CN104830872B - Cotton GhEDR2 genes and its encoding proteins and application - Google Patents

Abstract

The present invention relates to Cloning Plant Genes and functional analysis, belong to plant genetic engineering field, specifically one grows cottonGhEDR2Gene and its encoding proteins and application, relative conservative of the invention according to Homologous gene sequences, search and cotton EST fragments homologous arabidopsis disease-resistant gene cDNA, it will partly overlap and the cotton EST of very high homology carry out sequences assembly, it is combined into complete ORF cDNA sequence, according to the specific PCR primer of these sequences Designs, using RT PCR method, obtainGhEDR2Gene.The characteristics of expression of the gene in cotton plants presents tissue specificity is found using qPCR analyses.And the incidence of disease of genetically modified plants verticillium wilt is significantly lower than non-transgenic plant.Therefore using of the present inventionGhEDR2Gene cultivates resisting verticillium plant, will hold out broad prospects in Resistant breeding.

Description

Cotton GhEDR2 genes and its encoding proteins and application

Technical field

The present invention relates to Cloning Plant Genes and functional analysis, belong to plant genetic engineering field, specifically one grows cotton GhEDR2 genes and its encoding proteins and application, it is used to improve disease resistance of plant by plant gene engineering technology.

Background technology

Cotton is the industrial crops for occupying critical role in Chinese national economy.Cotton verticillium wilt is worldwide One of disease, seriously governs the stable development of Cotton Industry.In recent years, the occurring area of cotton verticillium wilt is in becoming for aggravating Gesture, onset area accounts for 50% or so of the cotton gross area.Cotton verticillium wilt is to infect caused fungoid dimension by verticillium dahliae Tube bundle system disease, belongs to soil-borne disease.The host range of verticillium dahliae widely, including cotton, tomato, flax, The various plants of potato and eggplant etc. 200, are exactly that verticillium wilt pathogen can also be with the mal-condition that not suitable host is present Microsclerotia is survived more than 10 years in soil.Current various cotton verticillium wilt prophylactico-therapeutic measures, thus it is anti-including physical control, chemistry Control, the method such as biological control is difficult to play prevention effect to cotton, so seed selection and be to solve this using resisting verticillium kind The most economical effective approach of problem.It is yellow yet with lacking although China has obtained remarkable effect in terms of anti-blight breeding Disease of withering anti-source, verticillium wilt resistance of cotton by same breeding is made slow progress.

EDR (Enhanced Disease Resistance) 2 is cloned from arabidopsis edr mutant with anti- The gene of characteristic of disease.Arabidopsis EDR2 includes a PH area, a START area and a DUF1336 area.Wherein, pH areas are by main It is responsible for being combined assistance film positioning with fat, START areas work in fat transport and metabolism and cell signal；DUF1336 areas are The distinctive domain of plant.EDR2 homologous protein EDR1 and EDR3 is guarded very much in arabidopsis, and the resistance that they are mediated is all Salicylic acid (SA) signal path is needed, without jasmonic (JA) and ethene (ET), its resistance mediated has broad spectrum activity, There is important application value in agricultural production.

With the development of biotechnology, using gene engineering method, disease-resistant gene is introduced directly into cotton, anti-yellowing wither is formulated The germplasm materials of disease, to we provide the effective ways for solving this problem.Therefore in current cotton disease resistance breeding, cotton is understood Colored disease resistance mechanisms and the degeneration-resistant favorable genes resource of excavation, initiative breeding new material have become the master of Molecular breeding in upland cotton instantly Want task.Clone, the separation gene related to research resisting verticillium, it is improvement cotton to analyze the expression of different genes, regulatory mechanism Flower variety provides material base and theoretical foundation.

The content of the invention

The defect that the present invention exists to make up current cotton variety in terms of resisting verticillium grows cotton there is provided one GhEDR2 genes and its encoding proteins and application.

