CN104450774A - Construction of soybean CRISPR/Cas9 system and application of soybean CRISPR/Cas9 system in soybean gene modification - Google Patents

Abstract

The invention relates to construction of a soybean CRISPR/Cas9 system. The construction disclosed by the invention is mainly characterized in that a core sequence is designed according to a target gene, and the core sequence is constructed into an expression carrier with cas9. The soybean CRISPR/Cas9 system utilizes the core sequence to identify the target gene, the cas9 shears the target gene, and various mutations can be generated in the process of repairing a broken chain by an organism. The invention also provides application of the soybean CRISPR/Cas9 system in soybean gene modification. With the adoption of the construction and the application provided by the invention, the constructed soybean CRISPR/Cas9 system is simple, the soybean gene can be rapidly and efficiently modified, and the problems of the traditional ZFNs system is too complex, wastes time and is low in efficiency are overcome.

Description

A kind of structure of soybean CRISPR/Cas9 system and the application in soybean gene is modified thereof

Technical field

The invention belongs to field of plant molecular biology, relate to a kind of system of rite-directed mutagenesis, particularly a kind of structure of soybean CRISPR/Cas9 system and the application in soybean gene is modified thereof.

Background technology

Carrying out pointed decoration to gene, is one of important method of biological research fields.Along with the reach of science, increasing silent technology development rapidly.Insert inactivation to zinc fingers (ZFs) and activating transcription factor sample effector nuclease (TALENs) rite-directed mutagenesis from the MES random mutagenesis of classics, T-DNA or transposon, these technology facilitate the process of research gene function all greatly.But because zinc refers to that rnase (ZFN) and activating transcription factor sample effector nuclease (TALENs) technology needs design specific restriction endonuclease for each goal gene, and building process is loaded down with trivial details, greatly limit its range of application.Compared with other silencing system, the advantage that CRISPR site-directed mutagenesis technique has it incomparable, to be widely used gradually and to study with gene site-directed modification.

CRISPR/Cas system finds the earliest in intestinal bacteria, is the acquired immune system of bacterium for foreign DNAs such as phages.The PAM that this system depends on the ribonucleoprotein complexes identification target sequence of crRNA and Cas albumen formation carries out specificity cutting to invasion phage or plasmid.CRISPR system mainly contains three types, and wherein II type system only needs a Cas9 albumen, crRNA and tracrRNA just can exercise its function.There are some researches show and crRNA and tracrRNA is integrated into the effect that sgRNA does not affect CRISPR/Cas9 system.In August, 2013, Nature Biotechnol periodical has been delivered first simultaneously three sections about CRISPR/Cas9 system be successfully applied to plant gene modify research.Afterwards, CRISPR/Cas9 system is widely used in Arabidopis thaliana, tobacco, paddy rice, Chinese sorghum, corn and wheat research, but CRISPR/Cas9 system is still blank out in soybean crops research.

Soybean [Glycine max (L.) Merr.] is one of important farm crop, is the main source of vegetable-protein and edible oil, nutritive value and economic worth higher.For studying gene function better, often need the transgenation carrying out specific site, and existing ZFNs system is too complicated, time-consuming and efficiency is low, greatly limit the application of the method.Therefore, develop a kind of CRISPR/Cas system for soybean, and be applied in soybean gene modify field seem particularly important.

Summary of the invention

The first object of the present invention is to provide a kind of structure of soybean CRISPR/Cas9 system, solve current soybean and there is no CRISPR/Cas system, and ZFNs system is too complicated, time-consuming and inefficient problem.

The second object of the present invention is to provide the application of above-mentioned soybean CRISPR/Cas9 system in soybean gene is modified.

The present invention is achieved through the following technical solutions:

One, a structure for soybean CRISPR/Cas9 system, the method comprises the following steps:

(1) cas9 is building up on pCambia3301 carrier;

(2) synthetic is with the sgRNAs of the special U6-10 promotor of soybean, with two BsaI restriction enzyme sites between the special U6-10 promotor of soybean and sgRNAs;

(3) according to soybean goal gene design core sequence, according to core sequence synthesis two ends with the primer of sticky end complementary sequence cutting rear formation with BsaI enzyme;

(4) fragment that step (2) is synthesized is connected into pUC57-Kan plasmid, after extracting plasmid, with BsaI restriction endonuclease complete degestion;

(5) core sequence with sticky end be combined into after primer annealing step (3) synthesized, the fragment after cutting with step (4) enzyme is connected;

(6) enzyme cut step (5) connect after plasmid, obtain object fragment and be building up on the pCambia3301 carrier with cas9, obtain pCas9-GmU6-sgRNA.

