CN111254159B

CN111254159B - Soybean GmST1 gene mutant plant and preparation method thereof

Info

Publication number: CN111254159B
Application number: CN201811455513.6A
Authority: CN
Inventors: 韩英鹏; 井妍; 赵雪; 滕卫丽; 李文滨
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2018-11-30
Filing date: 2018-11-30
Publication date: 2023-03-31
Anticipated expiration: 2038-11-30
Also published as: CN111254159A

Abstract

A soybean GmST1 gene mutant plant and a preparation method thereof, belonging to the technical field of plant biology. The invention provides a preparation method of a soybean GmST1 gene mutant plant for determining the disease resistance function of a soybean mosaic virus-resistant related gene, which comprises the following steps: designing a gRNA single-target-point primer according to a soybean GmST1 gene; preparing a gRNA single-target primer dimer; inserting the primer dimer into a Cas9/gRNA vector to construct a soybean GmST1 gene knockout vector; and (4) transforming the GmST1 gene knockout vector constructed in the step 3) into soybeans, and screening to obtain soybean GmST1 gene mutant plants. The invention determines that GmST1 can participate in the resistance reaction of resisting the soybean mosaic virus disease, and provides a theoretical basis for the research of the functions of the genes related to the soybean mosaic virus resistance.

Description

Soybean GmST1 gene mutant plant and preparation method thereof

Technical Field

The invention relates to the technical field of plant biology, in particular to a soybean GmST1 gene mutant plant and a preparation method thereof.

Background

Soybean Mosaic Virus (SMV), which is caused by Soybean Mosaic Virus, is one of the most serious viral diseases affecting Soybean yield and quality. In the main soybean production area in northeast China, N1 and N3 strains are dominant strains, and abnormal growth of soybean plants caused by the dominant strains can cause large-area yield reduction of soybeans by 25-60 percent, and even the dominant strains are dead in severe conditions. Due to the limitation of the traditional breeding method, the screening and identification of effective disease-resistant genes by using a molecular means are particularly important for breeding the disease-resistant varieties, so that the efficiency and the accuracy of breeding the disease-resistant varieties are improved, and the process of breeding the disease-resistant varieties is accelerated. Due to the problems of huge genome of soybean, polyploidization phenomenon of soybean, low transformation rate and the like, the difficulty is increased in the function analysis of disease-resistant genes.

Disclosure of Invention

In order to clarify the disease resistance function of a soybean mosaic virus-resistant related gene, the invention provides a soybean GmST1 gene mutant plant, which contains a mutant soybean GmST1 gene, wherein the mutation is that nucleotide sequence of 5 'AGAAAGGGGAGGAAATAAATAA 3' or 5 'CTTCCTAGGGAGAGGGT 3' in the coding region of the GmST1 gene is subjected to base substitution or deletion so as to change the coded amino acid sequence, and the nucleotide sequence of the soybean GmST1 gene is shown as SEQ ID NO:1 is shown.

The preparation method of the soybean GmST1 gene mutant plant comprises the following steps:

1) Designing a gRNA single-target primer according to a soybean GmST1 gene;

2) Preparing a gRNA single-target primer dimer;

3) Inserting the primer dimer into a Cas9/gRNA vector to construct a soybean GmST1 gene knockout vector;

4) Transforming the GmST1 gene knockout vector constructed in the step 3) into soybeans, and screening to obtain soybean GmST1 gene mutant plants.

Further limited, the forward primer of the soybean GmST1gRNA single-target primer in the step 1) is GmST1-1-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:2, the reverse primer is GmST1-1-A, and the nucleotide sequence thereof is shown as SEQ ID NO. 3; or the forward primer is GmST1-2-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:4, the reverse primer is GmST1-2-A, and the nucleotide sequence of the reverse primer is SEQ ID NO:5, respectively.

Further limited, the preparation of gRNA single-target primer dimer in step 2) means that 5. Mu.L of forward primer, 5. Mu.L of forward primer and H are added in each 20uL synthesis system ₂ O15 mu L, the reaction condition is 95 ℃ for 3min, after cooling to 25 ℃, standing for 5min at 16 ℃.

Further limiting, the step 3) of constructing the GmST1 gene knockout vector means that in every 10uL reaction system, 1-7 uL primer dimer, 1 uL Cas9/gRNA vector,1 uL Solution2 uL Solution, H ₂ O0-6. Mu.L, and reacted at 16 ℃ overnight.

Further limiting, the GmST1 gene knockout vector in the step 4) is used for transforming the soybean by an agrobacterium-mediated method; the agrobacterium is agrobacterium EHA105.

Further defined, the soybean of step 4) is Dongnong 93-046.

Further limited, the forward primer used in the screening in the step 4) is CasJC-S, and the nucleotide sequence of the forward primer is shown in SEQ ID NO:6, the reverse primer is CasJC-A, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:7, used for screening positive mutant plants.