The present invention is achieved by the following technical solutions：Cotton GhEDR2 genes, are the alkali as shown in SEQ ID NO.1 Basic sequence；Or carried out on the basis of the base sequence shown in SEQ ID NO.1 one or more bases replacement, missing or/and The base sequence variant of insertion, and function or work of the albumen still with GhEDR2 encoding proteins coded by the base sequence variant Property.

Base sequence shown in SEQ ID NO.1 is hybrid with it and encodes still having of obtaining under strict conditions The function of GhEDR2 encoding proteins or the DNA molecular of activity fall within protection scope of the present invention.Shown in the SEQ ID NO.1 Base sequence be to utilize the gene order in ncbi database, search and homologous arabidopsis disease-resistant gene cDNA cotton EST Fragment, will partly overlap and the cotton EST of very high homology carries out sequences assembly, complete ORF cDNA sequence is combined into, according to this The specific PCR primer of a little sequences Designs, using RT-PCR method, obtains GhEDR2 genes.

The second object of the present invention is to provide one and grown cotton GhEDR2 gene coded proteins, is the egg as shown in (a) or (b) In vain：

(a) protein shown in SEQ ID NO.2；

(b) by the protein shown in SEQ ID NO.2 is by the replacement of one or more amino acid, missing or/and inserts And the derivative obtained protein variant still with GhEDR2 gene functions or activity.

SEQ ID NO.1 are the cotton genes cloned from cotton leaf, are named as GhEDR2, ORFs 2449bp, encodes the protein being made up of 816 amino acid, as shown in SEQ ID NO.2.

In addition, improving plant to the application in resistance to verticillium wilt the invention provides cotton GhEDR2 genes.

Recombinant vector or recombinant bacterium or transgenic cell line containing cotton GhEDR2 genes fall within the protection of the present invention Scope.

Further, the recombinant vector containing cotton GhEDR2 genes is the multiple cloning sites insertion claim in pIP101 The recombinant vector that encoding gene described in 1 is obtained.

Present invention also offers a kind of method cultivated to the genetically modified plants of resistance to verticillium wilt, cotton GhEDR2 will be contained Importeding into plant for gene, cultivates the genetically modified plants that screening obtains improving resistance to verticillium wilt.Described plant is Shuangzi Leaf plant and monocotyledon, such as arabidopsis, cotton and corn.

The present invention is searched and cotton homologous arabidopsis disease-resistant gene cDNA according to the relative conservative of Homologous gene sequences EST fragments, will partly overlap and the cotton EST of very high homology carry out sequences assembly, be combined into complete ORF cDNA sequence, root According to the specific PCR primer of these sequences Designs, using RT-PCR method, GhEDR2 genes are obtained.Analyzed and sent out using qPCR The characteristics of now expression of the gene in cotton plants presents tissue specificity.And the incidence of disease of genetically modified plants verticillium wilt Significantly lower than non-transgenic plant.Therefore resisting verticillium plant is cultivated using GhEDR2 genes of the present invention, in plant It will be held out broad prospects in breeding for disease resistance.

Brief description of the drawings

Fig. 1 is expression analysis of the GhEDR2 genes in cotton Different Organs.

Fig. 2 is different time GhEDR2 gene expressions after verticillium wilt pathogen processing cotton.

Fig. 3 is the structure of GhEDR2 gene overexpression carriers.

Fig. 4 is the Subcellular Localization of GhEDR2 albumen.

Fig. 5 is the PCR electrophoretograms for turning GhEDR2 gene arabidopsis.

Fig. 6 refers to investigation to turn the disease of GhEDR2 gene arabidopsis strains after being inoculated with 15 days, and WT is WT lines；PX1- The transgenic line that PX5 is.

Fig. 7 refers to investigation to turn the disease of GhEDR2 gene arabidopsis strains after being inoculated with 20 days, and WT is WT lines；PX1- The transgenic line that PX5 is.

Embodiment

With reference to specific embodiment, the invention will be further described, but the present invention is not limited to following examples.