Two, the application of above-mentioned soybean CRISPR/Cas9 system in soybean gene is modified.

Adopt the positively effect of technique scheme: the soybean CRISPR/Cas9 system constructed by the present invention is simple, soybean gene is modified and can be completed fast and efficiently, overcomes existing ZFNs system too complicated, time-consuming and inefficient problem; And prove by experiment, soybean CRISPR/Cas9 system be combined with soybean cotyledon node root of hair method or soybean protoplast method, mutation rate is higher, advantageously in soybean gene, especially with the research of Soybean Root or root nodule genes involved function.

Accompanying drawing explanation

Fig. 1 is CRISPR/Cas9 carrier schematic diagram of the present invention;

Fig. 2 is that the CRISPR/Cas9 system that soybean protoplast method detects edits the gel electrophoresis figure of situation to Glyma06g14180;

In figure, M:marker; 1: CRISPR/Cas9 carrier is transferred to soybean protoplast after 48 hours, extract genomic dna, after Pst I complete degestion, pcr amplification Glyma06g14180 electrophoresis; After 2: leaves genomic DNA, Pst I complete degestions, pcr amplification Glyma06g14180 electrophoresis; 3: leaves genomic DNA, pcr amplification Glyma06g14180 rear electrophoresis;

Fig. 3 is that the CRISPR/Cas9 system that soybean protoplast method detects edits the gel electrophoresis figure of situation to Glyma08g02290;

In figure, M:marker; 1: CRISPR/Cas9 carrier is transferred to soybean protoplast after 48 hours, extract genomic dna, after BamH I complete degestion, pcr amplification Glyma08g02290 electrophoresis; After 2: leaves genomic DNA, BamH I complete degestions, pcr amplification Glyma08g02290 electrophoresis; 3: leaves genomic DNA, pcr amplification Glyma08g02290 rear electrophoresis;

Fig. 4 is that the CRISPR/Cas9 system that soybean protoplast method detects edits the gel electrophoresis figure of situation to Glyma12g37050;

In figure, M:marker; 1: CRISPR/Cas9 carrier is transferred to soybean protoplast after 48 hours, extract genomic dna, after EcoR I complete degestion, pcr amplification Glyma12g37050 electrophoresis; After 2: leaves genomic DNA, EcoR I complete degestions, pcr amplification Glyma12g37050 electrophoresis; 3: leaves genomic DNA, pcr amplification Glyma12g37050 rear electrophoresis;

Fig. 5 is that soybean cotyledon node induces the CRISPR/Cas9 system of root of hair method detection Glyma06g14180 to be edited to the gel electrophoresis figure of situation;

In figure, M:marker; Wt1: leaves genomic DNA, after pcr amplification Glyma06g14180, uses PstI restriction enzyme digestion and electrophoresis; Wt2: leaves genomic DNA, pcr amplification Glyma06g14180 fragment; 1-21: the Hairy root of induced synthesis, the genomic dna of extraction, after pcr amplification Glyma06g14180, with Pst I restriction enzyme digestion and electrophoresis; Wherein 4 and 7 is positive Hairy root.

Fig. 6 is that the CRISPR/Cas9 system that soybean cotyledon node root of hair method detects edits the gel electrophoresis figure of situation to Glyma08g02290;

In figure, M:marker; Wt1: leaves genomic DNA, pcr amplification Glyma08g02290 fragment; Wt2: leaves genomic DNA, after pcr amplification Glyma08g02290, with BamH I restriction enzyme digestion and electrophoresis; 1-21: the Hairy root of induced synthesis, the genomic dna of extraction, after pcr amplification Glyma08g02290, with BamH I restriction enzyme digestion and electrophoresis; Wherein 11,12,13,18 and 19 is positive Hairy root.

Fig. 7 is that the CRISPR/Cas9 system that soybean cotyledon node root of hair method detects edits the gel electrophoresis figure of situation to Glyma12g37050;

In figure, M:marker; Wt1: leaves genomic DNA, pcr amplification Glyma12g37050 fragment; Wt2: leaves genomic DNA, after pcr amplification Glyma12g37050, with EcoR I restriction enzyme digestion and electrophoresis; 1-21: the Hairy root of induced synthesis, the genomic dna of extraction, after pcr amplification Glyma12g37050, with EcoR I restriction enzyme digestion and electrophoresis; Wherein 1,5,8,14,19 is positive Hairy root.

