CN108342396B

CN108342396B - Application of corn gene ZmEREB180 in plant stain resistance

Info

Publication number: CN108342396B
Application number: CN201810332909.5A
Authority: CN
Inventors: 邱法展; 余锋; 梁昆; 方甜
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2018-04-13
Filing date: 2018-04-13
Publication date: 2020-12-08
Anticipated expiration: 2038-04-13
Also published as: CN108342396A

Abstract

The invention belongs to the field of agriculture and biotechnology, and particularly discloses application of a corn gene ZmEREB180 in stain resistance of plants, wherein the applicant identifies that ZmEREB180 is obviously associated with the stain resistance of corn seedlings through candidate gene association analysis, further identifies excellent alleles through re-sequencing and expression analysis, and over-expresses ZmEREB180 in arabidopsis thaliana and corn to confirm the stain resistance function. The invention provides genetic mechanism of corn seedling-stage water-logging tolerance, discovers allele with excellent water-logging tolerance in seedling stage, and provides gene resource and theoretical guidance for genetic improvement of corn water-logging tolerance.

Description

Application of corn gene ZmEREB180 in plant stain resistance

Technical Field

The invention belongs to the field of agriculture and biotechnology, and particularly relates to application of a corn gene ZmEREB180 in plant stain resistance.

Background

Waterlogging disasters occur more and more globally with changing global climate (Bailey-Serre et al, 2012 a). Particularly in the last decade, the number of waterlogging events has increased significantly in asia, europe and africa. In the united states, crop yield losses due to flood disasters are second only to drought stress in the last 12 years, which becomes the second largest abiotic stress factor for crops second only to drought (Bailey-Serres et al 2012 b). Corn is the crop with the widest planting range worldwide, and the yield of corn is also influenced by various abiotic adversity stress factors. In asian regions, waterlogging disasters are one of the important abiotic stress factors that limit corn yield. Only in southern and southeast asia regions, over 18% of maize planting area is frequently affected by waterlogging stress (Zaidi et al, 2010), with approximately 25-30% of yield loss per year due to waterlogging disasters (Sarkar et al, 1998). China maize production areas are also susceptible to waterlogging disasters, and summer maize in Huang-Huai-Hai areas and spring maize in Yangtze river watersheds are most seriously stressed by waterlogging. The rainfall in the Huang-Huai-Hai region generally accounts for 60-70% of the whole year in summer, and the rainfall time is relatively concentrated in a short time after sowing, so that the seedling stage is easily stressed by waterlogging, and the growth, development and yield of the corn are further influenced (Yuweidong 2013). In the middle and lower reaches of Yangtze river basin, the corn seedling stage is often in low-temperature spring rain, and the flowering stage is easy to be in continuous plum rain, so that the high yield and the stable yield of the corn in the south are seriously influenced.

The traits related to the maize waterlogging tolerance are mainly expressed as adaptive traits of the maize, such as the formation of adventitious roots and ventilated tissues (Mano et al 2006b) and the like, which can improve the survival capability of the maize under the waterlogging stress condition. The japanese Mano laboratory has made much work in the genetic mapping of maize resistance to seed-length: mano et al (2005a, 2005B) utilize F constructed by hybridization of maize inbred line B64 with teosinte and hybridization of two maize inbred lines B64 and Na4₂The segregation population co-localizes QTL related to the formation of adventitious roots under the stress of waterlogging on 8 th chromosome 8.05 bin; f constructed by using two maize inbred lines F1649 and H84₂The population maps QTL associated with resistance to waterlogging under redox soil conditions to the first chromosome 1.03-1.04bin (Mano et al 2)006a) (ii) a F hybridized by maize inbred line and teosinte₂The population (Mano et al 2008; Mano et al 2007; Mano et al 2012) and the high generation backcross population in which the inbred line Mi29 was hybridized with teosintes (Mano and Omori 2008) located QTLs that control the formation of airway tissues on 8 chromosomes except for the 4 th and 6 th chromosomes; f is constructed by hybridizing a maize deep-root inbred line B73 and shallow-root teosintes₂Segregating populations, mapping QTLs associated with control of root angle to 4 chromosomes, 2, 4, 7 and 10 (Omori and Mano 2007); using the crossing of maize inbred line Mi29 and teosinte, a population of 45 introduced lines with Mi29 as background was constructed, the major QTL for maize sterility was located on chromosome 4.07-4.08bin, and the introduced line material containing this QTL was directly used for genetic improvement in maize sterility (Mano and Omori 2013). Qiu et al (2007) of Huazhong agriculture university crop genetic improvement national emphasis laboratory corn team constructs F by using corn inbred line HZ32 with strong stain tolerance and stain tolerance sensitive inbred line K12₂And (3) separating a population, and positioning the QTL related to the maize seedling stage waterlogging tolerance in three main QTL dense areas of 4 th, 7 th and 9 th under two different environments. Osman et al (2013) further investigated the dynamically expressed QTL after the population waterlogging stress, where 6 QTL's were expressed in both stages, and 7 EST and microRNA genes co-localized with the dynamically localized QTL on the 1 st, 4 th, 6 th, 7 th and 9 th chromosomes. Zhang et al (2013) identified 4 significantly related SNP sites on three

