of the present invention
Among box, and primer then needs to be diluted before sample-adding.
Step 4: carrying out the real-time specific PCR of fluorescent quantitation：
1) take DNA sample 20ng transformed in step 2 to be added to Zymo TaqTM PreMix enzymes, and add a pair of dihydro leaves
Sour reductase promoter zone methylation specificity amplification primer.Include water, enzyme, primer, template in final system.According to template
And the quantity of primer, rationally design Loading sequence and content.The content of various composition is as follows in system:
| Reagent | Volume |
| 2 X SYBR Green I | 5.00ul |
| Primer F(10uM) | 0.25ul |
| Primer R(10uM) | 0.25ul |
| ddH2O | 3.50ul |
| Template(diluted) | 1.00ul |
2）Quantitative fluorescent PCR instrument is determined,
1st, the pre-degeneration of 10 minutes is first carried out.
2nd, 45 PCR cycles are completed, is respectively denatured, anneals and extension
3rd, solubility curve is obtained.
4th, result is read after machine cooling.
Its setting program see the table below：
Step 5: carrying out methylation analysis to result.Here, with related software (LightCycler 480_
Software data) are calculated, statistics is arranged.
Dihyrofolate reductase (dihydrofolate reductase,DHFR) it is a kind of protein coding gene, it can
Catalysis dihydrofoilic acid is converted into tetrahydrofolic acid.The hyper-methylation level of dihydrofolate reductase gene promoter region can cause this
The low expression of gene even expression silencing, causes the tetrahydrofolic acid with coenzyme activity to decline and causes homocysteine level liter
Height, and then a great risk as cerebral apoplexy.Therefore, dihydrofolate reductase gene promoter zone methylation water
The flat illness rate with cerebral apoplexy is proportionate.The present invention is developed a kind of to be methylated water with specific detection cerebral apoplexy related gene
Based on flat, the kit of the detection to cerebral apoplexy is conveniently and efficiently realized on a molecular scale, and such a method detection efficiency is high,
It is with strong points.
Dihydrofolate reductase gene promoter zone methylation level and the illness rate of cerebral apoplexy are proved below by experiment
It is proportionate.
1st, the collection of research object
Patients with cerebral apoplexy sample is collected from the hospital of Shenzhen and Ningbo area, patient makes a definite diagnosis use " FAST " determining method and combined most
Determined after new-type instrument diagnostic techniques Shenzhen area cerebral apoplexy patient 172 as case group (66.23 ± 9.07 years old) and
Age-matched and 325 normal persons without cerebral apoplexy family history are as a control group (66.00 (60.00,72.00) year)；Collect
Ningbo area cerebral apoplexy patient 56 is as case group (62.98 ± 11.70 years old) and age-matched and without cerebral apoplexy family history
137 normal persons as a control group (63.57 ± 10.24 years old) to all research objects on the premise of informed consent, take out
The general biochemical indicator such as uric acid level, triglycerides is surveyed in blood examination, while venous blood samples 3ml enters in EDTA anticoagulant tubes, it is -80 DEG C low
Temperature storage, to be ready for use on, sample is unified to extract genomic DNA.
2nd, the extraction of genomic DNA
Extract what above-mentioned steps were obtained using the Full automatic instrument for extracting nucleic acid of Lab-Aid 820 (Chinese Xiamen causes kind biotechnology)
The Whole Blood Genomic DNA of sample, then pass through NanoDrop2000 ultramicrospectrophotometers (U.S., Thermo Fisher
Scientific) detection gained DNA concentration, forDHFRThe detection of gene promoter area DNA methylation level.
3rd, DNA methylation level is determined
This experiment is right using the real-time PCR of fluorescent quantitation (QMSP)DHFRThe CpG sites (such as Fig. 1) of gene promoter area carry out DNA
Methylation level is analyzed.The general principle of this technology：Gene order is marked using fluorescent technique, and causes gene order
Can be by Sensitive Detection when being expanded.After polymerase chain reaction (PCR) so that gene order carries out multiple expansion
Increase, the different amplification curve of each blood sample correspondence.Curve is that correspondence CT values are (each with both setting the abscissa point that threshold value intersects
Fluorescence signal in reaction tube reaches the period undergone during given threshold).The percentage (PMR) for the reference value that methylates uses 2−ΔΔCtQuantization method, i.e. Δ Δ Ct=DNA samples (CTTarget gene - CTACTBDNA methylation sample (the CT of)-completelyTarget gene-
CTACTB), draw specific methyl rate.
Pcr amplification primer thing for experiment is as follows：
Methylation-specific sense primer includes following nucleotide sequence：
5’- TATTTGAGCGGTGGTTAG -3’；
Methylation-specific anti-sense primer includes following nucleotide sequence：
5’- TCTACTATAACGAACGAACTC -3’。
4th, the accuracy of the data obtained is verified
The accuracy of methyl rate obtained by QMSP is verified using sequencing technologies.
5th, data analysis
This substantial amounts of clinical data of experiment collection simultaneously draws a series of experiments data, data is carried out using SPSS 16.0 whole
Reason analysis.Considered from angle of statistics, p value, which is less than 0.05, has statistical significance.