Fig. 8 is the CRISPR/Cas9 system construction schematic diagram with the special U6-26 promotor of Arabidopis thaliana.

Embodiment

The source of biomaterial of the present invention:

1, carrier pH-Ubi-cas9-7:Targeted mutagenesis in rice using CRISPR-Cas system, JinMiao, Dongshu Guo, Jinzhe Zhang, Qingpei Huang, Genji Qin, Xin Zhang, Jianmin Wan, Hongya Gu, Li-Jia Qu, Cell Research (2013) 23:1233-1236, this carrier is given to the applicant of this patent by professor Qu Lijia;

2, carrier pCambia3301: be purchased from the sub-Bioisystech Co., Ltd of Beijing Geordie;

3, all primers are designed, designed and entrust the synthesis of three rich polygala root Bioisystech Co., Ltd.

Below in conjunction with embodiment and comparative example, technical scheme of the present invention is described further, but should not be construed as limitation of the present invention:

Embodiment 1

The present embodiment is for illustration of the building process of soybean CRISPR/Cas9 system.

(1) picking contains single bacterium colony of pCambia3301 plasmid, is inoculated in 50ml LB liquid nutrient medium, and adding that penicillin of card to final concentration in substratum is 100ng/ml, 37 DEG C, incubated overnight in 200 rotating speed shaking tables.

(2) bacterium colony is collected, by alkaline lysis method of extracting pCambia3301 plasmid, by spectrophotometric determination plasmid concentration, and by concentration adjustment to 200ng/ul.

(3) get 5ug pCambia3301 plasmid in step (2), spend the night with NcoI and PmlI enzyme (Fermentas) double digestion.

(4) by digestion products electrophoresis on 0.8% agarose gel, reclaim test kit (Tiangen) with glue purification and reclaim the large fragment DNA after pCambia3301 plasmid double digestion.Concentration adjustment is 50ng/ul by the pCambia3301 large fragment DNA concentration that spectrophotometric determination reclaims.

(5) the pH-Ubi-Cas9-7 plasmid provided with professor Qu Lijia, for template, to increase Cas9 gene with high-fidelity DNA phusion enzyme (NEB) and Cas9 special primer (Cas9-F:CATGccatggCCCCAAAGAAGAAGCGC and Cas9-RTCAATCGCCGCCGAGTTGTGA).

(6) by amplification Cas9DNA PCR primer purification kit (Tiagen) carry out purifying, by spectrophotometer by its concentration adjustment to 100ng/ul.

(7) carry out enzyme with NcoI enzyme (Fermenata) to Cas9DNA and cut through night, digestion products PCR primer purification kit (Tiagen) carries out purifying, by spectrophotometer by its concentration adjustment to 100ng/ul.

(8) fetch after the 100ng Cas9DNA coming from (7) mixes with the 100ng pCambia3301 large fragment DNA deriving from step (4), the T4DNA ligase enzyme adding 1 unit carries out 16 DEG C of connections and spends the night and form pCambia3301-Cas9 plasmid.

(9) the connection product of 2ul step (8) is got, mix with the DH10 β competent cell of 50ul, place 30 minutes on ice, 42 DEG C 90 seconds, add 800ul LB liquid nutrient medium, cultivate 50 minutes for 37 DEG C, 200 turns, 3000 leave the heart, remove supernatant, by in the substratum that is spread evenly across after resuspended for the DH10 β cell of precipitation containing that penicillin of 100ng/ml card, 37 DEG C of overnight incubation.

(10) picking list bacterium colony, carry out bacterium colony PCR with pCambia3301 primer (GATCCCTAAGCTTGGCAAGTTCC) and Cas9 gene primer (AGTTGGGCGATCAGATTCTC) and verify whether Cas9 is connected with pCambia3301, picking positive colony is in 50ml, blocking that penicillin to final concentration is in the LB liquid nutrient medium of 100ng/ml, 37 DEG C, incubated overnight in 200 rotating speed shaking tables.

(11) bacterium colony is collected, by alkaline lysis method of extracting pCambia3301-Cas9 plasmid, by spectrophotometric determination plasmid concentration, and concentration adjustment is for subsequent use to 200ng/ul.

