CN114292320B - Peanut SL type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants - Google Patents

Abstract

The invention discloses a peanut SL-type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants, and belongs to the technical field of biology. The nucleic acid sequence of the peanut SL-type oil body protein gene AhOLE2 is shown as SEQ ID NO. 1, and the amino acid sequence of the gene encoding protein is shown as SEQ ID NO. 2. After the gene is transformed into arabidopsis thaliana and peanut, the salt tolerance of the arabidopsis thaliana and the peanut can be obviously improved, at least 300mM NaCl is tolerated, and the gene has a good application prospect in the field of improving the salt tolerance of plants.

Description

Peanut SL type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a peanut SL-type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants.

Background

Plants are often subjected to various abiotic stresses (such as drought, salt stress, high and low temperatures, etc.) in natural environments; these adverse conditions can inhibit plant growth and even lead to death of the organism. With the continuous deterioration of the environment, the stress of saline alkali and other adverse conditions has become a worldwide problem, and the cultivation of new plant varieties with various stress resistances has become one of the main targets of the research of broad breeders.

At present, a conventional hybridization method is generally adopted to select a new plant variety, and the new variety with salt and alkali resistance is difficult to select in a short period due to the lack of the germplasm with salt and alkali resistance. The rapid development of genetic engineering technology provides a new way for plant genetic improvement, and genetic transformation by using genes playing important roles in salt stress response is an important means for obtaining new salt-tolerant germplasm.

Disclosure of Invention

The invention aims to provide a peanut SL-type oil body protein gene AhOLE2 and application of the gene in improving salt tolerance of plants.

In order to achieve the above purpose, the invention adopts the following technical scheme:

a nucleic acid sequence of the peanut SL-type oil body protein gene AhOLE2 is shown as SEQ ID NO. 1, and an amino acid sequence of the gene encoding protein is shown as SEQ ID NO. 2.

Cloning of primers for the peanut SL-type oleosin gene AhOLE2 of claim 1, the sequences are as follows:

P1：5′-TAACATGGCTGAAGCACTCT-3′；

P2：5′-CGGTAATACAAGCAACCCAG-3′。

the application of the peanut SL-type oil body protein gene AhOLE2 in improving the salt tolerance of plants, wherein the salt tolerance is at least 300mM NaCl tolerance.

A recombinant vector, recombinant bacteria, expression cassette and transgenic cell line for improving plant salt tolerance contains the coding region sequence of peanut SL-type oil body protein gene AhOLE2.

A method for improving salt tolerance of plants comprises constructing the sequence of peanut SL-type oil body protein gene AhOLE2 into a plant expression vector, and transforming plant cells to express in plants so as to improve salt tolerance of the plants.

In a specific embodiment, the salt tolerance is at least 300mM NaCl tolerance.

In the above method for improving salt tolerance of plants, the plants may be any plants, such as Arabidopsis thaliana, peanut.

Advantages of the technical proposal of the invention

1. The invention clones SL-type oleosin gene AhOLE2 from peanut, and sequencing results show that the gene has no intron and the coded protein has a conserved sequence proline knot.

2. The morphology of the arabidopsis plant transformed with the peanut AhOLE2 gene is normal, and after being treated by 300mM NaCl, the overexpression strain shows stronger salt tolerance compared with a wild type, and the ole mutant has serious wilting; according to the invention, the salt tolerance of the peanut AhOLE2 gene can be obviously improved by expressing the gene in arabidopsis.

3. The AhOLE2 gene is over-expressed in peanuts, so that the salt tolerance of the peanuts can be remarkably improved. The salt tolerance of transgenic peanuts after stress treatment with 300mM NaCl was significantly stronger than that of non-transgenic plants.

Drawings

FIG. 1 shows the relative expression levels of the peanut oil body protein gene AhOLE2 after 250mM NaCl stress treatment in different time periods;

FIG. 2 effect of salt stress treatment on phenotype (first row) and maximum photochemical efficiency (second row) of transgenic and non-transgenic Arabidopsis plants;

FIG. 3 salt stress treatment of Fv/Fm on transgenic Arabidopsis and non-transgenic controls,Influence of NPQ and Y (NO) values;

FIG. 4 PCR identification of AhOLE 2-overexpressed pseudotransgenic peanuts (M: DL2000;1: positive control; 2: negative control; 3-13: pseudotransgenic peanuts);