Following all equal references of genetic manipulation method《Molecular cloning》(Sambrook J et al., 1989) is described to be carried out；Have Kit is closed to use with reference to the application note for purchasing kit；It is public that restriction enzyme used and other toolenzymes are purchased from NEB Department.

Cotton material is disease-resistant cotton variety Henan cotton 21, is carried by Cotton Research Institute, Shanxi Academy of Agricultural Sciences variety source room For.Arabidopsis is that Columbia ecotype, tobacco bred are SR1, is provided by Microbe Inst., Chinese Academy of Sciences Wu Jiahe researcher, This laboratory of agrobacterium tumefaciens bacterial strain GV3103 is preserved.Cloning vector pMDl8-T Simple Vector, intermediate carrier pDNOR, Bacillus coli DH 5 alpha, reverse transcription reagent box, Real time RT-PCR kits and SYBR Premix Ex Taq are purchased from TaKaRa companies, DNA purification kits, DNA Rapid extraction kit, Ago-Gel QIAquick Gel Extraction Kit are given birth to purchased from Shanghai Work Co., Ltd.The primer is synthesized and is sequenced and completed by Shanghai Sheng Gong biotechnologys Services Co., Ltd.

First, the Cloning and sequence analysis of cotton GhEDR2 genes

1. the extraction of total serum IgE

Cotton disease resistance kind Henan cotton 21 is planted in flowerpot, when Cotton Seeding Cotyledon full extension, cotton leaf is taken Total serum IgE is extracted according to TaKaRa companies RNA extracts kits explanation.Use the PrimerScript of TaKaRa companies^TMReverse transcription Enzyme carries out cDNA synthesis.

The separation of 2.GhEDR2 genes

According to the relative conservative of Homologous gene sequences, with the base sequence of arabidopsis EDR2 genes, tblastn programs are used It is compared, the ESTs after comparison is ranked up according to homology height, and select in GenBank cotton ESTs databases Select the low sequence of matching score value height, E values.According to the Homologous gene sequences with complete coding region of acquisition, using Prier The design primers of Premier 5.0 enter performing PCR amplification.

GhEDR2 F GCTCACAATCAAAATCATAATCAA

GhEDR2 R CAGGGAAGATGTGAAAAACG

PCR amplification system：The system that reaction cumulative volume is 40 (μ L), template 2, P1/P2 2/2, DNTP3, BUFFER 4, TAQ 0.4, water 26.6.PCR reaction conditions are：95 DEG C of pre-degeneration 7min；95 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extensions 180s, after denaturation, annealing, 35 circulations of extension, 72 DEG C re-extend 10min, 4 DEG C of insulations.PCR primer is coagulated with 1% agarose Glue carries out electrophoresis detection.The target DNA band of PCR primer cut with clean scalpel from agarose gel be placed on 1.5mL from In heart pipe, then purified with Ago-Gel DNA QIAquick Gel Extraction Kits and reclaim purpose fragment.After the completion of purifying is reclaimed, 5 μ L are taken to carry out Electrophoresis detection.

The connection of 3.PCR products

According to Takara pMD18-T Vector specification, by the GhEDR2 fragments and pMD18-T Vector of recovery The of short duration centrifugation after melting on ice, sets up following reaction system in 1.5mL centrifuge tube：Recovery product (GhEDR2 fragments) 5 μ 4.5 μ L, pMD18-T Vector of L, connection Mix 0.5 μ L, the μ L of cumulative volume 10.After all products add well, gently mixed with pipettor Even, 16 DEG C connect overnight.