(12) carry out the sgRNAs of synthetic with the special U6-10 promotor of soybean in Genscript company, this fragment, between EcoRI and the HindIII restriction enzyme site of pUC57-Kan plasmid, forms pUC57-GmU6-sgRNA plasmid.With two BsaI restriction enzyme sites between the special U6-10 promotor of soybean and sgRNAs; The combined action of two BsaI restriction enzyme sites, by restriction enzyme site sequence complete resection after making enzyme cut;

(13) alkaline lysis method of extracting pUC57-GmU6-sgRNA plasmid, regulates plasmid concentration for subsequent use to 100ng/ul with spectrophotometer.

(14) get the plasmid of preparation in 1ug step (13), cut through night with BsaI enzyme 37 DEG C of enzymes, carry out purifying with PCR primer purification kit (Tiagen), regulate plasmid concentration for subsequent use to 100ng/ul with spectrophotometer.

(15) according to soybean goal gene design core sequence complementary primer, core sequence synthesis two ends are with the sequence of sticky end complementation of cutting rear formation with BsaI enzyme.Get 1ug complementary primer respectively in 10ul TE, 90 DEG C 5 minutes, then cooling slowly complementary primer is matched formed with the double-stranded DNA of BsaI enzyme sticky end.

(16) get the double-stranded DNA of 1ug step (15) renaturation and the pUC57-GmU6-sgRNA plasmid of 100ng step (14), under the effect of T4DNA ligase enzyme, 16 DEG C of connections are spent the night.

(17) the connection product of 2ul step (16) is got, mix with the DH10 β competent cell of 50ul, place 30 minutes on ice, 42 DEG C 90 seconds, add 800ul LB liquid nutrient medium, cultivate 50 minutes for 37 DEG C, 200 turns, 3000 leave the heart, remove supernatant, by in the substratum that is spread evenly across after resuspended for the DH10 β cell of precipitation containing that penicillin of 100ng/ml card, 37 DEG C of overnight incubation.

(18) picking list bacterium colony, carries out colony PCR amplification checking Insert Fragment with M13F (cgccagggttttcccagtcacgac) and M13R (agcggataacaatttcacacagga) primer.The integrity of picking positive colony carries out checking order (three rich polygala root Bioisystech Co., Ltd) authentication sequence.

(19) clone that picking step (18) sequence is correct, being inoculated in 50ml, blocking that penicillin final concentration is in the LB liquid nutrient medium of 100ng/ml, 37 DEG C, incubated overnight in 200 rotating speed shaking tables.After alkaline lysis method of extracting plasmid, regulate plasmid concentration to 100ng/ul with spectrophotometer.

(20) get the pCambia3301-Cas9 plasmid DNA of 100ng step (11) and the pUC57-GmU6-sgRNA plasmid DNA of 100ng step (18), spend the night with EcoRI and HindIII enzyme (Fermentas) 37 DEG C of double digestions.Digestion products PCR primer purification kit (Tiagen) carries out purifying.

(21) enzyme getting equal-volume step (20) cuts purified product pCambia3301-Cas9 and pUC57-GmU6-sgRNA, adds T4DNA ligase enzyme, 16 DEG C of connections are spent the night.

(22) the connection product of 2ul step (21) is got, mix with the DH10 β competent cell of 50ul, place 30 minutes on ice, 42 DEG C 90 seconds, add 800ul LB liquid nutrient medium, cultivate 50 minutes for 37 DEG C, 200 turns, 3000 leave the heart, remove supernatant, by in the substratum that is spread evenly across after resuspended for the DH10 β cell of precipitation containing that penicillin of 100ng/ml card, 37 DEG C of overnight incubation.

(23) picking list bacterium colony, with pCambia3301 multiple clone site special primer Pdmsf:(GGCTCGTATGTTGTGTGGAA) and pDMSR:(GCCTCTTCGCTATTACGCC) carry out colony PCR amplification checking Insert Fragment.The positive colony obtained is pCas9-GmU6-sgRNA plasmid, and this plasmid is soybean CRISPR/Cas9 system.In this system, core sequence according to goal gene design is used for identifying purpose gene, cas9 is used for the NGG sequence in recognition sequence, in NGG upstream, 3-5bp place cuts, cause DNA chain break, and organism is in the process of DNA plerosis, can various mutations be produced, thus editor's modification is carried out to gene.