FIG. 5 growth of transgenic peanut (OE-1, OE-2) and non-transgenic control (WT) plants after salt stress treatment;

FIG. 6 effect of salt stress treatment on maximum photochemical efficiency of transgenic peanut (OE-1, OE-2) and non-transgenic control (WT) photosynthetic system II (WT, OE-1, OE-2 in order from left to right);

FIG. 7 salt stress treatment of transgenic peanuts (OE-1, OE-2) and non-transgenic control (WT) Fv '/Fm'Influence of NPQ and SPAD;

FIG. 8 salt stress treatment using NBT and DAB for leaf staining of transgenic peanut (OE-1, OE-2) and non-transgenic (WT) plants;

FIG. 9 salt stress treatment of transgenic peanuts (OE-1, OE-2) and non-transgenic control (WT) H ₂ O ₂ And O ₂ ^- Accumulation, influence of MDA and proline content.

Detailed Description

The terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art unless otherwise indicated.

The invention will be described in further detail below in connection with specific embodiments and with reference to the data. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

The sources of the experimental materials used in the following examples are as follows:

coli DH 5. Alpha. Was maintained by the Qingdao university of agriculture laboratory;

agrobacterium tumefaciens strain GV3101 was purchased from Beijing Tianzenze Gene technologies Co., ltd;

agrobacterium tumefaciens strain EHA105 was purchased from Beijing Tian Enze Gene technologies Co., ltd;

arabidopsis ole mutants were purchased from AraShare;

arabidopsis thaliana Columbia wild type variety (supplied by the Qingdao university of agriculture genetic laboratory).

Transgenic peanut acceptor material was floral 23 (supplied by the Qingdao university of agriculture genetic laboratory).

Example 1 cloning and expression analysis of peanut SL-type oil body protein gene AhOLE2

1. Cloning of peanut SL-type oil body protein gene AhOLE2

Extracting genome DNA of peanut bearing 23, cloning peanut SL-type oleosin gene AhOLE2 with the primer pair as shown in SEQ ID No. 1, and encoding to produce amino acid sequence with conserved proline knot (-PX 5SPX 3P-) shown in SEQ ID No. 2.

SEQ ID NO:1

TAACATGGCTGAAGCACTCTACTACGGCGGCCGCCAACGCCAAGAGCAACCAAGGTCCACCCAGCTTGTCAAGGCCACCACCGCTGTTGTCGCCGGAGGCTCCCTCTTGATCCTCGCCGGCCTTGTGCTGGCCGGCACCGTCATTGGCCTCACAACGATCACACCGCTCTTCGTGATCTTCAGCCCGGTGCTTGTGCCAGCTGTCATCACTGTGGCACTCTTAGGCTTGGGGTTCTTGGCTTCTGGAGGCTTCGGCGTGGCGGCAATAACAGTGCTGACGTGGATCTATAGGTACGTAACAGGTAAGCATCCACCTGGCGCCAACCAATTGGACACAGCCCGCCACAAGCTGATGGGCAAGGCGCGTGAGATTAAGGACTTTGGTCAACAACAAACCAGTGGGGCCCAGGCTTCTTGAGCATACCATCTTCGTTTGCATCTTTGTTTGCACGCACGTCCACGCCATCATTTATCTTTTTCGAATTGTTATGGTTTATTTTATTTTATTTAATTTTTTATGAGTCTGGGTTGCTTGTATTACCG

SEQ ID NO:2

The amplification primer sequences were as follows:

P1：5′-TAACATGGCTGAAGCACTCT-3′(SEQ ID NO:3)；

P2：5′-CGGTAATACAAGCAACCCAG-3′(SEQ ID NO:4)。

2. influence of salt stress on expression of peanut SL-type oil body protein gene AhOLE2

a. Seedlings of "flower-grown No. 23" were treated with 250mM NaCl, leaves of the seedlings were taken at different time periods (0 h, 6h, 12h, 24h and 48h after treatment) and immediately frozen in liquid nitrogen for later use. Respectively taking 0.05g of young peanut leaves subjected to stress treatment in different time periods, quickly freezing with liquid nitrogen, grinding into powder, and extracting RNA with an RNA extraction kit. The extracted total RNA was treated with DNase I and purified.

b. The samples were reacted on an ABI 7500FAST fluorescent quantitative PCR instrument.

The 20. Mu.L reaction system comprises: 10. Mu.L of 2X SybrGreen qPCR Master Mix, 20. Mu. Mol/L of forward and reverse primers each 0.25. Mu.L, 20ng of reverse transcription product.