4. the conversion of connection product

A pipe competent cell is taken out in -70 DEG C of refrigerators to be placed in ice bath, and target DNA is added into competent cell suspension 5 μ L, gently rotating centrifugal pipe is to mix content, and centrifuge tube is placed in 42 DEG C of water-baths and placed by standing 30 minutes in ice bath 90 seconds, then quickly pipe is transferred in ice bath, cell is cooled down 2-3 minutes.900 μ L are added into each centrifuge tube sterile LB culture mediums (are free of antibiotic), 37 DEG C of shaking table concussion and cultivates 45 minutes (150 revs/min) are placed in after mixing, it is therefore an objective to make matter The expression of related resistant maker gene, makes thalline recover on grain.Centrifuge tube content is mixed, the sense that 100 μ L have been converted is drawn 75 μM of Amp are added to by state cell⁺LB solid agar mediums on, with sterile elbow glass rod with gentle cell is uniformly applied Open.Flat board is placed in room temperature up to liquid is absorbed again, flat board is inverted, 37 DEG C are cultivated 12-16 hours.

5. the PCR identifications of recombinant plasmid

8 hickies are selected respectively be inoculated into 8 contain Amp⁺In the 1.5mL of the LB fluid nutrient mediums of resistance centrifuge tube, 37 DEG C of shaking table concussion and cultivates are placed in after 5 hours, performing PCR detection are entered by template of these bacterium solutions, then electrophoresis detection PCR primer, Choose respectively and purpose fragment cloning and sequencing of the same size, DNA sequencing is complete by Shanghai Sheng Gong biotechnologys Services Co., Ltd Into.

2nd, the expression analysis of cotton GhEDR2 genes gene under different tissues and verticillium wilt induction

1. the collection and processing of sample are set

It will be planted in after the seed lint of disease-resistant cotton variety Henan cotton 21 in flowerpot, be vermiculite for examination soil.After cotyledon is grown Final singling, seedling 3 is stayed per basin.Condition of culture is that diurnal temperature is respectively 28 DEG C, 20 DEG C, daily illumination 16h, dark 8h, and culture is extremely When 2 true leaves of appearance in two weeks are fully deployed, verticillium wilt pathogen inoculation is carried out.Verticillium dahliae V991 is inoculated with using root dipping method, Spore concentration is 1.0 × 10⁷mL^{- 1}, cotton plant young root is taken respectively at after inoculation 12,24,36,48,72 and 96h, is not inoculated with while taking The cotton plant young root of verticillium wilt pathogen is as control, after liquid nitrogen frozen, is stored in -80 DEG C of refrigerators.

2.Quantitative Real-time RT-PCR methods

Using Quantitative Real-time RT-PCR (qRT-PCR) method, detection GhEDR2 Levant Cotton Root, stem, The expression of expression in leaf and its different periods after verticillium wilt induction, the pair of primers of GhEDR2 amplifications is GhEDR2-F：5’-ATGGTTTCAAGGGCAGGAT-3’；GhEDR2-R：5’-AATGCCAGGGAGGAAGGT-3’.With cotton Ubiquitin gene (accession number：AY189972) as internal standard gene, amplification pair of primers is Ubi-F：5’- AAGACCTACACCAAGCCCAAG-3’；Ubi-R：5’-ACACTCCGCATTAGGACACTC-3’.Ubiquitin and purpose base Because being in charge of amplification with machine.

Reaction system used in qRT-PCR is 25 μ l, and wherein template is 0.5 μ l cDNA after quantitative dilution.Amplification condition For：95 DEG C, 1min；95 DEG C, 5s；59 DEG C, 30s；72 DEG C, 30s；78 DEG C, 82 DEG C, 85 DEG C of each read plates once, set 40 circulations, Draw solubility curve.Using ubiquitin genes as internal reference, biological experiment is repeated 3 times.GhEDR2 bases are tried to achieve with Ct methods are compared Because of the relative expression quantity in root, stem, leaf, wherein calculation formula Y=10^△Ct/3× 100% (△ Ct are internal standard gene Ct and mesh Gene C t difference, i.e. △ Ct=Ct_Ghubi–Ct_{Gh EDR2})；The Ct of sample is calculated with the softwares of Opticon Monitor 2 Value, and use 2^-△△CtComputational methods try to achieve the relative expression quantity of sample under different disposal.