chromosomes

5, 6 and 9 in total by using a related population of 144 maize inbred lines, wherein one SNP site is located right in a QTL interval located by a high-generation backcross population. India Zaidi et al (2015) used the RIL population to localize 5 yield-tolerant QTLs on 5

chromosomes

1, 3, 5, 7 and 10 accounting for approximately 30% of phenotypic variation.

In view of the complexity of the trait phenotype after waterlogging stress, no corn tolerance gene has been cloned by scientific researchers to date. Therefore, the genetic mechanism of the maize seedling-stage stain resistance is researched, alleles with excellent stain resistance in the seedling stage are discovered, and gene resources and theoretical guidance are provided for genetic improvement of the maize stain resistance.

Disclosure of Invention

Aiming at the problems, the invention provides the application of a corn gene ZmEREB180 in plant stain resistance, wherein the CDS sequence of the Zm EREB180 gene is shown in SEQ ID NO.1, and the gene can be obviously enhanced in the stain resistance by over-expressing in corn and arabidopsis thaliana, so that the gene can be used for preparing a stain-resistant transgenic plant.

The invention also aims to provide a specific primer designed in the ZmEREB1805' -UTR region of a corn gene, and the primer can be used for breeding and screening the stain-resistant corn.

In order to achieve the purpose, the invention is realized by the following technical scheme:

in the research, the ZmEREB180 is obviously associated with the seedling-stage stain resistance of the corn through candidate gene association analysis, and the excellent allele is further identified through re-sequencing and expression analysis. Over-expression of ZmEREB180 in Arabidopsis and maize confirmed its stain tolerance function.

The application of the corn gene ZmEREB180 in the stain resistance of plants comprises the step of performing over-expression on the ZmEREB180 in plants by utilizing a conventional mode in the field, so that the stain resistance of the plants can be obviously enhanced;

the plant is preferably selected from corn and arabidopsis thaliana.

The specific primer designed aiming at the corn gene ZmEREB1805' -UTR region is F: GCAAAACTAAGACTTTCTCTAGCA, R: TGTGCCCTGTGTATTTTTCGACA, the application in corn breeding comprises detecting the specific sequence in the corn to be detected by using the conventional mode in the field, and then screening the stain-resistant corn.

Further details are provided in the detailed description of the preferred embodiments.

Compared with the prior art, the invention has the following advantages:

the candidate gene ZmEREB180 capable of controlling the maize seedling-stage stain resistance is found through correlation analysis, and is the first cloned gene influencing the maize seedling-stage stain resistance; resequencing and expression analysis show that the gene expression quantity is influenced by the 5' -UTR variation of the ZmEREB180 gene, so that the survival rate phenotype is influenced, and the over-expression genetic transformation of arabidopsis thaliana and corn proves that the gene can enhance the seedling-stage stain resistance of arabidopsis thaliana and corn.

Drawings

FIG. 1 is a schematic diagram showing the correlation between ZmEREB180 gene expression level and phenotype;

a: and (3) analyzing the correlation between the relative expression amount and the plant survival rate of the ZmEREB180 under the conditions of normal moisture (control), short-term waterlogging treatment (4h) and long-term waterlogging treatment (3 d).