Further limited, the forward primer used in the screening in the step 4) is GmST1-target1-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:8, the reverse primer sequence is GmST1-target1-A, and the nucleotide sequence is shown as SEQ ID NO:9, which is used for detecting a soybean GmST1 gene mutant plant constructed by using primers GmST1-1-S and GmST 1-1-A; or the forward primer is GmST1-target2-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:10, the reverse primer is GmST1-target2-A, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:11, is used for detecting soybean GmST1 gene mutant plants constructed by using primers GmST1-2-S and GmST 1-2-A.

Further limited, qRT-PCR quantitative detection is carried out on the expression quantity of the mutated GmST1 gene in the obtained soybean GmST1 gene mutant plant, the forward primer for detection is qGmST1-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:12, the reverse primer is qGmST1-A, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:13 is shown in the figure; the gene used for comparison is a virus coat protein gene, a forward primer for detecting the expression quantity of the gene is SMV-CP-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:14, the reverse primer is SMV-CP-A, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:15, respectively.

Advantageous effects

The invention utilizes CRISPR/Cas9 technology to carry out targeted mutation on a soybean GmST1 gene coding region to obtain a soybean mutant plant, and through comparison with wild type phenotype identification and analysis on GmST1 gene expression quantity and virus coat protein gene expression quantity, the resistance of the soybean mosaic virus is weakened after the GmST1 gene is mutated, and the fact that the GmST1 can participate in the resistance reaction of resisting the soybean mosaic virus is determined, so that the invention provides a theoretical basis for the research on the functions of the soybean mosaic virus-resistant related genes.

Drawings

FIG. 1 shows that 2 single-target vectors of the GmST1 gene construct bacterial liquid PCR, wherein M: DL2000,1, 2 are PCR detection results of target1, and 3, 4 are PCR detection results of target 2.

Fig. 2 PCR mutation detection of the T2 GmST1 gene knockout plant, wherein M: DL2000,1-4: plant PCR product of GmST1-1 gene knockout vector, 5: negative control (Dongnon 93-046).

FIG. 3 shows the base deletion of the GmST1-1 mutant, CK is Dongnong 93-046, WT is the sequence of the GmST1 gene (Glyma.13G191400) on Phytozome, and 2-1 is the mutant plant number.

FIG. 4 variation of leaves after inoculation of SMV N1 in T2 GmST1 knockout plants.

FIG. 5 shows the qRT-PCR detection result of the GmST1 mutant, wherein a is the qRT-PCR detection result of the GmST1 gene in the GmST1-1 mutant. CK is 93-046,1-4: the gene knockout mutant is characterized in that 1 is a mutant of a GmST1-1 target spot, the serial number of a plant 2-1, the serial number of a plant 2-4 is a mutant of a GmST1-2 target spot, and the serial numbers of the plants are 3-1, 3-2 and 3-3 in sequence; 5-8: a non-mutant; b is the qRT-PCR detection result of the SMV CP gene in the GmST1-1 mutant. CK is Dongnong 93-046, a is 1-4: the gene knockout mutant 1 is a mutant of a GmST1-1 target spot, the serial number of the plant is 2-1,2-4 is a mutant plant of the GmST1-2 target spot, and the serial numbers are 3-1, 3-2 and 3-3 in sequence; 5-8: non-mutant.

Fig. 6 PCR mutation detection of the T2-generation GmST1 gene knockout plant, wherein M: DL2000,1-4: plant PCR product of GmST1-2 gene knockout vector, 5: negative control (Dongnong 93-046)

FIG. 7 shows the base deletion of T2 GmST1 gene knockout plants, CK is Dongnong 93-046, WT is the sequence of GmST1 gene (Glyma.13G191400) on Phytozome, and 3-1, 3-2 and 3-3 are the mutant plant numbers respectively.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The pharmaceutical reagents used in the following examples were purchased from conventional biochemical reagent stores, unless otherwise specified. In addition, the soybean variety Dongnon 93-046 (disease resistant variety) is publicly available from northeast university of agriculture; this variety is described in: tengwareli, soybean mosaic disease resistance inheritance, cell ultrastructure analysis and gene location, doctor academic papers, northeast university of agriculture 2006. The public is available from northeast university of agriculture.

Wherein, the preparation method of the LB culture medium comprises the following steps: each liter of the medium was prepared, and 10g of tryptone, 5g of yeast extract and 10g of NaCl were added to 950ml of deionized water, and the vessel was shaken until the solutes were dissolved. Adjusting pH to 7.0 with 5mol/L NaOH, adding deionized water to 1L, and steam sterilizing under high pressure for 21min.

YEP liquid medium: each liter of the medium was prepared, and 10g of tryptone, 5g of yeast extract, and 5g of NaCl were added to 950ml of deionized water, and the vessel was shaken until the solutes were dissolved. The pH was adjusted to 7.0 with 5mol/LNaOH and the volume was 1L with deionized water. Steam sterilization at 15psi high pressure for 21min.

