CN102876674A - Maize flooding stress response zmERF5 gene promoter - Google Patents

Abstract

The invention relates to a maize flooding stress response zmERF5 gene promoter, belongs to the technical field of plant gene engineering and is characterized by disclosing a DNA sequence of the zmERF5 gene promoter. The promoter is characterized by comprising cis-elements, namely two AuxRR-Cores, a CE3, four CGTCA-motifs and two MBS sites, wherein the cis-elements are related to plant hormones and anaerobic stress responses. The promoter is a tissue-specific promoter only expressed in the root system and an inductive promoter efficiently expressed under flooding induction. The promoter is associated with target genes with insect resistance, disease resistance, adversity resistance and the like, so that the insect-resistant, disease-resistant and adversity-resistant capabilities of the roots of transgenic plants can be improved under flooding and waterlogging conditions. Meanwhile, the promoter is only expressed in the roots so that food safety problems cannot occur when the overground parts of the transgenic plants are eaten. The zmERF5 promoter has an excellent application prospect in the waterlogging-resistant genetic improvement of xerophilous plants.

Description

Corn flooding stress response zmERF5 gene promoter

Technical field:

The present invention relates to corn flooding stress response zmERF5 gene promoter, the platymiscium gene engineering technology field.

Background technology:

China is subjected to 9,560,000 hectares of the farmland area average out to of flood every year, and wherein the serious time, the disaster area reaches more than 1,500 ten thousand hectares.At Asia, flood has caused very large loss to the production of corn, South Asia only, and annual 15% the maize sown area of surpassing suffers in various degree harm.In India, flood causes the annual underproduction 25-30% of corn.Because of reasons such as the south China rainfall amount is abundant, irrigation and drainage system imperfections, the spring maize of low laying areas often suffers waterlogging stain evil, causes the corn Severe Reduction.Waterlogging stain evil has become one of main restrictive factor of south China corn with high yield, stable yields.Therefore, corn clone flooding stress responsive genes and promotor thereof to illustrating molecule mechanism that corn flooding stress response forms and the genetic improvement of corn and the waterlogging stain of other living crops of drought, have very important theory value and practice significance.

The ERF gene is one of key gene of involved in plant abiotic stress response, is the key gene of paddy rice, deep water rice and Arabidopis thaliana flooding stress response.Therefore, the promotor of corn clone ERF gene helps to illustrate the molecular mechanism that the corn waterlogging tolerance forms, and the genetic improvement of anti-stain for corn and the living crop of other droughts provides theoretical direction simultaneously.Yet the clone of corn ERF promotor at present, there is not yet report.

Summary of the invention:

The object of the present invention is to provide corn flooding stress response zmERF5 gene promoter, and the application of zmERF5 gene promoter in the plant genetic improvement of anti-the stain is provided.

Technical scheme of the present invention is:

1, the acquisition of corn zmERF5 gene

According to known Maize genome information, use the protein sequence of the AP2/ERF structural domain high conservative of tobacco ERF2 albumen, carry out the homology compare of analysis, electronic cloning goes out 121 ERF genes.By with the comparative analysis of the other plant ERF genes such as Arabidopis thaliana, paddy rice, tobacco, reject 48 false positives, obtained 73 ERF genes, respectively called after zmERF1--zmERF73.The waterlogging tolerance of corn inbred line Hz32 is stronger, and the Mo17 waterlogging tolerance a little less than, in 1 heart stage of corn 3 leaves, respectively to Hz32 and Mo17 carry out 0,4, the submerging treatment of 12h, and the expression that utilizes real-time PCR that 73 ERF genes are managed root system is throughout analyzed, found that the zmERF5 gene is expressed by the waterflooding inducement efficient at Mo17 and Hz32 root system, the result hints that also the promotor of zmERF5 gene is the inducible promoter of flooding stress response.