B: comparison of relative expression of ZmEREB180 between Hap1 and Hap2 under normal moisture (control), short-term waterlogging (4h) and long-term waterlogging (3d) conditions

FIG. 2 is a schematic diagram showing the analysis of over-expression of ZmEREB180 gene in Arabidopsis thaliana;

wherein: a: RT-PCR detects the expression difference of ZmEREB180 in Arabidopsis Wild Type (WT) and over-expression strains OE5 and OE8, and the expression patterns of 3-week-old seedlings before (0h) and after (4h) flooding are analyzed;

b: arabidopsis thaliana and transgenic 35S, ZmEREB180 Arabidopsis thaliana plants are completely submerged for 10 days to recover the phenotype difference after 9 days of growth;

c: recovering the difference of the phenotype of the overground part after 9 days of growth;

d: recovering the fresh weight difference of the overground part after 9 days of growth;

e: expression patterns of four anaerobic response marker genes of arabidopsis (AtADH1, AtPDC1, AtSUS1, and AtSUS4) in WT, O E5, and OE8 were analyzed.

FIG. 3 is a schematic diagram of analysis of phenotypic differences after water stress of ZmEREB180 transgenic maize overexpressing water;

wherein: a: analyzing expression patterns of ZmEREB180 in root systems of different time periods before and after C01, OE115 and OE240 waterlogging water treatment;

b: c01, OE115 and OE240 phenotype difference after 15 days of waterlogging treatment;

c: the morphological differences of root systems and overground parts of C01, OE115 and OE240 after the waterlogging treatment is carried out for 15 days;

d: the length of the longest root system of C01, OE115 and OE240 after 15 days of waterlogging treatment;

e: the fresh weight of the aerial parts of C01, OE115 and OE240 after the waterlogging treatment for 15 days;

f: the number of C01, OE115 and OE240 Adventitious Roots (AR) after 15 days of waterlogging treatment;

g: c01, OE115 and OE240 are longest in Adventitious Root (AR) length after 15 days of waterlogging treatment;

h: average length of C01, OE115 and OE240 Adventitious Roots (AR) 15 days after waterlogging treatment;

statistical analysis one-way anova was used, and the letters a and b represent the significance of the difference for multiple tests.

FIG. 4 is a phenotypic difference analysis of survival for Hap1 and Hap 2.

Detailed Description

The technical scheme of the invention is a conventional scheme in the field if not specified; the reagents or materials, if not specifically mentioned, are commercially available.

Example 1:

obtaining a corn stain-resistant gene ZmEREB 180:

1) and (3) correlation analysis of candidate genes of the corn stain resistance gene:

in 368 maize related populations with extensive genetic variation, 525105 high-quality SNP markers were obtained by transcriptome sequencing, and from them 19 polymorphic markers of the ERF gene of the seventh subfamily (ZmERF-VIIs) were obtained, with an average of 31.95 polymorphic SNPs for the 19 genes (Table 1). Candidate gene association analysis was performed using tassel3.0 software with Q and K as covariates, in combination with genotype and survival phenotype. Setting two thresholds, p respectively, for the correlation analysis result<1.0E-2 and p<1.0E-3(Table 1). At p<Under the condition of a threshold value of 0E-2, ZmEREB180 can detect the sites with significant association in EXP1, EXP2, EXP3 and BLUP, ZmEREB179 can detect the sites with significant association in EXP1, EXP3 and BLUP, ZmEREB7, ZmEREB14, ZmEREB102, ZmEREB181, ZmE REB182 and ZmEREB202 can detect the sites with significant association only in a single environment, and other genes are the sites with significant association. However, at p<Under the 1.0E-3 threshold condition, only ZmEREB180 could still detect the significantly associated sites in EXP1, EXP2, EXP3 and BLUP. Therefore, ZmEREB180 is likely to be associated with flooding resistance during the corn seedling stage. In the B73 reference genome, ZmEREB180 gene V3 version is numbered GRMZM2G018984, V4 version is numbered Zm00001d027925 (ZmEREB)www.maizegdb.org)。

TABLE 1 correlation analysis of natural variation of ZmERFVIIs Gene in maize diverse natural populations with seedling stage stain resistance

The phenotype identification method of the associated population comprises the following steps:

to identify the survival rate of the respective cross-bred lines after the waterlogging treatment, 3 experimental phenotypic identifications of the related population were performed in the greenhouse (average temperature about 28 ℃) of university of agriculture in Huazhong in 5-9 months 2014. The pot test was grown as described by the method of Qiu's Fall et al (2007) and normal moisture management was performed during the seedling stage. 3 barrels of each inbred line are planted, namely 3 biological replicates are planted, and seedlings are thinned to 10 plants before each barrel is flooded. And (4) beginning flooding treatment of the seedlings in 2-leaf 1-heart stage (the seedling age is about 7d), and keeping the water layer to be 2-3 cm. In order to ensure the relative consistency of the data of each experiment, the survival rate phenotype data is recorded by taking the survival rate of the maize inbred line B73 as a reference, and when the survival rate of B73 is 50%, the survival rate of other inbred lines is recorded. Survival was calculated as the number of surviving strains divided by the total number of strains. And (3) performing optimal linear unbiased estimation analysis (BLUP) on the phenotype mean values under three environments by using a general linear model to obtain the BLUP phenotype value of each inbred line.