MS ₀ Culture medium: weighing 4.43g MS powder and 30g sucrose, adding 600-800ml distilled water for dissolving, stirring with a glass rod for full dissolution, adjusting pH to 5.8, diluting to 1L, adding 6g agar powder, and steam sterilizing under 15psi for 21min.

The CRISPR/Cas9 kit is purchased from Beijing Weishanglide Biotech Co., ltd, a cargo number VK005-15.

Soybean mosaic virus N1 strain (SMV-N1 strain for short): publicly available from northeast university of agriculture; this strain is described in: tengwareli, soybean mosaic disease resistance heredity, cell ultrastructural analysis and gene location, doctor academic papers, northeast university of agriculture 2006, the phenotype of susceptible leaves is: the leaf veins are dark green, and the system leaves.

Example 1 preparation of soybean GmST1 Gene mutant plants.

This example describes the preparation method of soybean GmST1 gene mutant plants by taking the first target as an example (the target nucleotide sequence is 5 'AGAAAGGGGAGGAAATAAATAA 3') at the 47 th to 64 th bases of the GmST1 coding region.

1) A gRNA single-target-point primer is designed according to the soybean GmST1 gene.

Firstly, amplifying to obtain a soybean GmST1 gene, taking a soybean variety Dongnong 93-046 as a material, taking the material when a first group of three compound leaves grow out, extracting total RNA and carrying out reverse transcription to synthesize a cDNA first chain. Based on the sequence of the GmST1 gene (Glyma.13G191400) on Phytozome, gene cloning primers (Primer 1) were designed using Primer 5 software, and the nucleotide sequences were as follows:

primers 1 to S:5 'GAAGATCTATGGCTCCAAAAATGTCAC-3' (shown in SEQ ID NO: 20);

primer 1-A:5 'CTTGGTTACTTAAAATGACAAGCTCTGAC-3' (shown in SEQ ID NO: 21).

The RT-PCR reaction is carried out by taking cDNA as a template, and the reaction system comprises the following reaction procedures: 5min at 94 ℃;38 cycles: 30s at 94 ℃, 30s at 58 ℃ and 1min at 72 ℃; storing at 72 deg.C for 7min and 4 deg.C. And after the reaction, taking the PCR product, carrying out 1% agarose gel electrophoresis detection, and carrying out gel recovery and purification on the target fragment. The RT-PCR reaction system is as follows:

according to the steps of a PGM-T cloning kit of TIANGEN company, the obtained gel recovery product is connected with a cloning vector to obtain a cloning plasmid pGM-T-GmST1 with a target gene, a Top10 large intestine competent cell is transformed, and a single clone is selected and subjected to PCR and sequencing verification. Finally obtaining the GmST1 gene with the target fragment size of 1035bp, which is shown in SEQ ID NO:1 is shown.

According to the obtained GmST1 gene sequence, a gRNA single-target primer is designed. The forward primer is GmST1-1-S, 5.

2) Preparation of gRNA single target primer dimer.

Mixing the forward primers and the reverse primers according to the following proportion to form a dimer: gmST1-1-S/A (10. Mu.M) each 5. Mu.L, H ₂ After mixing O15. Mu.L, the following treatments were carried out: 3min at 95 ℃;95 to 25 DEG CSlowly cooling at the temperature of DEG C; 5min at 16 ℃.

3) And inserting the primer dimer into a Cas9/gRNA vector to construct a GmST1 gene knockout vector, and marking as the GmST1-1 gene knockout vector.

The reaction system was as follows (10. Mu.l system): the reaction was carried out at 16 ℃ overnight.

4) Transforming agrobacterium to the GmST1-1 gene knockout vector constructed in the step 3), infecting soybeans, and obtaining soybean GmST1 gene mutant plants through identification.

a, conversion: adding 10 μ l of the product into 50 μ l of TOP10 competence which is just thawed, flicking and uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, standing for 2min on ice, adding into 500 μ l of non-resistant LB culture medium, placing into a constant temperature shaking table at 37 ℃, carrying out 170 turns, recovering for 1h, coating a Kana resistant solid plate, carrying out overnight culture at 37 ℃, picking 3-5 single-spot shake bacteria, and carrying out bacteria liquid PCR and sequencing, as shown in figure 1. The PCR detection primers of the bacterial liquid are as follows:

CasJC-S:5 'AAGTCCCACTCGCTTAG-3' (SEQ ID NO: 6)

CasJC-A:5 'and TGTGCAAGGTAAGAAGATGG-3' (shown in SEQ ID NO: 7), wherein the target fragment is 435bp, the sequencing result is compared with the vector sequence, and the positive bacterial liquid is stored at-80 ℃ for later use.

b. Transforming soybean stem tip by agrobacterium tumefaciens mediated method.

The GmST1-1 gene knockout vector is transferred into agrobacterium EHA105, and the plasmid preserved in the experiment is adopted, and the method for transforming agrobacterium by a freeze-thaw method can refer to the following steps: the agrobacterium transformation method is described in the paper of doctor academic thesis, northeast agriculture university 2016.