2, the extraction of the total DNA of corn inbred line Mo17 blade

Get maize leaf 5.0g and in liquid nitrogen, grind, change in the 50ml centrifuge tube.Add CTAB damping fluid (1.17MNaCL, 0.0016M EDTA-8.0,0.835M Ttis-7.5,1.6%CTAB, the 1% β-thin basic ethanol) 10ml that is preheated to 95 ℃, mixing.65 ℃ of water-bath internal reactions 90 minutes, jog centrifuge tube frequently.Take out centrifuge tube, after being chilled to room temperature, add the equal-volume chloroform: different alcohol (24: 1), carefully shook test tube 10 minutes.Centrifugal 10 minutes of 8000rpm goes to supernatant in another 50ml centrifuge tube.Add 2/3 volume Virahol, careful mixing changes flocculence DNA in the 50ml centrifuge tube of containing 10ml 70% ethanol over to, soaks 12 hours.Outwell 70% ethanol, DNA is dried, add 1ml TE dissolving.After DNA dissolves fully, change in the 2.0ml centrifuge tube, add 10 μ l 10mg/ml RNaseA, mixing; Under 37 ℃, incubation 2 hours.Use again 1ml phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting once, centrifugal 10 minutes of 8000rpm.Supernatant liquor is changed in the 2.0ml centrifuge tube, add the 3M NaAC (PH5.2) of 1/10 volume, 2/3 volume isopropanol precipitating DNA.Flocculence DNA is changed in the 2.0ml centrifuge tube, with 70% washing with alcohol once of short duration centrifugal, make DNA adherent, remove 70% ethanol, dry DNA.After DNA dries, add 0.5ml T.E solution, complete dissolving DNA is in-20 ℃ of prolonged preservation.

3, the clone of zmERF5 gene promoter

Promoter sequence according to corn inbred line B73 zmERF5 gene designs a pair of special primer, left primer: 5 ' TGGAAGCAAGGCCACACAACTAA 3 ', right primer: 5 ' TAAATTGAATTTTAGATGTTGCCT 3 '.Respectively with the DNA of Mo17, Hz32 as template, carry out pcr amplification.The pcr amplification reaction system is: 2.5 μ l, 10 * PCR damping fluid, 2 μ l 10mM dNTPs, 1 μ l 10mM special primer, the special right primer of 1 μ l 10mM, 1 Taq of unit enzyme, 40ng template DNA, cumulative volume 25 μ l.The pcr amplification program is: 95 ℃ 3 minutes; 95 ℃ 1 minute, 61 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, circulate 35 times; 72 ℃ 7 minutes; 4 ℃ 30 minutes.Pcr amplification product 120 volts of volts DS electrophoresis 45 minutes in 1% sepharose, use the gel of Beijing Quanshijin Biotechnology Co., Ltd to reclaim test kit, reclaim specific DNA fragment, and this dna fragmentation is connected on the pGEM-Teasy carrier, carry out dna sequencing.

4, the structure of conversion carrier

Use is with the primer (left primer adds the HindIII restriction enzyme site, and right primer adds the BamHI restriction enzyme site) of restriction enzyme site, carries out pcr amplification take the DNA of corn inbred line Mo17 as template.The PCR product is connected with pGEM-T easy carrier, Transformed E scherichia coli DH5 α, the White strain that is grown on the LB solid plate that contains penbritin, X-Gal and IPTG is separated.Detect through PCR, select positive colony to carry out dna sequencing, extract the correct plasmid DNA of zmERF5 promoter sequence of cloning.Use simultaneously digested plasmid of HindIII and BamHI restriction enzyme, 1% agarose gel electrophoresis reclaims the zmERF5 promoter fragment.Use HindIII and BamHI restriction enzyme while enzyme to cut the pBI121 plasmid vector, and reclaim carrier segments.ZmERF5 promoter fragment and pBI121 carrier segments are linked external, be built into the pBI121-zmERF5-GUS carrier, be transformed in the Agrobacterium GV3101 bacterial strain.

The zmERF5 gene promoter of cloning is carried out dna sequencing, and its dna sequence dna is as follows:

ZmERF5 gene promoter dna sequence dna

TGGAAGCAAGGCCACACAACTAAACATAAGTCTACAACGCTTCCACGCCAATGGCCTCAAAGGAAA

AAAGCAAGCACACATGTCAAAAAAAACTTATGCACAAGAACAAAAACGAGGAGCAAAAACAAAAAA

ACTGATACTCCCTCACCGGATCAACCATGTCAACACACGCTGGAGCCCCATCGCCGTGGGCTGGAG

CAGTAGAGCCACCCACTTCACCACAGCTCCTCCGCTGACAGCAAACATGGATCCCGTCAGAGCCAC

CTCCCCCTCCACAGCAACTCATCATGGACCAGCGCGAGATCAGGAAATCGCCACCGGGGAGCCGAC

TCCGCCACTATGCGTCACAGAAATCGCCTTCTCTCATCTCCTACCGGACAGCCCGCCGATCGCCAG

CAACACGAACAACACGAGCAGCAGAGAAAAAAAATCGCCGCCCCCTCCCCTGGATAGCCCGACGGC

TGCTAGCAACAGAGGAGTAGAAGAAATGGGGAGGGCGGAGACCTTGCCGGCAAACAGCAGCACGTC

GTGGGAAGCTTCGTCGGCCCTCGTTCTCAGTTCTCACGCATTCCAGAGGGCAGGGCGTTGGGGAAA

GTGAACAGACGCTCCGTCGCATTCCAGAGGGCAATGGTTGGGGAAAGTGAATAGCGCGCGGAAAGT

GAAAAGACGCCTGAGTAAAAAATCAAACAGTGCAATAGGGACCCTCTGTCAGCGACAGTAGACAAA

AAAATATCCAACAGATGAAAAAAAAGCATATGGCAGATCCAACGGTGCACAAACGTGGATGCGTAG

TCCAGTGCTTCTTCCGGTTGCTTGTTCTCAGCCTGAAATGCCTGCGCCGGGTTGGGGTAACAAGCC

TCTTTCGCTGTGTCGTCGCCGTGGTTGAAGAGCTGAGACGCGACGAACTTGTCGAGCACTAAAGGC

AGGAGGAGGAGGCTTGGGGCTCTCCACCAACCGAGGGCGCGCGAGAAGCCTTTGCTCAGGGAAACA

AACAGACAGACGCAACTCAGGATCGATAACTGACACTCGATTCCTTGAAGCGATGAAGTGGAGGCG

AGCATGAACCCTCGCGGGGAGGTAGCGGCGGAGGCATCTCGTCCCGACCACGGCGGGGACCATGAA

AGGGCGGCTCTGGGAGCTAGAGCTAGCCGTGCGCGCCGGCGTGATGGAGAGAGGGAAGCGCGGTCC

AGTAGAGCGAGTAGTGAGCGGTGGTAGAGCTGCTGGCTTGCCGGTAGAGCTGCTGGCTTAGCCAGT

GGTAGAGCTGCTGGCTTGCCGTGGTAGAGGCGATGGACCCGGCAGGGCGTTGGGAAGATGAACGGG

CGGTCAGTCGCATTCCAGAGAGTAAAGATGAAAGTGAACAGCGGAAAGCGAAAAGACGCAATAGGG

ACCCTCTGTCAAGCGACAGTAAACAGAGAAAAATATCCAATAGATGAAAAAGAGCATCCTGGAGAT

CCAACGGCGTACAAATCGAGTGAAAACAACAAGAGAAACACACGCGTGTCCGTTAGCTTTTTCCTT

TTTGTTTTATCAGTTTCGGTTCCTATAGTAAAAAGTTGGAGTCGTGCTAAACGGACCTTACAAACT

CCGTCAAGGCAACATCTAAAATTCAATTTA

5, turn the acquisition of zmERF5 promotor Arabidopis thaliana plant

The GV3101 Agrobacterium that will contain the pBI121-zmERF5-GUS carrier is inoculated in the LB liquid nutrient medium, and adding Rifampin and kantlex to final concentration is 100mg/L, 28 ℃ of shaking culture.Centrifugal collection thalline is used ddH ₂O is diluted to OD=0.8, and every 100ml bacterium liquid adds 5.0g sucrose and 50 μ l Silweet L-77.Use floral dip method is contaminated Arabidopis thaliana, gathers in the crops seed after the maturation, seed is broadcast containing on the MS solid screening culture medium of 100mg/L kantlex.The resistant plant that grows from screening culture medium is defined as turning zmERF5 promotor positive plant after PCR detects.

6, the detection of zmERF5 promoter activity

To turn the zmERF5 Arabidopis thaliana and carry out submerging treatment seedling stage, the transgenic arabidopsis seedling of normal growth and submerging treatment will be carried out the GUS histochemical stain.Found that, under the normal growth condition, turn root and the blade of zmERF5 promotor Arabidopis thaliana plant, the blueness of GUS dyeing do not occur; And under the flooding condition, the root that turns zmERF5 promotor Arabidopis thaliana presents stronger GUS blueness, and blade has no the GUS blueness.Studies show that the zmERF5 promotor is an organizing specific type promotor of expressing in root, also is the inducible promoter of a waterflooding abduction delivering simultaneously.

The present invention has following beneficial effect compared with prior art:

1, the zmERF5 promotor directly drives the transgenic plant of foreign gene, rapidly and efficiently starts foreign gene under the flooding condition in the great expression of plant root, can improve the waterlogging tolerance of plant, or the ability such as pest-resistant, disease-resistant.

2.zmERF5 promotor directly drives the transgenic plant of foreign gene, because foreign gene abduction delivering under flooding condition only, and expressive site only is confined to root, so for the transgenic plant of edible non-root, do not have Transgenic Food Safety Issue.

3, the zmERF5 promotor be the inducible promoter of abduction delivering under the flooding condition and only in the tissue-specific promoter of root specifically expressing, be the stronger strong promoter of startup ability.