The candidate gene association analysis method comprises the following steps:

SNP information of the ZmE RF-VIIs gene is extracted as a genotype according to 50 ten thousand SNP marker information of a related group by using a phenotype mean value and a BLUP value under a single environment, and candidate gene association analysis ((Li et al, 2013; Wen et al, 2014)) is carried out by using Q and K as covariates by combining phenotype data and using Tassel3.0 software.

2) ZmEREB180 resequencing assay

To identify the DNA polymorphic sites of ZmEREB180, 248 inbred lines were randomly selected among 368 inbred line-related populations for resequencing analysis. The total length of the sequencing sequence is 3.1Kb, and the sequence comprises a ZmEREB180 promoter region 1.1Kb and a gene region 2 Kb. After sequence alignment analysis, 58 SNPs sites and 29 InDels (insertion and d-elongation) sites are identified. Combining the 87 polymorphic markers with the BLUP phenotype, MLM models were selected and the significance p-value between each locus and phenotype and LD-value between each marker was calculated using tassel3.0 with Q and K as covariates. The results showed that 7 significantly associated sites were identified in total, including 4 InDels (InDel-241, InDel-196, InDel-77, InDel-19 and InDel214) and 2 SNPs (SNP-118 and SNP-78). InDel-241, InDel-196, InDel-77, InDel-19, SNP-118 and SNP-78 are all located in 5' -UTR, and InDel214 is located in the first exon and is a three-base GGC deletion, and does not cause the frame shift mutation of amino acid. These significantly associated sites have a complete LD status. Inbred lines were divided into two different haplotypes, Hap1 and Hap2, based on the LD status of seven significant association sites. The survival rate phenotype of the Hap1 is obviously higher than that of the Hap2, and the Hap1 is a localized gene with strong stain resistance. Representative selfs for Hap1 are JIAO51 and CML69, and for Hap2 are K12, LY042 and 835B.

ZmEREB180 resequencing analysis method:

280 inbred lines were randomly selected from the related population for re-sequencing analysis. Gene specific primers are designed according to a B73 reference genome, a 2Kb segment and a 1.1Kb segment of a promoter region of ZmEREB180 are amplified, and the sequences of different inbred lines in related populations are obtained through PCR product sequencing. For efficient amplification and sequencing, the entire sequence was divided into 3 segments for amplification, with the following primer sequences:

first stage F/R: CAGCAACACGAACAACACGA/GTCCGTTTAGCACGACTCCA

Second stage F/R: CCAACGGCGTACAAATCGAG/AAGTTGACCTTGGCCTTGCT

Third stage F/R: GCCCGTCTTGTGTATAGCCC/GCATTTGGATCGGAACGCTT

Sequences are arranged and subjected to multi-sequence alignment by CLCsequence View software, SNP sites with minimum allele frequency more than 0.05 and InDel are extracted by Tassel3.0 software, and then association analysis of candidate segments is carried out by using the Tassel3.0 software and Q and K as covariates and adopting an MLM (multi-level modeling language) model and combining BLUP phenotypic data.

Correlation analysis of ZmEREB180 gene expression quantity and phenotype

Since ZmEREB180 has 4 InDels and two SNPs variation in the 5'-UTR region, i.e., there are two haplotypic materials of Hap1 and Hap2 (the 5' -UTR sequence of Hap1 is shown in SEQ ID NO.2, and the nucleotide sequence of the 5'-UTR region of Hap2 is shown in SEQ ID NO. 3), it is hypothesized that the 5' -UTR variation may affect the expression level of the gene. In 248 inbred lines of resequencing, 100 inbred line materials are randomly selected, waterlogging water treatment is carried out in two leaves and one heart, genotype material root system RNA before waterlogging water treatment (control), short-term waterlogging water treatment (4h) and long-term waterlogging water treatment (3d) is extracted, and the expression quantity of ZmEREB180 is analyzed. qRT-PCR analysis of 300 RNA samples shows that ZmEREB180 expression level and plant survival rate are in obvious positive correlation under 4h and 3d waterlogging water treatment conditions, but the correlation is not obvious under control conditions (A in figure 1). This result indicates that enhanced ZmEREB180 expression contributes to the waterlogging tolerance of maize inbred lines. Furthermore, ZmEREB180 had a relatively high expression level in Hap1 genotype material regardless of the presence of stress treatment, with the difference being more pronounced after 4h treatment (fig. 1B). According to the results, the sequence variation in the 5'-UTR is shown to influence the expression of ZmEREB180, so that the resistance of the maize inbred line to waterlogging stress is different, and according to the sequence characteristics of the 5' -UTR, molecular markers are developed on two sides of the variation sequence and are named as InDel59, and the markers can be used for screening the waterlogging resistance of genetic materials.