From table 1：Gene promoter region hyper-methylation be cause one of stroke patients it is larger it is dangerous because
Element (P c=1.12E-08), and the potential factor such as hypertension can also greatly improve the risk of patients with cerebral apoplexy, they it
Between methylation level difference have preferable statistical significance (P a = 3.38E-12)。
Understand that the methyl rate of the patients with cerebral apoplexy of Ningbo area and Shenzhen area has significant difference according to table 3, and in year
Age and biochemical indicator TG show obvious difference.Shown by table 3 and table 4 Ningbo area and Shenzhen area normal person it is many
Biochemical indicator (such as UA, TG, TC) all have it is obvious different (P <0.05), according to table 5 understand, only Shenzhen area AGE, UA with
The correlation of cerebral apoplexy is statistically significant, it is seen that region factor is also one of the stroke patients original that can not be ignored
Cause.
The present invention is picked outDHFRThe promoter region of gene is as research object, and " A " part understands to be detected in Fig. 1
Sequence region particular location is Chr5:79950220-79950350, follow-up methylation analysis is carried out accordingly；In Fig. 1
The DNA sequence analysis result of " B " part shows that the bisulfite conversion of template DNA is successful；" C " part shows capillary in Fig. 1
Electrophoresis tube confirms that expanding fragment length is 131 bp.
Note：N represents number of samples in chart, and p value is the result compareed between two arrays, if it is less than 0.05,
Then represent that there is larger significant difference between the two arrays, be expressed as positive findings, emphasized with character overstriking.P aIt is brain
The result that apoplexy patient is contrasted with hyperpietic；P b It is the result that patients with cerebral apoplexy is contrasted with normal person；P cIt is high
The result that blood pressure patient is contrasted with normal person.The data of normal distribution are not met, are represented with median (quartile),
It calculates gainedpAdd after value#；Meet the data of normal distribution, represented with average ± variance, it calculates gainedpAdd after value*,
With its reasonability.
Highly preferred embodiment of the present invention has been elucidated with, and the various change or remodeling made by those of ordinary skill in the art are all
It is without departing from the scope of the invention.
SEQUENCE LISTING
<110>Ningbo Municipal Center for Disease Control ＆ Prevention
<120>A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
tatttgagcg gtggttag 18
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
tctactataa cgaacgaact c 21
Claims (5)
1. a kind of detection kit of auxiliary diagnosis cerebral apoplexy, it is characterized in that：Described detection kit includes a pair of dihydro leaves
Sour reductase gene promoter zone methylation specificity amplification primer, a pair of described dihydrofolate reductase gene promoter regions
Methylation-specific amplimer includes methylation-specific sense primer and methylation-specific anti-sense primer：
Described methylation-specific sense primer includes following nucleotide sequence：
5’- TATTTGAGCGGTGGTTAG -3’；
Described methylation-specific anti-sense primer includes following nucleotide sequence：
5’- TCTACTATAACGAACGAACTC -3’。
2. a kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy according to claim 1：It is characterized in that：Bag
Include following steps：
Step 1: extracting the Whole Blood Genomic DNA of sample, and detect gained DNA concentration；
Step 2: carrying out bisulfite conversion to sample DNA using methylating reagent box；
Step 3: the real-time specific PCR early-stage preparations of fluorescent quantitation：Under the conditions of primer content is 10uM, it is separately added into
Primer TE or dd H2O are diluted；
Step 4: carrying out the real-time specific PCR of fluorescent quantitation：DNA sample 20ng transformed in step 2 is taken to be added to Zymo
TaqTM PreMix enzymes, and a pair of dihyrofolate reductase promoter zone methylation specificity amplification primers are added, enter performing PCR expansion
Increase；
Step 5: carrying out methylation analysis to result.
3. a kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy according to claim 2：Described step
Whole Blood Genomic DNA is extracted using the Full automatic instrument for extracting nucleic acid of Lab-Aid 820 in one, then passes through NanoDrop2000 ultramicron
Spectrophotometer detects DNA concentration.
4. a kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy according to claim 2：Described step
Bisulfite conversion is carried out to sample DNA using EZ DNA Methylation-Gold kits in two.