Embodiment:

The zmERF5 promotor is cloned on the conversion carrier, connects thereafter a Tnos terminator, be built into a conversion carrier.The goal gene that transforms with correct direction, is cloned between zmERF5 promotor and the Tnos terminator, builds conversion carrier.Then by particle bombardment or agrobacterium co-cultivation mediated method goal gene is transformed in the recipient cell, obtains transfer-gen plant by technique means such as tissue culture.Under waterlogging stain, flooding condition, the zmERF5 promotor can start goal gene in plant root great expression.

Claims (3)

1. the corn flooding stress responds the zmERF5 gene promoter, it is characterized in that the dna sequence dna of zmERF5 gene promoter is:

TGGAAGCAAGGCCACACAACTAAACATAAGTCTACAACGCTTCCACGCCAATGGCCTCAAAGGAAA

AAAGCAAGCACACATGTCAAAAAAAACTTATGCACAAGAACAAAAACGAGGAGCAAAAACAAAAAA

ACTGATACTCCCTCACCGGATCAACCATGTCAACACACGCTGGAGCCCCATCGCCGTGGGCTGGAG

CAGTAGAGCCACCCACTTCACCACAGCTCCTCCGCTGACAGCAAACATGGATCCCGTCAGAGCCAC

CTCCCCCTCCACAGCAACTCATCATGGACCAGCGCGAGATCAGGAAATCGCCACCGGGGAGCCGAC

TCCGCCACTATGCGTCACAGAAATCGCCTTCTCTCATCTCCTACCGGACAGCCCGCCGATCGCCAG

CAACACGAACAACACGAGCAGCAGAGAAAAAAAATCGCCGCCCCCTCCCCTGGATAGCCCGACGGC

TGCTAGCAACAGAGGAGTAGAAGAAATGGGGAGGGCGGAGACCTTGCCGGCAAACAGCAGCACGTC

GTGGGAAGCTTCGTCGGCCCTCGTTCTCAGTTCTCACGCATTCCAGAGGGCAGGGCGTTGGGGAAA

GTGAACAGACGCTCCGTCGCATTCCAGAGGGCAATGGTTGGGGAAAGTGAATAGCGCGCGGAAAGT

GAAAAGACGCCTGAGTAAAAAATCAAACAGTGCAATAGGGACCCTCTGTCAGCGACAGTAGACAAA

AAAATATCCAACAGATGAAAAAAAAGCATATGGCAGATCCAACGGTGCACAAACGTGGATGCGTAG

TCCAGTGCTTCTTCCGGTTGCTTGTTCTCAGCCTGAAATGCCTGCGCCGGGTTGGGGTAACAAGCC

TCTTTCGCTGTGTCGTCGCCGTGGTTGAAGAGCTGAGACGCGACGAACTTGTCGAGCACTAAAGGC

AGGAGGAGGAGGCTTGGGGCTCTCCACCAACCGAGGGCGCGCGAGAAGCCTTTGCTCAGGGAAACA

AACAGACAGACGCAACTCAGGATCGATAACTGACACTCGATTCCTTGAAGCGATGAAGTGGAGGCG

AGCATGAACCCTCGCGGGGAGGTAGCGGCGGAGGCATCTCGTCCCGACCACGGCGGGGACCATGAA

AGGGCGGCTCTGGGAGCTAGAGCTAGCCGTGCGCGCCGGCGTGATGGAGAGAGGGAAGCGCGGTCC

AGTAGAGCGAGTAGTGAGCGGTGGTAGAGCTGCTGGCTTGCCGGTAGAGCTGCTGGCTTAGCCAGT

GGTAGAGCTGCTGGCTTGCCGTGGTAGAGGCGATGGACCCGGCAGGGCGTTGGGAAGATGAACGGG

CGGTCAGTCGCATTCCAGAGAGTAAAGATGAAAGTGAACAGCGGAAAGCGAAAAGACGCAATAGGG

ACCCTCTGTCAAGCGACAGTAAACAGAGAAAAATATCCAATAGATGAAAAAGAGCATCCTGGAGAT

CCAACGGCGTACAAATCGAGTGAAAACAACAAGAGAAACACACGCGTGTCCGTTAGCTTTTTCCTT

TTTGTTTTATCAGTTTCGGTTCCTATAGTAAAAAGTTGGAGTCGTGCTAAACGGACCTTACAAACT

CCGTCAAGGCAACATCTAAAATTCAATTTA。

2. corn flooding stress according to claim 1 response zmERF5 gene promoter is characterized in that described promotor clones acquisition from corn inbred line Mo17.

3. corn flooding stress response zmERF5 gene promoter according to claim 2 is characterized in that the zmERF5 promotor can start goal gene in plant root great expression under waterlogging stain, flooding condition.