3. organizing specific expression is analyzed

The total serum IgE of the organs such as root, stem, the leaf of cotton is extracted, and reverse transcription is carried out into cDNA using the cDNA as template Quantitative qRT-PCR analyses, as a result show that GhEDR2 genes have expression in these histoorgans, GhEDR2 genes are planted in cotton Expression in strain is the characteristics of present tissue specificity (as shown in Figure 1), GhEDR2 root expression quantity highest, be secondly stem, And the expression quantity in leaf is relatively low, it is a constitutive expression gene to illustrate this gene, implies the function of the gene and may deposit In tissue specificity.

4. the expression of the lower gene of verticillium wilt induction

As shown in Fig. 2 in the inoculation verticillium wilt High pathogenicity defoliation bacterial strain V991 instantaneous up-regulated expression of back root part gene, Show as inoculation 12h after gene expression amount raise more than 10 times, 24~36h expression quantity is greatly reduced, after 48h expression quantity just with 0h expression quantity is without significant difference, the level that expression quantity is returned to before inoculation after 96h.

3rd, the structure of GhEDR2 gene plants expression vector

1. the amplification of the gene order with ATTB sites

AttB primers, as template, are designed using with expanding obtained mesh gene GhEDR2 full length products,

attB1

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGGGATCAGGCGATGG

attB2

GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCATCCAGTGGTACAGCAG

Joint attBl and attB2 are introduced at the two ends of full-length gene by PCR reactions respectively, for carrier restructuring.PCR Reaction system is：Reaction condition：95 DEG C of 10min, 35 circulations include 95 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 3MIN, last 72 DEG C 10MIN.After agarose electrophoresis PCR primer is reclaimed with DNA purification kits.

2. the structure of entry vector

First, the structure of entry vector is carried out, as shown in Figure 3.AttB joints are carried by obtained above by BP reactions Target gene GhEDR2 and entry vector pDONER/Zeo recombinated.Configure following BP reaction systems：The μ L of gene 3, carrier (PDONR) the μ L of 1 μ L, BP enzyme 1, are connected overnight.Products therefrom is subjected to bacillus coli DH 5 alpha competence conversion, and even spread is arrived On less salt LB solid mediums with final concentration of 25 μ L/mlZeocin resistances, 37 DEG C are cultivated 12~18 hours, and screening is positive Clone, carries out sequencing detection.Sequence verification is correctly cloned to bacterium solution and is inoculated in liquid LB cultures of the 2mL with Zeocin resistances Culture is enlarged in base.Cultivated in 37 DEG C of shaking tables 6~8 hours and reach 1.0 to OD values, using plasmid extraction (a small amount of) reagent Box carries out plasmid extraction.

3. the structure of expression vector

Whole carrier used in the present invention is pEARLEGATE101 carriers, by transforming pEARLEGATE101 carriers, The cassette of attR recombination sites is included in its flat terminal restriction restriction enzyme site insertion, Gateway is made compatible Carrier.By LR reactions by above-mentioned purpose gene swapping to final expression vector pEARLEGATE101, following LR reactions are configured System：The 1 μ L of μ L, LRASE of GhEDR2-pDONR3 μ L, pEARLEGATE101 carrier 1, reaction is stayed overnight.Then products therefrom is turned Change E. coli competent.Transformed bacteria solution even spread is on the LB solid mediums with Kan resistances, 37 DEG C of cultures 12~18 Hour.Screening positive clone and sequence verification, extract positive colony plasmid, that is, obtain expression vector GhEDR2- pEARLEGATE101。

4. the conversion of recombinant plasmid Agrobacterium

The expression vector GhEDR2-pEARLEGATE101 plasmids conversion Agrobacterium GV3101 competence of above-mentioned acquisition is thin Born of the same parents.Picking positive single bacterium colony, is added to 800 μ L resistance LB fluid nutrient mediums (50mg/LKan+50mg/ on cultured flat board LRif+50mg/LGen in), 28 DEG C of shaking table cultures 6~8 hours.Culture bacterium solution carries out target gene as the PCR templates detected Detection.Concrete operation step is as follows：The μ L of incubated overnight Agrobacterium bacterium solution 100 are taken to add in new EP pipes, 4000rpm centrifugations 5min, abandons supernatant；Take 5 μ LddH20 to add in EP pipes, gently piping and druming precipitation, thalline is resuspended, EP pipes are placed in 98 DEG C of water-baths 15min is boiled, performing PCR detection is entered as PCR template.The positive expression carrier GV3101 bacterial strains obtained through detected through gel electrophoresis Afterwards, bacterium is deposited standby.