The molecular marker primers designed for InDel59 were as follows:

F：GCAAAACTAAGACTTTCTCTAGCA

R：TGTGCCCTGTGTATTTTTCGACA。

example 2:

the application of the corn ZmEREB180 gene in the stain resistance of arabidopsis thaliana is as follows:

ZmEREB180 overexpression analysis in Arabidopsis

To analyze whether the ectopic expression of ZmEREB180 can enhance the resistance of waterlogging stress, 35S constitutive expression promoter is utilized to over-express ZmEREB180 in Arabidopsis and carry out the flooding-resistant phenotype identification. By genetic transformation, a total of 13 positive transformation events were obtained (OE1-OE 13). High-expressing amounts of OE5 and OE8 were selected for phenotypic experiments, and wild-type (WT) was used as control. ZmEREB180 was clearly overexpressed in both OE5 and OE8, and flooding stress was able to significantly enhance its expression (fig. 2 a). Arabidopsis seedlings grown for 3 weeks, with no significant difference in vigor between WT and OE5 and OE 8; after 10 days of total flooding, growth was restored for 9 days, OE5 and OE8 were able to restore normal growth, whereas WT appeared as a weak wilting (B, C in FIG. 2), and the fresh weight of the aerial parts of OE5 and OE8 was significantly higher than WT (D in FIG. 2). Further analysis of the expression patterns of four anaerobic response marker genes (AtADH1, AtPDC1, AtSUS1 and AtSUS4) of Arabidopsis thaliana in WT, OE5 and OE8 shows that the over-expression of ZmEREB180 plants can enhance the expression of the anaerobic response marker genes after flooding stress. These results indicate that overexpression of ZmEREB180 can enhance the flooding resistance of Arabidopsis thaliana.

The construction method of the over-expression vector comprises the following steps:

the ZmEREB180 Arabidopsis thaliana overexpression vector is constructed by a homologous recombination method, and the specific operation flow is carried out according to a Kit Clonex pressure II/One Step Clone Kit (Vazyme). The super expression vector promoter is a 35S constitutive expression promoter, a single-enzyme digestion linearized plasmid is selected, and the enzyme digestion site is SmaI (CCCGGG). The complete CDS (coding sequence) sequence of ZmEREB180 in B73 (shown in SEQ ID NO. 1) was amplified from the T vector and subjected to recombination reaction according to the kit instructions, and the sequences of homologous recombination primers were as follows:

F：TCGACTCTAGAGGATCCCCGGGATGTGCGGAGGCGCCATC

R：AATTCGAGCTCGGTACCCCGGGTCAGAAAACAGAACCGTCGACG

transforming the recombinant product into escherichia coli; selecting monoclonal bacterial plaque, carrying out PCR identification, and then sending the bacterial plaque to a company for sequencing; comparing the sequencing results, selecting correct monoclone, shaking the bacteria, expanding and propagating to extract plasmid, and using the plasmid in the genetic transformation of arabidopsis thaliana.

Construction of the agrobacterium binary vector:

1) adding about 1 mu g of recombinant plasmid DNA into 50 mu l of competent cells, uniformly mixing, and carrying out ice bath for 30 min;

2) transferring into an electric shock cup (precooling at-20 degrees);

3) under the voltage of 15-20Kv/cm, the time constant is 4.5-5.0 ms;

4) after the electric shock is finished, adding 400 mul LB liquid culture medium (without antibiotics) and lightly blowing and uniformly mixing, transferring the bacterial liquid into a 1.5ml centrifuge tube, and recovering for 1-2h by a shaking table at 37 ℃ and 180 rpm;

5) the supernatant was centrifuged off at 350. mu.l, and the bacterial suspension was applied to LB plate containing 50. mu.g/ml Kanamycin + rifampicin and cultured at 28 ℃ for 1.5 to 2 days until a single colony was formed.