(24) the positive colony pCas9-GmU6-sgRNA in picking step (23), being inoculated in 50ml, blocking that penicillin final concentration is in the LB liquid nutrient medium of 100ng/ml, 37 DEG C, incubated overnight in 200 rotating speed shaking tables.After alkaline lysis method of extracting plasmid, regulate plasmid concentration for subsequent use to 1ug/ul with spectrophotometer.

Embodiment 2

The functional verification that the present embodiment is modified soybean gene for illustration of soybean CRISPR/Cas9 system.

Choose soybean three gene Glyma06g14180, Glyma08g02290 and Glyma12g37050 is research object, and primer composition sequence is as table 1:

Table 1: soybean goal gene design of primers

Owing to being the core sequence according to the design of soybean goal gene, thus the CRISPR/Cas9 system built, the core sequence therefore in CRISPR/Cas9 system can identify soybean goal gene, thus provides location for the modification editting function of cas9.In table 1, italic is restriction enzyme site, and runic is PAM sequence, namely NGG, cas9 cut from NGG upstream 3-5bp, therefore cut and just in time occur in restriction enzyme site place, proof test for the later stage is provided convenience condition, namely utilizes enzyme to cut test, just can find out whether there occurs sudden change.

According to these three gene constructed CRISPR/Cas9 systems being applicable to these three genes, detect the activity of CRISPR/Cas9 system respectively by soybean protoplast and cotyledonary node root of hair method.

One, soybean protoplast detects the activity of CRISPR/Cas9 system

(1) get fresh soyabean blade, after shredding, put into lysate (0.5%cellulose R10,0.5%macerozymeR10,0.1%pectolase Y23,0.6M mannitol, 10mM MES pH5.7,20mM KCl, 10mM CaCl2and 0.1%BSA).

(2) after mixing, vacuum filtration 30 minutes.

(3) cracking about 6 hours under 30rpm condition.

(4) filter with 100 μm of nylon membranes, centrifugal 3 minutes of 100g, collect supernatant liquor.

(5) isopyknic W5 solution (2mM MES pH5.7,154mM NaCI, 125mM CaCl is added ₂, 5mM KCl), slowly mix, ice bath 30 minutes.

(6) centrifugal 3 minutes of 100g, MMG solution (4mM MES pH5.7,0.4mM mannitol, 100mMCaCl ₂) resuspended, to be transformed.

Add the pCas9-GmU6-sgRNA plasmid DNA of 10 μ l cases 1 step (24) in the protoplast solution that (7) 100 μ l MMG are resuspended, add 110 μ l 40%PEG after mixing again, slowly mix.Left at room temperature 30 minutes.

(8), after drawing 800 μ l W5 solution rinsings, 1ml WI solution (4mM MES pH5.7,0.5mMmannitol, 20mM CaCl is added ₂), under room temperature condition, dark culturing 48 hours.

(9) collect protoplasm somatocyte, CTAB method extracts protoplastis genomic dna.

(10) the different restriction endonuclease (Glyma06g14180 of genomic dna will extracted, the restriction endonuclease that Glyma08g02290 and Glyma12g37050 is corresponding is respectively Pst I, BamHI and EcoRI) carry out complete degestion, with gene specific primer gene is increased, electrophoresis detection (Fig. 2-4).Result show, after the restriction enzyme site of gene is undergone mutation, restriction enzyme site disappear, with corresponding restriction endonuclease carry out enzyme cut time, the DNA of sudden change is global DNA, can carry out amplifying gene specific band with gene-specific primer; And contrast after DNA enzymatic cuts, owing to there is restriction enzyme site, gene DNA ruptures, and cannot amplify gene specific band with gene specific primer.

(11) PCR primer of step (10) be cloned on pEasy-T carrier (Transgene), picking positive colony carries out the site of sequence verification sudden change.Three gene editing situations of soybean protoplast method are shown in SEQ ID No.1-SEQ ID No.16.

Two, soybean cotyledon node induction root of hair method detects the activity of CRISPR/Cas9 system

(1) with disinfection by chlorine method process Williams 82 soybean seeds, by the planting seed of sterilization in the moist box of sterilizing, 25 DEG C, 16 little time/8 hours light culture 5 days.

(2) pCas9-GmU6-sgRNA and the pCas9-AtU6-sgRNA plasmid will built, be transformed in Agrobacterium rhyzogenesK599 by liquid nitrogen flash freezer method, the solidified MS media containing that penicillin of 100ng/ml card, 50ng/ml Streptomycin sulphate and 50ng/ml Spectinomycin resistance is cultivated 3 days for 28 DEG C.