The amplification procedure was: firstly, pre-denaturing for 2min at 94 ℃; then 40 circulation reactions are carried out, denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s and extension at 72 ℃ for 30s are carried out in each circulation; after the cycle was completed, the temperature was slowly raised to 94℃to prepare a melting curve. 3 duplicate wells were set for each reaction.

c. The primers for quantitative PCR of the oleosin gene AhOLE2 are as follows:

forward primer sequence: 5'-ACGCCAAGAGCAACCAAG-3' (SEQ ID NO: 5);

reverse primer sequence: 5'-GAACCCCAAGCCTAAGAGTG-3' (SEQ ID NO: 6).

The peanut action gene is taken as an internal standard, and the primer of the internal standard gene is as follows:

forward primer sequence: 5'-GTGGCCGTACAACTGGTATCGT-3' (SEQ ID NO: 7);

reverse primer sequence: 5'-ATGGATGGCTGGAAGAGAACT 3' (SEQ ID NO: 8).

The result is shown in figure 1, and the result shows that the expression level of the oil body protein gene AhOLE2 is obviously increased after salt stress treatment, so that the oil body protein gene AhOLE2 is induced by salt stress.

EXAMPLE 2 construction of SL oleosin Gene AhOLE2 plant expression vector

(1) Cloning a coding region of an oleosin gene AhOLE2 by taking cDNA of a flower culture 23 as a template, and respectively introducing Kpn I and Sac I restriction enzyme sites on an upstream primer and a downstream primer; the primer sequences used are as follows, wherein the underlined parts refer to the cleavage sites:

forward primer: 5' -GGTACCTAACATGGCTGAAGCACTCT-3′(SEQ ID NO:9)；

Reverse primer: 5' -GAGCTCCGGTAATACAAGCAACCCAG-3′(SEQ ID NO:10)；

(2) The PCR product was recovered and ligated with the cloning vector pMD18-T (purchased from TaKaRa) by T4 DNA ligase, and the ligation product transformed into E.coli DH 5. Alpha. Extracting recombinant plasmid, carrying out double enzyme digestion by Kpn I and Sac I, recovering enzyme digestion fragments of the oil-containing protein gene AhOLE2, and cloning the enzyme digestion fragments into corresponding enzyme digestion sites of a plant expression vector pBI121 to obtain the plant expression vector pBI121-AhOLE2 of the gene.

Example 3 application of SL oil body protein gene AhOLE2 in improving salt tolerance of Arabidopsis thaliana

1. The expression vector transforms the arabidopsis thaliana, comprising the following steps:

a. preparation, activation and bacterial liquid preparation of agrobacterium recombinant strain: the plant expression vector pBI121-AhOLE2 constructed in example 2 was used to transform competent cells of Agrobacterium strain GV3101 by liquid nitrogen freeze thawing, and recombinant strains containing pBI121-AhOLE2 were selected. Selecting single colony of recombinant strain, inoculating into YEB (rifampicin 50mg/L, kanamycin 50 mg/L) liquid culture medium, culturing at 28 ℃ and 180rpm until OD600 = 0.5-0.8, transferring 2mL bacterial liquid into 50mLYEB (rifampicin 50mg/L, kanamycin 50 mg/L) culture medium, and culturing until OD600 = 0.6-0.8. After centrifugation at 5000rpm for 15min, the bacterial liquid was suspended with the same volume of liquid 1/2MSB5 for further use.

b. Planting arabidopsis thaliana: selecting proper Arabidopsis seeds, soaking in 1% NaClO for 5min, and washing with sterile water for 4-6 times. Dibbling onto substrate soil.

c. Agrobacterium-mediated genetic transformation: selecting a robust plant in an initial fruit period, reversely buckling the robust plant with a pot above a container containing agrobacterium suspension, immersing the whole inflorescence into the agrobacterium suspension for about 20-30s, and taking care that the leaves are not contacted with the dip dyeing liquid as much as possible. The pot is taken down and horizontally placed in a dark box for about 24 hours. Care was taken to maintain a certain humidity. After 24 hours, the treated Arabidopsis plants are placed under the illumination condition of 22-25 ℃ to enable the Arabidopsis plants to grow normally. Mature seeds were harvested after approximately 3 w.

d. Screening of transgenic Arabidopsis thaliana

Transgenic Arabidopsis seeds are inoculated into MS culture medium added with kanamycin, cultured for about one week at 22 ℃, and fresh and robust Arabidopsis seedlings are selected and transplanted into matrix soil.

e. PCR detection of transgenic plants

Extracting genome DNA of the transgenic plant, and performing PCR amplification by using the vector sequence and the designed primer of SL-type oleosin gene AhOLE2 sequence. The PCR reaction procedure was: 95 ℃ for 5min;95 ℃, 50s,56 ℃, 50s,72 ℃, 1min,30 cycles; 72 ℃ for 10min. The identification result is sent to sequencing, and the arabidopsis plant which is correctly sequenced is the AhOLE2 gene transferred.