The flow of transforming arabidopsis by inflorescence infection method:

1) the arabidopsis thaliana is planted in a light incubator, and the culture conditions are as follows: keeping the temperature at 22 deg.C, day and night time at 13 and 11 hr, respectively, and humidity at 60%. When the number of buds is large in the full-bloom stage of Arabidopsis, transformation is carried out by infecting inflorescences. Soil needs to be soaked one day ahead before the arabidopsis is planted or transplanted, and sufficient water needs to be added in the soil soaking process. Nutrient soil and vermiculite 1: 1 proportion, and the nutrient soil and the vermiculite are required to be sterilized.

2) Tens of wild type Arabidopsis thaliana were planted in large pots (10 cm. times.10 cm) and transplanted after they had grown into young seedlings, 5 of them were transplanted per pot (they were not grown and replanted because their roots would be entangled, they were not easy to transplant and they were easy to damage the roots). After the arabidopsis thaliana is planted, watering and film covering are needed, and the purpose of the film covering is to keep moisture. Note that: the membrane was covered for 3 to 4 days after the transplantation of Arabidopsis thaliana, because the seedlings just transplanted were small.

3) Positive clones were tested after electroporation by shaking a small amount of 1ml LB (50 ug/ml kan and Rif) in 2ml centrifuge tubes, aliquoting the tubes, and incubating at 28 ℃ and 180rpm overnight (time is flexible and sometimes longer shaking is required to get turbid).

4) After turbidity, the mixture was transferred to a 500ml flask (as 1: 50) and culturing at 28 ℃ and 180rpm for 8-10h until the OD value is 1.2-1.6.

5) And (4) centrifuging at 4000rpm for 15min to enrich agrobacterium.

6) Resuspend in permeation buffer (1/2MS medium + 5% sucrose configuration after sterilization, add 0.02-0.03% final Silwe ttL-77, shake mix), use the resuspend permeation buffer as control, adjust OD600 to 0.8-1.0.

7) When arabidopsis thaliana is first bloomed, buds are cut off, and the proliferation of more flower branches on lateral branches can be promoted. Flowers suitable for transformation of the plants did not mature and did not produce fertilized siliques. Before the arabidopsis thaliana is transferred by an inflorescence infection method, cutting off grown siliques by scissors (because seeds of the siliques are non-transgenic in the future, the positive rate can be reduced if the seeds are not cut off), pouring 100ml of 5% sucrose suspension bacterial liquid into a big dish, then immersing the inflorescence of the arabidopsis thaliana into the big dish for infection for 50s, rotating a pot in the infection process, wiping the pot by using filter paper after infection, covering the infected arabidopsis thaliana by using a black plastic bag or a thin film, and culturing in dark for 24 hours. Care was taken after infection to maintain adequate moisture. The full-bloom period of arabidopsis is long, and the arabidopsis is generally infected for 2-3 times.

8) The seeds can be harvested after the siliques are naturally cracked (about 30d), and the harvested seeds are T1 seeds.

Screening positive seedlings of arabidopsis thaliana:

1) after dehiscence of the silique, seeds of T1 generation were harvested, and Arabidopsis positive seedlings were screened on sterile solid culture. 1/2MS culture medium is prepared, high temperature sterilization is carried out (115 ℃ for 15 minutes), sterilized culture dishes are poured into a super clean bench, about 25mL of culture medium is generally filled in one culture dish, the culture dish is horizontally placed and sealed for storage after full solidification, and 25 mu L of Hygromycin (Hygromycin B, Roche) with the concentration of 50mg/mL is added into 150mL of screening culture medium stored at 4 ℃.

2) Washing Arabidopsis seeds with 75% alcohol for 1min, and removing supernatant; washing with 50% 84 disinfectant for 2min, removing supernatant, and repeating for 2 times; washing with sterile water for 3-5 times; the suspension was suspended in 0.1% sterile agarose, the seeds were spread evenly on 1/2MS petri dishes, and the dishes were closed with a sealing membrane.

3) The plate was incubated in a light incubator at 22 ℃ for 13h/11h photoperiod.

4) After about 7-10 days, root hairs and buds of Arabidopsis thaliana have grown, and after 3 to 4 leaves have grown, seedlings are transplanted into soil for culture. The preparation method of the nutrient soil is the same as the above.