In the method for transforming the GmST1-1 gene knockout vector into a disease-resistant soybean variety Dongnong 93-046 by an agrobacterium-mediated method, the specific method comprises the following steps:

(1) Preparing bacterial liquid: the prepared bacterial liquid was placed on YEP solid plates (50 mg/mL Str,50mg/mL Kan)25mg/mL Rif), selecting single colony to be inoculated in YEP liquid culture medium (50 mg/mL Str,50mg/mL Kan,25mg/mL Rif), shaking and culturing at 28 ℃ and 200rpm for 1-2 days, taking 1-2mL of bacterial liquid to be inoculated in 50mL of fresh YEP liquid culture medium to be shaken and cultured to OD ₆₀₀ Is 0.6-0.8.

(2) Seed sterilization: the method comprises the steps of selecting full and sterile spot seeds in a culture dish, putting the seeds into a dryer in a ventilation kitchen by adopting a chlorine sterilization method, pouring 96ml of sodium hypochlorite into a triangular flask of the dryer, quickly adding 6ml of concentrated hydrochloric acid, and quickly covering and sealing the flask. Sterilizing for 16h, blowing off residual chlorine gas in a clean bench for about 30min, and sealing for later use.

(3) Seed germination: and (3) inoculating the sterilized seed umbilicus downwards into an MS0 culture medium, wherein 10 seeds are planted in each bottle, and the seeds germinate for 5-6 days under the conditions of 23 ℃,16h of light and 8h of dark.

(4) Preparing a stem tip explant: when the seed germinates to the point that the cotyledon breaks through the seed coat, the seed coat is removed by using a pair of tweezers and a scalpel, half of the two halves of the seed coat is cut off, axillary buds between the cotyledon and a growing point are slightly scraped by using the scalpel, 3-5 wounds are slightly scratched at the cotyledon node, and the rest part is used as an explant for infection.

(5) Infection and co-culture: and putting the prepared explant into the invasive dye liquor for vacuumizing, wherein the vacuumizing condition is 0.6pa and 10min. Washing the explants subjected to vacuum infection with sterilized distilled water for three times, blotting infection liquid on the surfaces of the explants by using sterile paper, inserting the explants into an MS0 culture medium for co-culture for 3 days, observing the revival condition, determining the transplanting time according to the green turning condition of the explants, transplanting the explants into soil, and then culturing the explants in an incubator at the temperature of 25 ℃, under the illumination of 16h and in the dark of 8 h.

c. And (3) identifying mutant plants: taking a T1 generation leaf of a soybean plant with a GmST1 gene knocked out and a control (Dongnong 93-046) leaf, extracting DNA of the leaf, and carrying out PCR identification by using primers:

CasJC-S:5 'AAAAGTCCCACTCGCTTAG-3' (shown in SEQ ID NO: 6);

CasJC-A:5 'and TGTGCAAGGTAAGAAGATGG-3' (shown in SEQ ID NO: 7), wherein the target fragment is 435bp, and a transgenic plant transformed with the GmST1-1 gene knockout vector is identified. Collecting soybean seeds identified as transgenic plants in the T1 generation, inoculating the soybean seeds, extracting leaf DNA, and carrying out PCR detection by using a single-target point mutation detection primer, wherein the forward primer is as follows: gmST1-target1-S: 5; reverse primer: gmST1-target1-A:5 'TCCTTACATTTCTTGACTTAGC-3' (SEQ ID NO: 9). And amplifying a target fragment of 121bp, sequencing the product, and finding that 1 positive plant is mutated at a target point and has 1 base deletion compared with a wild plant (shown in figure 3) according to a sequencing result as shown in figure 2, wherein the mutated GmST1 gene sequence is shown as SEQ ID NO: shown at 16. Collecting soybean seeds identified as transgenic plants in the T1 generation, planting the soybean seeds, and carrying out SMV N1 virus inoculation experiments when the T2 generation plants completely expand the live leaves, wherein the specific method comprises the following steps: 0.01mol/L disodium hydrogen phosphate and sodium dihydrogen phosphate buffer (pH = 7.0) (10 mL/g virus leaf) was prepared, and the mixture was added into a mortar containing the virus leaf and a small amount of carborundum and ground into a slurry. The materials are planted in the sterilized soil, after the true leaves are fully developed, a brush is used for dipping inoculation liquid and the inoculation liquid is rubbed along the veins of the true leaves, and after inoculation, the surfaces of the leaves are immediately washed by clear water so as to remove residues. A second inoculation was performed one week later.

As a result, it was found that: after inoculation, soybean leaves with the GmST1 gene knocked out shrink, more mosaic phenomena appear, and a contrast soybean plant has no obvious change, as shown in figure 4, the method explains that the GmST1 gene has the base deletion in the target region (the nucleotide sequence is 5 'AGAAAGGGGAGGAAAATAA3'), so that functional amino acid is changed, and the resistance of a disease-resistant variety Dongnong 93-046 to mosaic viruses is weakened.

