WO2022262118A1

WO2022262118A1 - Dna methylation marker and use thereof

Info

Publication number: WO2022262118A1
Application number: PCT/CN2021/114684
Authority: WO
Inventors: 彭浩; 张明芝; 何艳
Original assignee: 苏州大学
Priority date: 2021-06-17
Filing date: 2021-08-26
Publication date: 2022-12-22
Also published as: CN113373213A; CN113373213B

Abstract

Provided are a DNA methylation marker and the use thereof. The marker is methylation site Chr1:11908353 in an NPPA gene promoter region, wherein the methylation level thereof indicates the onset risk of hypertension or cerebral apoplexy. The marker can be used for predicting the onset risk of cerebral apoplexy, provides a basis for screening a population at high risk of cerebral apoplexy, and can also be used as an intervention target for preventing and controlling hypertension and cerebral apoplexy.

Description

A DNA methylation marker and its application

technical field

The invention relates to the technical field of bioengineering, in particular to a DNA methylation marker and its application.

Background technique

Hypertension is not only a cardiovascular disease, but also an important risk factor for many other cardiovascular and cerebrovascular diseases. Globally, 67% of heart disease, 54% of stroke are caused by high blood pressure, and 13.5% of deaths are attributed to high blood pressure. Among them, stroke, as a global health problem, has become the primary disease that threatens the life and health of Chinese residents, and brings huge disease burden and economic loss to Chinese residents every year. The results of the "China Stroke Epidemic Report" released by the China Stroke Association for the first time in 2015 show that there are about 2.7 million new patients with cerebrovascular diseases in my country every year, about 1.3 million patients die of cerebrovascular diseases every year, and one person has a stroke every 12 seconds , every 21 seconds someone dies from a stroke. Therefore, how to effectively prevent and control stroke is a major public health challenge facing our country, and it is urgent to find and discover more potential risk factors and intervention targets for stroke.

The natriuretic peptide axis is an important cardiac endocrine regulatory system for the body to respond to external environmental stimuli, and plays an important role in maintaining the body's water and sodium balance, blood pressure stability, and energy metabolism balance. The natriuretic peptide axis is mainly composed of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP) and their receptors. When blood volume increases, cardiomyocytes secrete and release a large amount of biologically inactive atrial natriuretic peptide precursor (pro-ANP) and brain natriuretic peptide precursor (pro-BNP), pro-ANP, pro-NNP It is further activated into active ANP and BNP, and binds to its receptor to activate the natriuretic peptide axis, thereby promoting water and sodium metabolism, reducing blood volume, dilating blood vessels, and promoting energy metabolism, thereby maintaining cardiovascular homeostasis.

At present, there is no research report on the relationship between DNA methylation of ANP coding gene NPPA and hypertension and stroke, and there is no report on a suitable methylation marker that can be used as an intervention target for the prevention and control of hypertension and stroke. point.

Contents of the invention

In order to solve the above technical problems, the present invention provides a DNA methylation marker related to hypertension and stroke through the study of the correlation between DNA methylation and hypertension and stroke phenotype, which is useful in predicting stroke It provides a basis for the screening of high-risk populations with high risk of stroke and stroke, and is also expected to be an intervention target for the prevention and control of hypertension and stroke.

The first object of the present invention is to provide a DNA methylation marker, which is the methylation site Chr1:11908353 in the promoter region of the NPPA gene, and the degree of methylation is related to the risk of hypertension or stroke .

The above-mentioned method for detecting DNA methylation markers of NPPA gene related to hypertension and cerebral apoplexy comprises the following steps:

(1) extract DNA sample, and carry out bisulfite treatment to DNA sample;

(2) using suitable primers to amplify the sample after bisulfite treatment in step (1) to obtain an amplification product;

(3) Transcribing and digesting the amplified product of step (2) to obtain a transcription and digesting product;

(4) Detect the transcription and digestion products of step (3), and obtain the degree of methylation in the sample sequence.

Application of the above DNA methylation markers in the preparation of reagents for predicting or detecting the risk of developing hypertension or cerebral apoplexy.

Application of the above-mentioned DNA methylation markers in the preparation of screening reagents for stroke high-risk groups.

Application of the above DNA methylation markers in the preparation of drugs for treating hypertension or cerebral apoplexy.

Furthermore, DNA methylation is reversible, and the therapeutic drug is a targeted drug designed based on the DNA methylation site of the NPPA gene or the NPPA gene, which can regulate the expression of the NPPA gene and the secretion of ANP, thereby reducing blood pressure, The purpose of treating stroke.

The second object of the present invention is to provide a kit for predicting the risk of stroke, including reagents for detecting the degree of methylation of the above-mentioned DNA methylation markers.

Further, the kit includes a pair of primers for amplifying the DNA methylation site Chr1:11908353.

Further, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, specifically:

F: TTTTGTTTTGAGGTTAGAGGTTTTGTTTA

R: AAAAAATCCCTTAATTATCTCACCRCC

Application of the above primer pair in preparation of reagents for predicting or detecting the risk of hypertension or cerebral apoplexy.