(3) with the bacterium colony of the syringe needle picking step (2) of syringe, Agrobacterium K599 is directly inserted into the cotyledonary node hypocotyl place of the large bean seedlings of step (1) healthy growth.The high humidity infecting the large bean seedlings of K599 and be put in sealing is cultivated in box, 25 DEG C, 16 little time/8 hours light culture 2-3 weeks.

(4) when Hairy root is from cotyledonary node hypocotyl director to 5-10 centimetre, clip wall scroll Hairy root, CTAB method extracts Hairy root genomic dna.

(5) genomic dna gene specific primer is carried out gene amplification, the PCR primer of amplification is carried out enzyme with corresponding restriction endonuclease and is cut (Glyma06g14180, the restriction endonuclease that Glyma08g02290 and Glyma12g37050 is corresponding is respectively Pst I, BamHI and EcoRI) electrophoresis detection (Fig. 5-7).With soybean leaves genomic dna in contrast, result has three kinds of situations:

Show two bands: 3-5 base sequence of goal gene PAM upstream does not change or other nonanticipating sequence changes;

Only show a band: two sudden change.Because soybean is amphiploid plant, when genome sister chromosome is all undergone mutation, because restriction enzyme site changes, cause restriction endonuclease that enzyme cannot occur and cut effect, therefore show a band;

Show three bands: single mutation.Namely single mutation undergos mutation on item chromosome, and the another item chromosome of pairing does not suddenly change, and therefore, when enzyme is cut, item chromosome DNA can cut by enzyme, shows two bands, and another chromosomal DNA cannot be cut by enzyme, shows a band, totally three bands.

(6) reclaim with glue the DNA band that test kit (Tiagen) reclaims sudden change, be cloned on pEasy-T carrier (Transgene), picking positive colony carries out the site of sequence verification sudden change.As can be seen from the figure, each goal gene shows multiple catastrophe, and namely band differs.Statistics CRISPR/Cas9 system, to editor's situation of goal gene, refers to the gene fragment in sequence table, the soybean gene after the process of CRISPR/Cas9 system really there occurs such as lack, increase, the various mutations such as replacement.Three gene editing situations of soybean cotyledon node root of hair method are shown in SEQ IDNo.17-SEQ ID No.28.

Can illustrate, soybean protoplast method and soybean cotyledon node root of hair method, CRISPR/Cas9 system all can cause various mutations to goal gene, and mutation rate is high.

Comparative example

Adopt the method for embodiment 1, the same pCRISPR/Cas9 system built with the special U6-26 promotor of Arabidopis thaliana, is shown in Fig. 8.The soybean gene group that the pCas9-AtU6-sgRNA of structure obtains soybean protoplast method and these two kinds of methods of soybean cotyledon node root of hair method is equally carried out sudden change process, treatment process is the same.Found that,

The activity of pCas9-GmU6-sgRNA system is far above pCas9-AtU6-sgRNA system, and goal gene mutation rate, up to 20.2%, refers to table 2, illustrates that the system that present patent application builds is applicable to soybean gene editor modification.

Table 2 two kinds of systems carry out to three goal gene the results contrast processed that suddenlys change

Soybean CRISPR/Cas9 system constructed by the present invention is simple, modifies and can complete fast and efficiently, overcome existing ZFNs system too complicated to soybean gene, time-consuming and inefficient problem.

Claims (2)

1. a structure for soybean CRISPR/Cas9 system, is characterized in that: the method comprises the following steps:

(1) cas9 is building up on pCambia3301 carrier;

(2) synthetic is with the sgRNAs of the special U6-10 promotor of soybean, with two BsaI restriction enzyme sites between the special U6-10 promotor of soybean and sgRNAs;

(3) according to soybean goal gene design core sequence, according to core sequence synthesis two ends with the primer of sticky end complementary sequence cutting rear formation with BsaI enzyme;

(4) fragment that step (2) is synthesized is connected into pUC57-Kan plasmid, after extracting plasmid, with BsaI restriction endonuclease complete degestion;

(5) core sequence with sticky end be combined into after primer annealing step (3) synthesized, the fragment after cutting with step (4) enzyme is connected;

(6) enzyme cut step (5) connect after plasmid, obtain object fragment and be building up on the pCambia3301 carrier with cas9, obtain pCas9-GmU6-sgRNA.

2. the application of soybean CRISPR/Cas9 system according to claim 1 in soybean gene is modified.