5) Watering in the tray, absorbing by capillary action from the holes at the bottom to ensure soil moistening. The top of the pot may be covered with a substantially transparent cover two days immediately prior to implantation.

Screening medium formulation (1L):

2.2 g MS; 30 g of sucrose; 8 g of agar, adjusting the pH value to 5.6-5.8 by using a sodium hydroxide solution, and sterilizing. To 150mL of the selection medium was added 25. mu.L of Hygromycin (Hygromycin B, Roche) at a concentration of 50 mg/mL.

Example 3:

the application of the corn ZmEREB180 gene in corn stain resistance is as follows:

ZmEREB180 overexpression analysis in maize

ZmEREB180 (shown in SEQ ID NO. 1) is overexpressed by using a constitutive promoter ubi in a maize excellent inbred line C01, 20T 0 positive transformation events are obtained and are subjected to inbreeding homozygosity. At the T2 generation, two different transformation event sources of high expression over-expression families OE115 and OE240 were selected for waterlogging phenotypic identification. When C01, OE115 and OE240 seedlings normally grow to the two-leaf one-heart stage, the characteristics of each genotype material, such as seedling height, root length, fresh weight of overground part, fresh weight of underground part, SPAD value and the like, have no obvious difference, and the over-expression ZmEREB180 does not influence the plant growth under the normal condition. Expression analysis shows that the expression of OE115 and OE240 is about 4-5 times that of C01 under normal conditions (0h), and the short-time (4h) waterlogging treatment can enhance the expression of ZmER EB180 in C01, OE115 and OE 240; however, after long-term (1d and 3d) waterlogging treatment, OE115 and OE240 still maintained higher level expression, while ZmEREB180 expression in C01 was significantly reduced compared to 4h treatment (A in FIG. 3). After 15 days of waterlogging treatment, only the first leaves of the over-expressed lines OE115 and OE240 were completely withered and the C01 heart leaves had completely withered (B, C in FIG. 3). Overexpression lines OE115 and OE240 maintained a more complete root system and also induced the development of developed adventitious root systems, whereas the root system of C01 was substantially oxidized and produced fewer adventitious roots (C in FIG. 3). The longest root length, fresh aerial part weight, number of adventitious roots, longest adventitious root length, and average length of adventitious roots were significantly higher than C01 in both over-expressed lines OE115 and OE240 (D-H in fig. 3). These results indicate that overexpression of ZmEREB180 can enhance the resistance to seed-stage corn.

the ZmEREB180 maize overexpression vector is constructed by utilizing a homologous recombination method, and the specific operation process is carried out according to a Kit Clonexper essel/One Step Clone Kit (Vazyme). The over-expression vector promoter is a Ubi constitutive expression promoter, a single-enzyme digestion linearized plasmid pCAMBIA3300 is selected, and the enzyme digestion site is SmaI (CCCGGGG). The complete CDS (coding sequence) sequence of ZmEREB180 in B73 was amplified from the T-vector and the recombination reaction was performed according to the kit instructions. Transforming the recombinant product into escherichia coli, selecting monoclonal bacterial plaque, carrying out PCR identification, and then sending the bacterial plaque to a company for sequencing; comparing the sequencing results, selecting correct monoclone, shaking the bacteria, expanding and reproducing to extract plasmid, and using the plasmid in corn genetic transformation.

Corn genetic transformation step:

1) transferring the constructed vector into agrobacterium tumefaciens EHA105 by an electric shock method, and identifying by PCR;

2) taking freshly stripped young maize embryos of about 1mm as a material, putting the stripped young maize embryos into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min;

3) absorbing the suspension, putting the rest corn embryo into a tube, adding 1.0ml of agrobacterium suspension, and standing for 5 min;

4) the young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃.

5) After co-culture, transferring the immature embryos into a rest culture medium, carrying out dark culture at 28 ℃ for 6 days, putting the immature embryos onto a screening culture medium containing 5mg/L of Bialap hos, starting screening culture for two weeks, and then transferring the immature embryos onto the screening culture medium containing 8mg/L of Bialap hos for screening culture for 2 weeks;

6) the resistant calli were transferred to differentiation medium 1 and cultured at 25 ℃ under 5000lx light for 1 week.

7) Transferring the callus to a differentiation culture medium 2, and culturing for 2 weeks by illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted;

8) transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.