Application of the above primer pair in preparation of screening reagents for stroke high-risk groups.

The third object of the present invention is to provide a method for detecting the risk of stroke. The detection threshold is set according to the degree of methylation of the NPPA gene DNA methylation marker. The methylation site Chr1 of the subject: 11908353 When the degree of methylation is higher than the detection threshold, the subject is normal, and when the degree of methylation is lower than the detection threshold, the subject is at risk of stroke.

Furthermore, NPPA is derived from blood, which is convenient for sampling.

By means of the above solution, the present invention has at least the following advantages:

(1) The NPPA gene DNA methylation marker provided by the present invention can be used to predict the risk of hypertension and stroke, provide a basis for the screening of high-risk groups of stroke, and can also be used as an intervention to prevent and control hypertension and stroke target.

(2) The present invention not only helps to explain the molecular mechanism of NPPA deficiency acting on hypertension and stroke, but also provides important epidemiological information for NPPA gene methylation as a drug target for the prevention and control of hypertension and stroke evidence.

The above description is only an overview of the technical solutions of the present invention. In order to understand the technical means of the present invention more clearly and implement them according to the contents of the description, the preferred embodiments of the present invention are described below with detailed drawings.

Description of drawings

In order to make the content of the present invention more clearly understood, the present invention will be further described in detail below according to the specific embodiments of the present invention and in conjunction with the accompanying drawings.

Fig. 1 is the schematic diagram of the DNA methylation mark of the present invention;

Fig. 2 is a schematic diagram of 9 CpG sites in the promoter region of the NPPA gene in the embodiment, wherein site 1 is the methylation marker of the present invention.

detailed description

The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and implement it, but the examples given are not intended to limit the present invention.

Example

In two independent populations, a discovery study (enrolling 2,498 individuals, including 1,109 hypertensives and 1,389 normotensives) and a validation study (enrolling 1,771 individuals, including 995 hypertensives and normotensives 776 people). Whole blood DNA samples were extracted from each subject, and the target region sequencing technology was used to detect the methylation level of each CpG site in the promoter region of the NPPA gene, that is, the promoter region of the human NPPA gene (gene number: ENSG00000175206) was queried using the ENSEMBL database , this region is Chromosome 1:11908117-11908380 (GRCh37.P13, distance from TSS: -540bp to-277bp), intercept the nucleic acid sequence of this region on NCBI, import the nucleic acid sequence into EMBOSS Cpgplot software to predict the CpG island, and then use the Epidesigner program Primers were designed for the sequences of CpG islands and CpG-intensive regions, and appropriate primers were selected for DNA methylation detection (see Table 1 for primer sequence information). After selection, the methylation levels of 9 CpG sites were obtained, and the 9 CpG sites are shown in FIG. 2 .

Table 1 NPPA gene promoter region DNA methylation detection primer sequence

The specific detection methods for DNA methylation are:

First, DNA samples were treated with bisulfite using EZ-96 DNA Methylation Kit (Zymo Research, Orange, CA), and all cytosine C without methylation modification in the sample DNA was converted into uracil U. Then use the primers in Table 1 and use the sample genome treated with bisulfite as a template for multiplex PCR amplification. In order to distinguish different samples, primers with Index sequences were used to introduce specific tag sequences compatible with the Illumina platform to the end of the library by PCR amplification. Finally, the Index PCR amplification products of all samples were mixed in equal amounts, and high-throughput sequencing was performed on the Illumina Hiseq/Miseq platform in the paired-end sequencing mode of 2×150bp/2×250bp to obtain FastQ data. The methylation level of each CpG site was quantified as the number of reads methylated at this site (ie, the number of reads with base C detected)/total number of reads at this site×100%.

The research results are as follows:

1. Clinical characteristics of the research subjects

In both populations, hypertensive patients had more traditional risk factors such as smoking, alcohol consumption, obesity, hyperglycemia, and hyperlipidemia than normotensive subjects (all P<0.05).

Table 1 Clinical characteristics of the research subjects

2. The methylation site with the strongest relationship with hypertension

As shown in Table 2, the DNA methylation levels of the nine detected CpG sites were higher in hypertensive patients than in normotensive patients. After further adjustment of traditional risk factors, it was found that only CpG1 was significantly correlated with blood pressure and hypertension in the study, and the P values after correction of multiple tests were all <0.05 (Table 3), and every 5% increase in the methylation level of this site , the risk of hypertension decreased by 13%. Similarly, the same findings were found in the validation study. After correcting multiple tests, only CpG1 was significantly associated with blood pressure and hypertension (all P values after correction were <0.05), and the methylation level of this site per liter 5% higher, the risk of hypertension decreased by 18% (Table 4).