The Subcellular Localization of 5.GhEDR2 genes

Concussion and cultivate under the Agrobacterium GV3101 dark surrounds of GhEDR2 expression vectors will be transferred to, have treated that Agrobacterium is trained When supporting to OD=0.6,3000rpm is centrifuged 10 minutes, with MS culture mediums (4.4 grams of MS powder, 20 grams of sucrose, 1 liter of 5.6 constant volumes of pH), Bacterium solution is precipitated and suspended, OD is adjusted₆₀₀=0.6, add MES (the μ L of 10mM, AS 200), stand 3 hours it is standby.It is disposable with 1mL Syringe needle pierces 1-3 aperture at the tobacco leaf back side, is propped up with hand at the aperture on blade face, then will with the needle tubing of needle-less The bacterium solution of Agrobacterium is slowly injected into leaf tissue space along aperture by osmotic pressure, is cultivated between culture 2 days, then common in laser Observed under focusing microscope.A figures are the distribution situation of fusion protein (GhEDR2-YFP) in the cell in Fig. 4, and b figures are generations The form of table cell under common white light, c figures are that a figures and b figures overlap generation.GhEDR2 albumen is primarily targeted for There is a small amount of distribution on cytoskeleton in cell membrane and nucleus, kytoplasm.

4th, the genetic transformation of transgenic arabidopsis and PCR Molecular Identifications

Arabidopsis thaliana transformation method is infected using colored method is dipped in：Positive GV3101 bacterial strains obtained above are expanded into culture, inoculation In 5mL LB/ (Rif of ten Kan of Gen ten) fluid nutrient medium, 28 DEG C, 250r/min shaken cultivations are stayed overnight.Next day adds 300mL LB/ (Rif of ten Kan of Gen ten) fluid nutrient medium, 28 DEG C, 250rpm shaken cultivations 16-20h, 4500rpm centrifugation 10min is abandoned Clearly, thalline is collected, is suspended with 300mL transformation of Arabidopsis thaliana Buffer (1/2MS)；Will be southern in vigorous and more bud plan is grown Mustard inflorescence is inverted, and immersion infects 60s in the Agrobacterium containing recombinant plasmid, careful to take out, and flicks off unnecessary liquid；Use preservative film Sealing, is inverted in light culture and stays overnight, Kei removes preservative film after 24h-48h, normal culture.About after two weeks to one month, harvest Mature seed.Harvest seed is placed in 4 DEG C, sowed after 48h vernalization, normal culture.Herbicide when length is to 2-3 piece true leaves Basta (1000 times of dilution) carries out sprinkling Screening Treatment, and T0 is obtained after being screened through 3-4 times for resistant plant.It is anti-to what is filtered out Property plant using CTAB methods extract arabidopsis thaliana genomic dna.PCR results, some positive regeneration are detected with agarose gel electrophoresis (1 is the result of amplification cloning vector to the PCR results of plant as shown in Figure 5；2 be the result of non-transgenic arabidopsis；3-10 is to turn Enter the result of GhEDR2 gene arabidopsis).These PCR results show that gene is had been integrated into the genome of Arabidopsis plant.