2. Identification of salt tolerance of AhOLE 2-transferred Arabidopsis thaliana

AhOLE2 was transformed into ole mutant and wild type Arabidopsis thaliana (WT), and the T3 generation homozygote was obtained by screening. Arabidopsis seedlings grown for 15d were irrigated with 300mM NaCl solution and observed for phenotypic changes in Arabidopsis OLE mutant (OLE), wild type plant (WT), complementation line (AhOLE 2 gene was transferred into Arabidopsis OLE mutant, OLE/OLE 2) and over-expression line (AhOLE 2 gene was transferred into Arabidopsis wild type plant, OE-OLE 2). The results showed that the over-expressed strain OE-OLE2 showed a stronger salt tolerance after 7d treatment with 300mM NaCl compared to the wild type, and the OLE mutant plants were severely wilted (FIG. 2).

Arabidopsis seedlings treated with 300mM NaCl for 7d were examined using a chlorophyll fluorescence imaging system and the results are shown in the second row of FIG. 2 and in FIG. 3A, wherein the second row of FIG. 2 shows the maximum photochemical efficiency for the different treatment groups, wherein the color from red to purple represents the maximum photochemical efficiency from small to large, where OLE mutant plants show yellow, WT shows yellow and purple, OLE/OLE2 and OE-OLE2 show purple, and the purple range of OE-OLE2 is greater than OLE/OLE2, and the transformation of the AhOLE2 gene is shown to increase the maximum photochemical efficiency of the plants in combination with the data of FIG. 3A, and is higher than OLE mutants and WT.

Salt stress significantly reduced the Y (NPQ) value (quantum yield regulating energy dissipation) of ole mutants (B in fig. 3); PSII photochemical quantum efficiency (ΦPSII) has a similar trend to Fv/Fm values (D in FIG. 3); under salt stress, the Y (NO) value of OLE mutant (an important indicator of photodamage) was significantly lower than that of WT, the complementation line (OLE/OLE 2) and the over-expression line (OE-OLE 2) (FIG. 3C).

Example 4 application of SL oil body protein gene AhOLE2 in improving salt tolerance of peanuts

1. The expression vector transforms peanuts, which comprises the following steps:

a. preparation, activation and bacterial liquid preparation of agrobacterium recombinant strain: the pBI121-AhOLE2 recombinant plasmid is used for transforming competent cells of the agrobacterium strain EHA105 by a liquid nitrogen freeze thawing method, and the recombinant strain containing the recombinant plasmid is screened. Selecting single colony of recombinant strain, inoculating into YEB (rifampicin 50mg/L, kanamycin 50 mg/L) liquid culture medium, culturing at 28deg.C and 180rpm until OD600 = 0.5-0.8, transferring 2mL bacterial liquid into 50mL YEB (rifampicin 50mg/L, kanamycin 50 mg/L) culture medium, and culturing until OD600 = 0.6. After centrifugation at 5000rpm for 10min, the bacterial liquid was suspended with the same volume of liquid MSB5 for further use.

b. Isolation of peanut explants: selecting full peanut seeds (flower culture No. 23), soaking in 70% ethanol for 1min, soaking in 0.1% mercuric chloride for 20min, washing with sterile water for 3-5 times, and cutting each piece She Zongxiang into 2 halves.

c. Agrobacterium-mediated genetic transformation: the cut explant is immersed in the prepared agrobacterium liquid, the temperature is 28 ℃, the shaking is carried out at 90rpm for 10min, the residual bacterial liquid is sucked by sterile filter paper, and the residual bacterial liquid is inoculated on a SIM induction medium to be co-cultured in the dark for 3d. Transferring to SIM induction culture medium added with 250mg/L cephalosporin, embedding the incision end of the explant into the culture medium, culturing about 2w, inducing cluster buds, and culturing under the following conditions: the light intensity is 1500-2000lx, the illumination is 12h, and the temperature is 26+/-1 ℃.