Table 2 DNA methylation level of NPPA gene

Table 3 found the relationship between NPPA gene DNA methylation and blood pressure and the prevalence of hypertension in the study

Table 4 The relationship between NPPA gene DNA methylation and blood pressure and the prevalence of hypertension in the verification study

3. Methylation sites that can independently predict the risk of future stroke

The 2,498 people in the above discovery study were followed up for 10 years to obtain stroke events. By analyzing the relationship between the DNA methylation level of the NPPA gene and stroke events at baseline, it was found that it can independently predict the risk of stroke in the future. methylation site. The results are shown in Table 5. After correcting for multiple tests, only CpG1 was significantly associated with the risk of stroke (all corrected P values <0.05). After adjusting traditional risk factors, the methylation level of this site increased by 5%. , the risk of stroke is reduced by 21%.

Table 5 The relationship between baseline NPPA gene DNA methylation and the risk of stroke

4. Construction of a methylation detection kit

Based on the above studies, it can be known that: as shown in Figure 1, after the methylation of the CpG1 site located in the promoter region, it may inhibit the expression of NPPA gene and the secretion of pro-ANP protein, and then participate in the pathogenesis of hypertension and stroke. It can be used as a predictive marker and potential drug target for the risk of stroke. Therefore, the present invention constructs a methylation detection kit based on the CpG1 site.

The specific detection method is:

① Whole blood DNA extraction and quality inspection

a. Agarose gel electrophoresis to detect the integrity of genomic DNA: the electrophoresis bands are clearly visible, without obvious degradation, and without RNA contamination.

b. Nanodrop 2000 detects the quality of genomic DNA: concentration ≥ 20ng/μL, total amount ≥ 1μg, OD260/280 = 1.7-2.0, OD260/230 ≥ 1.8.

②Sulfite treatment

EZ-96 DNA Methylation Kit (Zymo Research, Orange, CA) was used to treat qualified DNA samples with sulfite to convert all unmethylated cytosine C in the sample DNA into uracil U.

③Multiple PCR amplification

Then, the designed primers (F: TTTTGTTTTGAGGTTAGAGGTTTGTTTA; R: AAAAATCCTTAATTATCTCACCRCC) were used to amplify DNA from the sulfite-treated specimen to obtain the amplified product with T7 RNA polymerase promoter sequence.

④ CpG fragment cutting

Then use T7 RNA polymerase to transcribe the amplified DNA product into RNA fragments, and use RNase A to cut the resulting RNA fragments into small fragments with CpG.

⑤ In-flight mass spectrometry analysis

Finally, in each small RNA fragment, the final product of unmethylated CpG is CpA, and the final product of methylated CpG is CpG. The molecular weight of this final product is detected using the Agena MassArray flight mass spectrometry system.

⑥ Methylation level calculation and stroke risk prediction

The methylation level of the CpG site is quantified as product quality CpG/(CpG+CpA)×100%, and the methylation level <50% indicates a higher risk of stroke, so close attention should be paid and preventive treatment measures should be taken.

Based on the above studies, it can be known that, as shown in Figure 1, after the methylation of the Chr1:11908353 CpG site located in the promoter region, it may inhibit the expression of NPPA gene and the secretion of pro-ANP protein, and then participate in the development of hypertension and stroke. It can be used as a predictive marker and a potential drug target for the risk of hypertension and stroke.

Apparently, the above-mentioned embodiments are only examples for clear description, and are not intended to limit the implementation. For those of ordinary skill in the art, on the basis of the above description, other changes or changes in various forms can also be made. It is not necessary and impossible to exhaustively list all the implementation manners here. However, the obvious changes or changes derived therefrom are still within the scope of protection of the present invention.

Claims

A DNA methylation mark, is characterized in that, described DNA methylation mark is the methylation site Chr1:11908353 of NPPA gene promoter region, the degree of methylation of described DNA methylation mark Indicates the degree of risk of developing high blood pressure or stroke.
The application of the DNA methylation marker according to claim 1 in the preparation of reagents for predicting or detecting the risk of hypertension or cerebral apoplexy.
The application of the DNA methylation marker according to claim 1 in the preparation of screening reagents for stroke high-risk groups.
The application of the DNA methylation marker according to claim 1 in the preparation of drugs for treating hypertension or cerebral apoplexy.
The application according to claim 4, wherein the therapeutic drug is a targeted drug designed based on the methylation site of claim 1.
A kit for predicting the risk of stroke, characterized in that it comprises a reagent for detecting the degree of methylation of the DNA methylation marker according to claim 1.
The kit according to claim 6, wherein the kit comprises a pair of primers for amplifying the DNA methylation site Chr1:11908353.
Kit according to claim 7, is characterized in that, the nucleotide sequence of described primer pair is as shown in SEQ ID NO.1 and SEQ ID NO.2.
The use of the primer pair according to claim 7 in the preparation of reagents for predicting or detecting the risk of hypertension or stroke or the preparation of reagents for screening high-risk groups of stroke.
A method for detecting the risk of stroke based on the DNA methylation marker according to claim 1 or the kit according to claims 5-7, characterized in that: according to the methyl group of the DNA methylation marker The detection threshold is set for the degree of methylation, when the methylation degree of the methylation site Chr1:11908353 of the subject is higher than the detection threshold, the subject is normal, and when the methylation degree is lower than the detection threshold, The subject is at risk of stroke.