Respectively designing quantitative primers according to sequences of the GmST1 gene and the virus coat protein gene:

the GmST1 gene quantitative primer is as follows: a forward primer: qGmST1-S:5 'TCCCCTTTTCGGATTCATT-3' (SEQ ID NO: 12); reverse primer qGmST1-A: 5-; the quantitative primer of the virus coat protein gene SMV-CP (GenBank accession number: U25673.1) is as follows: a forward primer: SMV-CP-S: 5-: SMV-CP-A: 5.

The T2 generation plant of the inoculated mosaic virus is detected by utilizing a qRT-PCR method, and the result shows that the relative expression quantity of the GmST1 gene in the soybean leaf with the GmST1 gene knocked out is lower than that of a control variety, and the result is shown in figure 5. Based on the relative expression amount which is 2.5 times more than that of the contrast, 1 soybean mutant plant with mutation of GmST1 gene is obtained, and the mark is 2-1. Meanwhile, the relative expression quantity of the virus coat protein gene existing in the soybean leaf with the GmST1 gene knocked out is higher than that of a control variety. The fact that the GmST1 gene is knocked out can lead the variety Dongnong 93-046 resisting the soybean mosaic virus to generate certain susceptibility.

Example 2. Preparation of soybean GmST1 Gene mutant plants.

In this example, the preparation method of soybean GmST1 gene mutant plant was described by taking the second target as an example (target nucleotide sequence of 5 'cttcctagggagagagaggt 3') at bases 115 th to 132 th of the coding region of GmST 1.

The gene was obtained as described in example 1, based on the sequence of the GmST1 gene (SEQ ID NO: 1). A gRNA single-target primer was designed. The forward primer is GmST1-2-S,5' ttgCTTCCTAGGGAGAGAGGTT-.

2) Preparation of gRNA single target primer dimer.

The forward and reverse primers were mixed in the following proportions to form a dimer. GmST1-2-S/A (10. Mu.M) each 5. Mu.L, H ₂ After mixing O15. Mu.L, the following treatments were carried out: 3min at 95 ℃; slowly cooling at 95-25 deg.C; 5min at 16 ℃.

3) And inserting the primer dimer into a Cas9/gRNA vector to construct a GmST1 gene knockout vector, and marking as a GmST1-2 gene knockout vector.

The reaction system was as follows (10. Mu.l system): the reaction was carried out overnight at 16 ℃.

4) And (4) transforming the GmST1 gene knockout vector constructed in the step 3) into agrobacterium tumefaciens, infecting soybeans, and identifying to obtain soybean GmST1 gene mutant plants.

a, conversion: adding 10 μ l of the product into 50 μ l of TOP10 competence which is just thawed, flicking and uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 90S at 42 ℃, standing for 2min on ice, adding 500 μ l of LB without resistance, placing in se:Sub>A constant temperature shaking table at 37 ℃, carrying out 170 turns, recovering for 1h, coating se:Sub>A Kanse:Sub>A resistant solid plate, carrying out overnight culture at 37 ℃, picking 3-5 unilamellar shavings, carrying out PCR (polymerase chain reaction) of bacterial liquid and sequencing, wherein primers for PCR detection of the bacterial liquid are the same as CasJC-S and CasJC-A in example 1 as shown in figure 1. And comparing the sequencing result with the vector sequence, and storing the positive bacteria liquid at-80 ℃ for later use.

b. The stem tip of soybean was transformed by Agrobacterium tumefaciens mediated transformation, and the plant was obtained by culturing according to the transformation method described in b) in step 4) of example 1.

c. And (3) identifying mutant plants: and (3) taking se:Sub>A T1 generation leaf of the soybean plant with the GmST1 gene knocked out and se:Sub>A control (Dongnong 93-046) leaf, extracting DNA of the leaf, carrying out PCR identification, and finally identifying se:Sub>A transgenic plant with the GmST1-2 gene knock-out vector, wherein the target fragment (primers are the CasJC-S and the CasJC-A) is 435 bp. Collecting soybean seeds identified as transgenic plants in the T1 generation, sowing the soybean seeds, extracting leaf DNA, and carrying out PCR detection by using a single-target point mutation detection primer.

A forward primer: gmST1-target2-S: 5-;

reverse primer: gmST1-target2-A:5 'GACAATGGCAAAGGTGAGA-3' (SEQ ID NO: 11).

Amplifying a target fragment 324bp and sequencing the product, wherein the sequencing result shows that 3 transgenic positive plants have mutation at a target point, wherein the plants with the numbers of 3-1 and 3-3 have 2 base deletions compared with the wild type, and the plant with the number of 3-2 has 1 base deletion compared with the wild type, as shown in figure 6; as shown in fig. 7. The nucleotide sequence of the mutated GmST1 gene in the plant with the number of 3-1 is shown as SEQ ID NO:17, the nucleotide sequence of the mutated GmST1 gene in the plant with the number of 3-2 is shown as SEQ ID NO:18, and the nucleotide sequence of the mutated GmST1 gene in the plant with the number of 3-3 is shown as SEQ ID NO:19, respectively.