5th, Disease Resistance Identifications of the GhEDR2 transgenic arabidopsis T1 with plant

Disease Resistance Identification is carried out after arabidopsis grows 1 month, bacterial strain uses therefor is respectively defoliation High pathogenicity verticillium wilt Bacterium V991, after pathogen activates through PDA plate, Cha Shi nutrient solutions, 25 DEG C, 180rmin trainings are put into from colony edge picking fungus block 5-6d is supported, filtered through gauze nutrient solution is used, microscopy is simultaneously counted with blood counting chamber.Inoculation method is to embrace sub- suspension liquid irrigating root in seedling stage Method, it is 1 × 10 that per basin, subnumber is embraced in inoculation⁷, the identification strain number of each every kind of pathogen of transgenic line need to be more than 24 plants, after inoculation A situation arises for observation disease daily, and disease symptom just can be substantially seen after 14 days, yellowing leaf is mainly shown as, withered It is listless, delayed growth.Disease refers to be identified according to following standard, 0 grade：Disease-free plant；1 grade：The plant of 0.1%-25% blades morbidity Strain；2 grades：The plant of 25%-50% blades morbidity；3 grades：The plant of 50%-75% blades morbidity；4 grades：75% is sent out with blade The plant of disease, disease index=(each sick level diseased plant number and corresponding sick level)/(investigation total strain number × 4) × 100%, plants to transgenosis The Disease Resistance Identification result of thing shows, after verticillium wilt pathogen is inoculated with 15 days (as shown in Figure 6), and 5 transgenic lines are averaged Disease refers to only 17.3%, and compares and reach 50.8%；It is inoculated with verticillium wilt after 20 days (as shown in Figure 7), 5 transgenic lines are put down Equal disease refers to only 34.8%, and compares and reach 90.2%.The incidence of disease of transgenic arabidopsis strain is significantly lower than control.From turn The Disease Resistance Identification result of GhEDR2 gene arabidopsis can draw, process of the upland cotton GhEDR2 genes in arabidopsis resisting verticillium In play an important role, can also infer that GhEDR2 genes can be applied in other plant resisting verticillium, such as it is dicotyledonous plant Thing and monocotyledon, particularly arabidopsis, cotton and corn.