5. a kind of detection method of the detection kit of auxiliary diagnosis cerebral apoplexy according to claim 2：Described step
PCR amplification conditions are in four：95 DEG C first 10min pre-degeneration；Then 95 DEG C of 20s, Tm 20s, 72 DEG C of 30s, totally 45
The annealing reaction of circulation；Then 40 DEG C of 10min of extension.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710473312.8A CN107164510A (en) | 2017-06-21 | 2017-06-21 | A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710473312.8A CN107164510A (en) | 2017-06-21 | 2017-06-21 | A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107164510A true CN107164510A (en) | 2017-09-15 |
Family
ID=59819450
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710473312.8A Pending CN107164510A (en) | 2017-06-21 | 2017-06-21 | A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164510A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109061139A (en) * | 2018-06-19 | 2018-12-21 | 温州医科大学附属第医院 | Application of the serum inflammatory biomarker in prevention and treatment acute cerebral ischemic infarction |
| CN111286534A (en) * | 2019-08-06 | 2020-06-16 | 苏州大学 | CORIN gene DNA methylation marker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100112589A1 (en) * | 2008-11-03 | 2010-05-06 | Xie Yagang | Allele-allele interactions of mthfr gene variants, and uses thereof in predicting disease risk |
| CN103911456A (en) * | 2014-04-18 | 2014-07-09 | 宁波大学 | Detection kit for helping diagnose Alzheimer disease and detection method thereof |
-
2017
- 2017-06-21 CN CN201710473312.8A patent/CN107164510A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100112589A1 (en) * | 2008-11-03 | 2010-05-06 | Xie Yagang | Allele-allele interactions of mthfr gene variants, and uses thereof in predicting disease risk |
| CN103911456A (en) * | 2014-04-18 | 2014-07-09 | 宁波大学 | Detection kit for helping diagnose Alzheimer disease and detection method thereof |
Non-Patent Citations (5)
| Title |
|---|
| ANNETTE BENTSEN HÅVIK等: "MGMT Promoter Methylation in Gliomas-Assessment by Pyrosequencing and Quantitative Methylation-Specific PCR", 《JOURNAL OF TRANSLATIONAL MEDICINE》 * |
| HSIU-FEN LIN等: "Methylation in the Matrix metalloproteinase-2 Gene Is Associated With Cerebral Ischemic Stroke", 《JOURNAL OF INVESTIGATIVE MEDICINE》 * |
| JAE-MIN KIM等: "Associations of BDNF Genotype and Promoter Methylation With Acute and Long-Term Stroke Outcomes in an East Asian Cohort", 《PLOS ONE》 * |
| LOO KEAT WEI等: "A Potential Epigenetic Marker Mediating Serum Folate and Vitamin B12 Levels Contributes to the Risk of Ischemic Stroke", 《BIOMED RESEARCH INTERNATIONAL》 * |
| 魏艳: "P53基因启动子区甲基化状态与缺血性脑卒中的相关性研究", 《万方学位论文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109061139A (en) * | 2018-06-19 | 2018-12-21 | 温州医科大学附属第医院 | Application of the serum inflammatory biomarker in prevention and treatment acute cerebral ischemic infarction |
| CN111286534A (en) * | 2019-08-06 | 2020-06-16 | 苏州大学 | CORIN gene DNA methylation marker and application thereof |
| CN111286534B (en) * | 2019-08-06 | 2023-05-16 | 苏州大学 | CORIN gene DNA methylation marker and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111363848A (en) | Internal reference gene for respiratory tract RNA virus PCR detection and detection product thereof | |
| WO2020048518A1 (en) | Group of genes for molecular typing of medulloblastoma and use thereof | |
| CN106399462A (en) | BCR-ABL fusion gene amplification kit and BCR-ABL fusion gene detection kit | |
| CN116814781A (en) | Markers, kits and devices for detecting urothelial cancer | |
| CN105385780A (en) | Kit for rapidly detecting methicillin-resistant staphylococcus aureus and application thereof | |
| CN104480206A (en) | Primer, probe and kit for fluorescent quantitative detection on genes of spinal muscular atrophy (SMA) | |
| CN102732633B (en) | Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit | |
| CN104673891A (en) | Detection method and kit for spinal muscular atrophy related gene mutation | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN107164510A (en) | A kind of detection kit and its detection method of auxiliary diagnosis cerebral apoplexy | |
| CN106967839A (en) | Primer, probe, kit and the method for B races streptococcus fluorescence quantitative PCR detection | |
| CN107164519A (en) | A kind of primer and probe that ESR1 gene mutations are detected based on fluorescent PCR | |
| CN103773894B (en) | For detecting the dual probe determination method of HCV | |
| CN105779580A (en) | Methods and markers for assessing risk of developing colorectal cancer | |
| CN102517390B (en) | Chromosome aneuploidy detection kit based on real-time fluorescent PCR | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN111424101A (en) | Kit and method for quantitatively detecting yersinia sporogenes | |
| CN106544428A (en) | Primer and its application needed for detection BDNF gene promoter zone methylation degree | |
| CN107326078A (en) | The detection kit and assay method of a kind of cystathionine beta synthase gene promoter zone methylation degree | |
| CN105950723A (en) | Noninvasive methylation quantitative detection kit used for early diagnosis on colorectal cancer | |
| CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
| CN105506068A (en) | AMRMS-qPCR detection kit and detection method for MMP2 genotyping | |
| US20220290249A1 (en) | Colorectal cancer diagnostic marker, method for assisting diagnosis of colorectal cancer, method for collecting data for diagnosis of colorectal cancer, colorectal cancer diagnostic kit, therapeutic agent for colorectal cancer, method for diagnosing colorectal cancer, and method for treating colorectal cancer | |
| CN107841549A (en) | Detection kit and determination method for methylation degree of serine hydroxymethyltransferase gene promoter region | |
| CN103060315B (en) | Detection kit and method for predicting susceptibility to prostate cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170915 |
|
| RJ01 | Rejection of invention patent application after publication |