Soybean seeds identified as transgenic plants in the T1 generation were harvested and planted, and SMV N1 virus inoculation experiments were performed when the T2 generation plants fully developed the live leaves (the inoculation method was described with reference to example 1), and as a result, it was found that: after inoculation, soybean leaves with the GmST1 gene knocked out shrink, more mosaic phenomenon appears, and the contrast soybean plants have no obvious change, as shown in figure 4, the resistance of the GmST1 gene to mosaic virus of a disease-resistant variety Dongnong 93-046 is weakened after the nucleotide deletion of the target region (the nucleotide sequence is 5 'CTTCCTAGGGAGAGAGGGT 3').

the GmST1 gene quantitative primer is as follows: a forward primer: qGmST 1-S5 '-TCCCCTTTTCGGATTCATT-3' (SEQ ID NO: 12); reverse primer: qGmST 1-A5-.

The quantitative primer of the virus coat protein gene SMV-CP (GenBank accession number: U25673.1) is as follows:

a forward primer: SMV-CP-S: 5;

reverse primer: SMV-CP-A: 5.

The T2 generation plant of the inoculated mosaic virus is detected by utilizing a qRT-PCR method, and the result shows that the relative expression quantity of the GmST1 gene in the soybean leaf with the GmST1 gene knocked out is lower than that of a control variety, and the result is shown in figure 5. And 3 mutant soybean plants with mutation of the GmST1 gene are obtained by taking the relative expression quantity which is 2.5 times more than that of the contrast as a reference, and the relative expression quantity of the virus coat protein gene existing in the soybean leaves with the GmST1 gene knocked out is detected to be higher than that of the contrast variety. The fact that the GmST1 gene is knocked out can lead the soybean mosaic virus resistant variety Dongnong 93-046 to have certain susceptibility.