Explants forming cluster buds were transferred to SEM medium of 250mg/L cephalosporin, 100mg/L kanamycin for selection of resistant buds, cultured for 2w, culture conditions: the light intensity is 1500-2000lx, the illumination is 12h, and the temperature is 26+/-1 ℃.

After 2w of culture, the adventitious bud portion was excised and transferred to SEM medium of 250mg/L cephalosporin and 150mg/L kanamycin, selection of resistant buds and induction of bud elongation were performed, and culture was performed about 4w, during which time subculture was performed 2-3 times.

d. PCR detection of transgenic plants

Extracting the genome DNA of the regenerated plant, and performing PCR amplification by using the vector sequence and the AhOLE2 gene sequence design primer. The PCR reaction procedure was: 95 ℃ for 5min;95 ℃, 50s,58 ℃, 50s,72 ℃, 1min,30 cycles; 72 ℃ for 10min. And sending the identification result to sequencing, and obtaining the AhOLE2 gene-transferred peanut plants after the sequencing is correct. The PCR positive rate of the transgenic plant reaches 19.8 percent (figure 4).

e. Grafting and transplanting of transgenic positive plants

Taking a sterile seedling with seedling age of about 15 days as a stock, cutting off a main stem part which is more than 2cm away from cotyledons, vertically splitting the upper end of the stock by using a surgical knife, and ensuring that the incision depth is about 1cm. When the transgenic plant seedlings grow to about 3cm, the regenerated seedlings are cut from the base of the bud cluster to be used as scions, the lower end of the regenerated seedlings is cut into V-shaped wounds with the length of about 1cm, and the cuts are flat. Inserting the scion into the stock, enabling the cambium of the stock and the scion to be in close contact, and then winding the joint by using a sealing film, wherein the tightness is moderate. Placing the grafted seedling in an MSB5 culture medium for sterile culture for 3-4d; transplanting the seeds into sterilized seedling culture matrix for domestication for 2w, and transplanting the seeds into matrix soil until pods are harvested.

f. Salt tolerance analysis of transgenic plants

2w peanut seedlings were grown by watering with 200mM NaCl solution, and 3d later seedlings were watered with 300mM NaCl solution for 15d, and phenotypic changes of the over-expressed plants and the non-transgenic control were observed. The results showed that plants overexpressing AhOLE2 gene (OE) (OE-1 and OE-2) showed stronger salt tolerance after NaCl treatment and that non-transgenic peanut plants (WT) had severe wilting (FIG. 5).

Determination of transgenic positive plants and related non-transgenic control leaves using chlorophyll fluorescence imaging system and chlorophyll photosynthesis instrumentThe parameters, as shown in FIG. 6, the color from yellow to purple in FIG. 6, respectively, represents the maximum photochemical efficiency from small to large, the non-transgenic control plants showed yellow, the over-expressed strains (OE-1 and OE-2) showed purple, which illustrates that the photosynthetic system II maximum photochemical efficiency (PSII) (Fv/Fm) of the 2 over-expressed strains (OE-1 and OE-2) was higher than that of the non-transgenic control; furthermore, in connection with the data in FIG. 7, it is shown that 2 over-expressed strains (OE-1 and OE-2) have PSII photochemical efficiencies (Fv '/Fm'), and PS II quantum efficienciesBoth the non-photochemical quenching coefficient NPQ and SPAD values were significantly higher than the non-transgenic control (WT).

To detect the accumulation of active oxygen in transgenic positive plants and non-transgenic control leaves after salt stress treatment, the measurement was stained with NBT and DAB (FIG. 8), wherein the more blue parts of leaves in the NBT staining results of FIG. 8, the more O was demonstrated ₂ ^- The more the accumulation amount; transgenic plants (OE-1 and OE-2) showed less blue part than non-transgenic control (WT) leaves, indicating O ₂ ^- The accumulation amount is small. In the DAB staining results, the more brown part of the leaves, the more H is understood ₂ O ₂ The more the accumulation amount; transgenic plants (OE-1 and OE-2) showed less brown part than non-transgenic control (WT) leaves, indicating H ₂ O ₂ The accumulation amount is small. Further determination of H in transgenic Positive plants and non-transgenic control leaves ₂ O ₂ And O ₂ ^- Accumulation, MDA and proline content, the results indicate that O for 2 overexpressing lines (OE-1 and OE-2) compared to the non-transgenic control ₂ ^- The accumulation amount is respectively reduced by 40.24 percent and 30.00 percent; h ₂ O ₂ The accumulation amounts are respectively reduced by 47.97 percent and 32.97 percent; the MDA content is respectively reduced by 39.69 percent and 33.16 percent; the proline content was increased by 36.53% and 33.77%, respectively (fig. 9).