Example 4:

the application of the primer designed aiming at the sequence in corn breeding comprises the following steps:

the use of the InDel59 marker (F: GCAAAACTAAGACTTTCTCTAGCA, R: TGTGCCCTGTGTATTTTTCGACA) allows the discrimination between two different genotypes of Hap1 (resistance) and Hap2 (sensitivity) by PCR amplification. In 248 double sequenced inbred lines, the survival rate after waterlogging stress for Hap1 was higher than that of Hap2, and the average survival rate for Hap1 was about 0.55, while the average survival rate for Hap2 was about 0.40 (fig. 4). The results show that the molecular marker InDel59 can be used for screening the resistance of the inbred line.

Sequence listing

<110> university of agriculture in Huazhong

Application of <120> corn gene ZmEREB180 in plant stain resistance

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1023

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtgcggag gcgccatcct cgcggagctg atcccgccga cgcggcgcgt ggcgtcgaag 60

ccggtgacag aaggccacct ctggtcggcg agctccaaga aagccggcag cggcagggac 120

aagaggcacc agcacgaata cgccgacgat gacttcgagg ccgccttcga ggacttcgac 180

gacgactttg acgtgcatga agacgacgag gacggccact tcgtattctc gtccaaatcc 240

gccttgtccc cagccctgca cgacgggcgc gcggcgagcc agaagaagca gcgcgggcgc 300

cagttccgcg gcatccggca gcggccctgg ggcaagtggg cggcggagat ccgcgacccg 360

cacaagggca cccgcgtctg gctcggcacc ttcagcaccg ccgaggacgc cgcccgggcc 420

tacgacgtgg aggcgcgccg cctccgcggc agcaaggcca aggtcaactt ccccgcagcc 480

agcggtcgcg ctcgcggtcg cgcgcgccca cgccgcggcg acgacggcaa cccacgaacc 540

gcgccggaaa cgcagcaccc agcacagccc gctctgctgc ctcgaggaga gagagagacg 600

cagaggaagg aagggatcgc cgccgtgaag ccagaagcta cggagtcgtt cgacgtgggc 660

ggcggtctct tcttcgacat ggccttcccc accttcccag cctcgccgcc gccgcaggcc 720

gtggatacgt ccttcgccgg cagcaccgcc acgtcggaga ccgggagccc cgcgaagagg 780

ccgagatgcg acgaagactc gtccgagggc ggcagcggct ccgcgctgga gctcgctgac 840

gagctggcgt tcgacccgtt tgtgctgctg cagatgccct actcgggtgg gtacgacgac 900

gactcactgg acggcctttt cgccgcagat gaggccgtgc agcaggacgt gggcaacggc 960

atggacggcg tccgcctgtg gagcttcgac gagttccccg ccgtcgacgg ttctgttttc 1020

tga 1023

<210> 2

<211> 365

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tatatttttt cctttgtctg ttttcataaa atgcaaaact aagactttct ctagcagatt 60

gtacatataa catgtaaaac atcattttac accgtagaga acgtcacaac actgtttata 120

gaagatggcg agaaagccta agaaagggaa cccaatgcaa cgtggctcac cacgtggcac 180

atcacaattc atcgtgtcat ccagtaagct gcgctaggcg tgtggccatg tggcatatct 240

tgctagtcac catgccaagt catccgccaa cggtcctact gtcctagcta gtttataaat 300

ctcctctctc cgccggcaac cttattggta tcaagaaaaa cttgtcgaaa aatacacagg 360

gcaca 365

<210> 3

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tatatttttt cctttgtctg ttttcataaa atgcaaaact aagactttct ctagcagatt 60

gtacatataa catgtaaaac atcattttac accgtagaga acgtcacaac actgtttata 120

gaaggggatc gtatccagtg cacggcgtgg cccttgtaca ctggatacga tcccttatag 180

aagatggcga gaaagcctaa gaaagggaac ccaacgtggc tcaccacgtg gcacatcaca 240

attcatcgtg tcgtccagta agctgcgcta ggcgtgtggc catgtggcat attttgctag 300

tcaccatgcc aagtcatccg ccaacggtcc tatcttgttt ataaatctcc tctctccgcc 360

ggcaacctta ttggtatcaa gaaaaacttg tcaaaaatac acagggcaca 410

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcaaaactaa gactttctct agca 24

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgtgccctgt gtatttttcg aca 23

Claims

1. The application of the primer pair in stain-resistant corn screening and breeding comprises the following steps: f: GCAAAACTAAGACTTTCTCTAGCA, R: TGTGCCCTGTGTATTTTTCGACA are provided.