Nucleotide sequence listing

<110> northeast university of agriculture

<120> soybean GmST1 gene mutant plant and preparation method thereof

<130>

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 1035

<212> DNA

<213> Soybean GmST1 Gene

<400> 1

atggctccaa caaatgtcac atgcttcaga gaagaaaatg aatccgagaa aggggaggaa 60

ataacaatag aagaagacaa gctaagtcaa gaatgtaagg agttgatact ctctcttcct 120

agggagagag gttggagaac acgttatata tatctatttc aaggattttg gtgccagcca 180

ttggaaatcc aagcaataat cacttttcag aagcacttcc aagctaaaga cagtgatgtt 240

attgtggcca caattccaaa atcaggtacc acttggctga aagctctcac ctttgccatt 300

gtcaatcgcc atactcatag tatcactaca tcaatgtcat cacatccttt gcttacttct 360

aatcctcatg aacttgtgcc tttcatagaa tacaccgttt atggtaatgc ccctagccat 420

gttccaaacc tatccaacat gactgagcca agactttttg gtacacatat tccattccat 480

gcattggcca agtcaatcaa ggagttcaat agtagaataa tttatatatg taggaaccca 540

cttgacactt ttgtgtctac ttggattttc ctcaacaaaa ttaagccaga acatttacct 600

gaatttgaac taggggaagc ttttgaaaag tattgcaaag gaataatagg gtttggtcca 660

acttgggacc aaatgttggg ttattggaag gagagtatag ctaggcctag taaggttttg 720

ttcttgaagt acgaggatct taaaaaagat gtcaattttc atgtgaaaag aatagcggag 780

ttcttaggat ggcctttcac ttcggaggaa gaaggtgatg ggactattga gagcataatc 840

aagctatgca gcttcgagaa gatgaaggaa ttggaggcaa ataaatctgg aacatttgct 900

aggaactttg agagaaagta cttgttccga aaggctgaaa tgggagattg ggtgaactac 960

ctttcccctg aaatgggtga aaagttatcg caaattatgg aagaaaagtt aagtgggtca 1020

ggcttgtcat tttaa 1035

<210> 2

<211> 21

<212> DNA

<213> GmST1-1-S

<400> 2

ttgagaaagg ggaggaaata a 21

<210> 3

<211> 21

<212> DNA

<213> GmST1-1-A

<400> 3

aacttatttc ctcccctttc t 21

<210> 4

<211> 21

<212> DNA

<213> GmST1-2-S

<400> 4

ttgcttccta gggagagagg t 21

<210> 5

<211> 21

<212> DNA

<213> GmST1-2-A

<400> 5

aacacctctc tccctaggaa g 21

<210> 6

<211> 20

<212> DNA

<213> CasJC-S

<400> 6

aaaagtccca catcgcttag 20

<210> 7

<211> 20

<212> DNA

<213> CasJC- A

<400> 7

tgtgcaaggt aagaagatgg 20

<210> 8

<211> 20

<212> DNA

<213> GmST1-target1-S

<400> 8

gatcgaccat tagcactcta 20

<210> 9

<211> 21

<212> DNA

<213> GmST1-target1-A

<400> 9

tccttacatt cttgacttag c 21

<210> 10

<211> 21

<212> DNA

<213> GmST1-target2-S

<400> 10

agatcgacca ttagcactct a 21

<210> 11

<211> 19

<212> DNA

<213> GmST1-target2-A

<400> 11

gacaatggca aaggtgaga 19

<210> 12

<211> 20

<212> DNA

<213> qGmST1-S

<400> 12

tcccctttct cggattcatt 20

<210> 13

<211> 22

<212> DNA

<213> qGmST1-A

<400> 13

tgccaatcag tactagagat cg 22

<210> 14

<211> 20

<212> DNA

<213> SMV-CP-S

<400> 14

aggatccaaa gaagagcacc 20

<210> 15

<211> 21

<212> DNA

<213> SMV-CP-A

<400> 15

gcctttcagt attttcggag t 21

<210> 16

<211> 1034

<212> DNA

<213> 2-1 plant GmST1 gene mutation sequence

<400> 16

atggctccaa caaatgtcac atgcttcaga gaagaaaatg aatccgagaa aggggagaaa 60

taacaataga agaagacaag ctaagtcaag aatgtaagga gttgatactc tctcttccta 120

gggagagagg ttggagaaca cgttatatat atctatttca aggattttgg tgccagccat 180

tggaaatcca agcaataatc acttttcaga agcacttcca agctaaagac agtgatgtta 240

ttgtggccac aattccaaaa tcaggtacca cttggctgaa agctctcacc tttgccattg 300

tcaatcgcca tactcatagt atcactacat caatgtcatc acatcctttg cttacttcta 360

atcctcatga acttgtgcct ttcatagaat acaccgttta tggtaatgcc cctagccatg 420

ttccaaacct atccaacatg actgagccaa gactttttgg tacacatatt ccattccatg 480

cattggccaa gtcaatcaag gagttcaata gtagaataat ttatatatgt aggaacccac 540

ttgacacttt tgtgtctact tggattttcc tcaacaaaat taagccagaa catttacctg 600

aatttgaact aggggaagct tttgaaaagt attgcaaagg aataataggg tttggtccaa 660

cttgggacca aatgttgggt tattggaagg agagtatagc taggcctagt aaggttttgt 720

tcttgaagta cgaggatctt aaaaaagatg tcaattttca tgtgaaaaga atagcggagt 780

tcttaggatg gcctttcact tcggaggaag aaggtgatgg gactattgag agcataatca 840

agctatgcag cttcgagaag atgaaggaat tggaggcaaa taaatctgga acatttgcta 900

ggaactttga gagaaagtac ttgttccgaa aggctgaaat gggagattgg gtgaactacc 960

tttcccctga aatgggtgaa aagttatcgc aaattatgga agaaaagtta agtgggtcag 1020

gcttgtcatt ttaa 1034

<210> 17

<211> 1033

<212> DNA

<213> 3-1 plant GmST1 gene mutation sequence

<400> 17

atggctccaa caaatgtcac atgcttcaga gaagaaaatg aatccgagaa aggggaggaa 60

ataacaatag aagaagacaa gctaagtcaa gaatgtaagg agttgatact ctctcttcct 120

ggagagaggt tggagaacac gttatatata tctatttcaa ggattttggt gccagccatt 180

ggaaatccaa gcaataatca cttttcagaa gcacttccaa gctaaagaca gtgatgttat 240

tgtggccaca attccaaaat caggtaccac ttggctgaaa gctctcacct ttgccattgt 300