The above description is only a preferred embodiment of the present invention, and is not intended to limit the invention in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present invention still fall within the protection scope of the technical solution of the present invention.

Sequence listing

<110> Qingdao university of agriculture

<120> peanut SL-type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 543

<212> DNA

<213> peanut (Arachis hypogaea Linn.)

<400> 1

taacatggct gaagcactct actacggcgg ccgccaacgc caagagcaac caaggtccac 60

ccagcttgtc aaggccacca ccgctgttgt cgccggaggc tccctcttga tcctcgccgg 120

ccttgtgctg gccggcaccg tcattggcct cacaacgatc acaccgctct tcgtgatctt 180

cagcccggtg cttgtgccag ctgtcatcac tgtggcactc ttaggcttgg ggttcttggc 240

ttctggaggc ttcggcgtgg cggcaataac agtgctgacg tggatctata ggtacgtaac 300

aggtaagcat ccacctggcg ccaaccaatt ggacacagcc cgccacaagc tgatgggcaa 360

ggcgcgtgag attaaggact ttggtcaaca acaaaccagt ggggcccagg cttcttgagc 420

ataccatctt cgtttgcatc tttgtttgca cgcacgtcca cgccatcatt tatctttttc 480

gaattgttat ggtttatttt attttattta attttttatg agtctgggtt gcttgtatta 540

ccg 543

<210> 2

<211> 137

<212> PRT

<213> peanut (Arachis hypogaea Linn.)

<400> 2

Met Ala Glu Ala Leu Tyr Tyr Gly Gly Arg Gln Arg Gln Glu Gln Pro

1 5 10 15

Arg Ser Thr Gln Leu Val Lys Ala Thr Thr Ala Val Val Ala Gly Gly

20 25 30

Ser Leu Leu Ile Leu Ala Gly Leu Val Leu Ala Gly Thr Val Ile Gly

35 40 45

Leu Thr Thr Ile Thr Pro Leu Phe Val Ile Phe Ser Pro Val Leu Val

50 55 60

Pro Ala Val Ile Thr Val Ala Leu Leu Gly Leu Gly Phe Leu Ala Ser

65 70 75 80

Gly Gly Phe Gly Val Ala Ala Ile Thr Val Leu Thr Trp Ile Tyr Arg

85 90 95

Tyr Val Thr Gly Lys His Pro Pro Gly Ala Asn Gln Leu Asp Thr Ala

100 105 110

Arg His Lys Leu Met Gly Lys Ala Arg Glu Ile Lys Asp Phe Gly Gln

115 120 125

Gln Gln Thr Ser Gly Ala Gln Ala Ser

130 135

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

taacatggct gaagcactct 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cggtaataca agcaacccag 20

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

acgccaagag caaccaag 18

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gaaccccaag cctaagagtg 20

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gtggccgtac aactggtatc gt 22

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atggatggct ggaagagaac t 21

<210> 9

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ggtacctaac atggctgaag cactct 26

<210> 10

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gagctccggt aatacaagca acccag 26

Claims (2)

1. Application of peanut SL-type oil body protein gene AhOLE2 in improving salt tolerance of plants, wherein the nucleic acid sequence of the peanut SL-type oil body protein gene AhOLE2 is shown as SEQ ID NO. 1, the amino acid sequence of the gene encoding protein is shown as SEQ ID NO. 2, and the plants are peanuts or arabidopsis thaliana; the salt tolerance is 300mM NaCl tolerance.

2. A method for improving salt tolerance of plants is characterized in that a sequence of a peanut SL-type oil body protein gene AhOLE2 is constructed into a plant expression vector, and plant cells are transformed to be expressed in the plants so as to improve the salt tolerance of the plants; the nucleic acid sequence of the peanut SL-type oil body protein gene AhOLE2 is shown as SEQ ID NO. 1, the amino acid sequence of the gene encoding protein is shown as SEQ ID NO. 2, and the plant is peanut or Arabidopsis; the salt tolerance is 300mM NaCl tolerance.