caatcgccat actcatagta tcactacatc aatgtcatca catcctttgc ttacttctaa 360

tcctcatgaa cttgtgcctt tcatagaata caccgtttat ggtaatgccc ctagccatgt 420

tccaaaccta tccaacatga ctgagccaag actttttggt acacatattc cattccatgc 480

attggccaag tcaatcaagg agttcaatag tagaataatt tatatatgta ggaacccact 540

tgacactttt gtgtctactt ggattttcct caacaaaatt aagccagaac atttacctga 600

atttgaacta ggggaagctt ttgaaaagta ttgcaaagga ataatagggt ttggtccaac 660

ttgggaccaa atgttgggtt attggaagga gagtatagct aggcctagta aggttttgtt 720

cttgaagtac gaggatctta aaaaagatgt caattttcat gtgaaaagaa tagcggagtt 780

cttaggatgg cctttcactt cggaggaaga aggtgatggg actattgaga gcataatcaa 840

gctatgcagc ttcgagaaga tgaaggaatt ggaggcaaat aaatctggaa catttgctag 900

gaactttgag agaaagtact tgttccgaaa ggctgaaatg ggagattggg tgaactacct 960

ttcccctgaa atgggtgaaa agttatcgca aattatggaa gaaaagttaa gtgggtcagg 1020

cttgtcattt taa 1033

<210> 18

<211> 1034

<212> DNA

<213> 3-2 plant GmST1 gene mutation sequence

<400> 18

atggctccaa caaatgtcac atgcttcaga gaagaaaatg aatccgagaa aggggaggaa 60

ataacaatag aagaagacaa gctaagtcaa gaatgtaagg agttgatact ctctcttcct 120

aggagagagg ttggagaaca cgttatatat atctatttca aggattttgg tgccagccat 180

tggaaatcca agcaataatc acttttcaga agcacttcca agctaaagac agtgatgtta 240

ttgtggccac aattccaaaa tcaggtacca cttggctgaa agctctcacc tttgccattg 300

tcaatcgcca tactcatagt atcactacat caatgtcatc acatcctttg cttacttcta 360

atcctcatga acttgtgcct ttcatagaat acaccgttta tggtaatgcc cctagccatg 420

ttccaaacct atccaacatg actgagccaa gactttttgg tacacatatt ccattccatg 480

cattggccaa gtcaatcaag gagttcaata gtagaataat ttatatatgt aggaacccac 540

ttgacacttt tgtgtctact tggattttcc tcaacaaaat taagccagaa catttacctg 600

aatttgaact aggggaagct tttgaaaagt attgcaaagg aataataggg tttggtccaa 660

cttgggacca aatgttgggt tattggaagg agagtatagc taggcctagt aaggttttgt 720

tcttgaagta cgaggatctt aaaaaagatg tcaattttca tgtgaaaaga atagcggagt 780

tcttaggatg gcctttcact tcggaggaag aaggtgatgg gactattgag agcataatca 840

agctatgcag cttcgagaag atgaaggaat tggaggcaaa taaatctgga acatttgcta 900

ggaactttga gagaaagtac ttgttccgaa aggctgaaat gggagattgg gtgaactacc 960

tttcccctga aatgggtgaa aagttatcgc aaattatgga agaaaagtta agtgggtcag 1020

gcttgtcatt ttaa 1034

<210> 19

<211> 1033

<212> DNA

<213> 3-3 plant GmST1 gene mutation sequence

<400> 19

atggctccaa caaatgtcac atgcttcaga gaagaaaatg aatccgagaa aggggaggaa 60

ataacaatag aagaagacaa gctaagtcaa gaatgtaagg agttgatact ctctcttcct 120

agggagaggt tggagaacac gttatatata tctatttcaa ggattttggt gccagccatt 180

ggaaatccaa gcaataatca cttttcagaa gcacttccaa gctaaagaca gtgatgttat 240

tgtggccaca attccaaaat caggtaccac ttggctgaaa gctctcacct ttgccattgt 300

caatcgccat actcatagta tcactacatc aatgtcatca catcctttgc ttacttctaa 360

tcctcatgaa cttgtgcctt tcatagaata caccgtttat ggtaatgccc ctagccatgt 420

tccaaaccta tccaacatga ctgagccaag actttttggt acacatattc cattccatgc 480

attggccaag tcaatcaagg agttcaatag tagaataatt tatatatgta ggaacccact 540

tgacactttt gtgtctactt ggattttcct caacaaaatt aagccagaac atttacctga 600

atttgaacta ggggaagctt ttgaaaagta ttgcaaagga ataatagggt ttggtccaac 660

ttgggaccaa atgttgggtt attggaagga gagtatagct aggcctagta aggttttgtt 720

cttgaagtac gaggatctta aaaaagatgt caattttcat gtgaaaagaa tagcggagtt 780

cttaggatgg cctttcactt cggaggaaga aggtgatggg actattgaga gcataatcaa 840

gctatgcagc ttcgagaaga tgaaggaatt ggaggcaaat aaatctggaa catttgctag 900

gaactttgag agaaagtact tgttccgaaa ggctgaaatg ggagattggg tgaactacct 960

ttcccctgaa atgggtgaaa agttatcgca aattatggaa gaaaagttaa gtgggtcagg 1020

cttgtcattt taa 1033

<210> 20

<211> 28

<212> DNA

<213> primer 1-S

<400> 20

gaagatctat ggctccaaca aatgtcac 28

<210> 21

<211> 29

<212> DNA

<213> primer 1-A

<400> 21

cttggttacc ttaaaatgac aagcctgac 29

Claims

1. The application of soybean GmST1 gene mutant plants in improving soybean mosaic virus infection diseases is characterized in that the mutant plants contain mutant soybean GmST1 genes, the mutation is that nucleotide sequences of 5 'AGAAAGGGGAGGAAATAAA 3' or 5 'CTTCCTAGGGAGAGGGT 3' in coding regions of the GmST1 genes are subjected to base substitution or deletion, so that the coded amino acid sequences are changed, and the nucleotide sequences of the soybean GmST1 genes are shown as SEQ ID NO:1 is shown in the specification; the nucleotide sequence of the mutated soybean GmST1 gene is shown as SEQ ID NO: 17. the amino acid sequence of SEQ ID NO:18 or SEQ ID NO: as shown at 19.