<110>Cotton Research Institute, Shanxi Academy of Agricultural Sciences

<120>CottonGhEDR2Gene and its encoding proteins and application

<160>2

<210>1

<211>2449

<212>DNA

<213>Cotton

<221>CDS

<222>（1）…（2449）

<400>1

atgattttat ttttactgat agtgacctgt tcgttgcaac aaattgatga gcaatgcttt 60

tttataatgc caactttgta caaaaaagca ggcttcatgg cgggatcagg cgatggagga 120

aacgagagag aggtgttgga agacagcatc aatcacagta gcagtttttc tagacatagg 180

tatagacgaa gcatgagctc cggcgaagaa gacaagggac ttttagcatt ttccgggtgg 240

gtgtatcatg taggaaccaa ttcgattggc catgagtatt cccatcaacg cttcttatat 300

gtaaaaggga aatatgttga gatgtataga agagatcctc aggagaaccc cggcattcga 360

cctattagga agggtatcat aggacctaca ctaatggtgg aggagacagg gagtcgaaaa 420

gtcggtaatg aggaactcta cactatacaa ttttacaatc gattagatga gactaagaaa 480

ggagaaattg cttgtacctc ggctgaagaa tctaaaaaat ggatagaggc attggactat 540

gccaagcaac aggctgaata tgagctttca agaggaggtg gtgccagaaa caaattaagc 600

ctggaggctg atattgattt ggaaggccat cgacctcgag tacggcggta tgcatctgga 660

ttaaaaaagc ttataagaat tggtggaggt ccagagttgc tttcacggtc aagctcaagc 720

ttgggtacag gttcatcaga tggagacttt gaaggggagt ttggagatgc agttgaagca 780

catgaatgga aatgtgtgcg tacgatcaat ggtgttagaa tccttgagga tgtggctgat 840

ggaaagggtg ggaaagcttc tctggtaaag gctgttgctc ctgtagatgc aagcgcagat 900

actgttttag aagtaatctt aaatctggat cgccataaga gatacgagtg ggatatgctg 960

acaggggact tggagctggt agattcttat gatggaaact atgatgttgt ctatggaaca 1020

tatgatccta aatatcttgg tcgatggcaa tccaagagag attttgtctt ctccaggcaa 1080

tggtttcaag ggcaggatgg agcatacaca attttgcaat ttcctgctgc acataagaag 1140

cgtcctacaa gaaatggata ccaacgaaca tcaattaaac catctacttg ggagattaga 1200

agtttaacca atgaaaaatg ccttgtaaca catatgttgg agatgaatgc tgccggatgg 1260

ggtcgatgga agaaaagtag tagctgctca aagtttgaaa agaccattcc attcgcctta 1320

ttatcccaag ttgcaggttt aaaggaatat attggagcaa atccatcgct caaatgtgaa 1380

ccttcctccc tggcattgca ttcaaaacat tctgaaggcg atccgccaga tgaattctat 1440

gatgcagttg ctggtgactc atcttcaaca tcagaagatg gagagagcga tgatgaatca 1500

gagaaggagg aaaaaccaat taagcagaag cctgcaccag cggccatctc aagcacagct 1560

ttgaagcaag cttcagatgc agctgaaaat gcaagtaagg aattagatct tagtgtacct 1620

cctattcatg ttgatccaag tcaattcaac agtgttctcc ataaaggaaa ggatgatgct 1680

gacacaaatt gttggacttc tcctggtggt gcgggattta tgataagagg acagacatac 1740

ttaaaaaata gtgccaagat aatgggtgga aagccccttc tcaagctcat agctgttgat 1800

tggttcaaag tcgataaagc aacagataaa attgcattgc atccaaagag tctagctcag 1860

tctgatgccg gaaaaaatct tccatttatc cttgtgatta atctcgagat tcctgcaaaa 1920

ccaaactata gtttggtcct ctaccatgct gctgaaaggc cagtgaggaa agattcttta 1980

ctggaaaagt ttgcagatgg aacggatcaa tttcgtgatg caagatttaa attgatacca 2040

agcattgttg aggggtattg gatggtcaag cgtgcagttg gaacaaaagc ttgcctactt 2100

gggaaagctg ttacatgcaa atatttcagg caagacaatt ttctggagat tgacgtggac 2160

attgggtcat catctgtagc gagaagtgtt atcggccttg tccttggata tgtcacaagc 2220

ttagttgtgg atcttgcaat actaatagag gcaaatgacg cggcagaatt gcctgagtac 2280

attctgggca gtgttcgact gaatcgtgtg aggcttgaat ctgctgtacc actggatggg 2340

gacccagctt tcttgtacaa agttggcatt ataagaaagc attgcttatc aatttgttgc 2400

aacgaacagg tcactatcag tcaaaataaa atcattattg ccatccagc 2449

<210>2

<211>816

<212>PRT

<213>Cotton

<222>（1）…（816）

<400>2

MetIleLeuPheLeu LeuIleValThrCys SerLeuGlnGlnIle AspGluGlnCysPhe 20

PheIleMETProThr LeuTyrLysLysAla GlyPheMetAlaGly SerGlyAspGlyGly 40

AsnGluArgGluVal LeuGluAspSerIle AsnHisSerSerSer PheSerArgHisArg 60

TyrArgArgSerMet SerSerGlyGluGlu AspLysGlyLeuLeu AlaPheSerGlyTrp 80

ValTyrHisValGly ThrAsnSerIleGly HisGluTyrSerHis GlnArgPheLeuTyr 100

ValLysGlyLysTyr ValGluMetTyrArg ArgAspProGlnGlu AsnProGlyIleArg 120

ProIleArgLysGly IleIleGlyProThr LeuMetValGluGlu ThrGlySerArgLys 140

ValGlyAsnGluGlu LeuTyrThrIleGln PheTyrAsnArgLeu AspGluThrLysLys 160

GlyGluIleAlaCys ThrSerAlaGluGlu SerLysLysTrpIle GluAlaLeuAspTyr 180

AlaLysGlnGlnAla GluTyrGluLeuSer ArgGlyGlyGlyAla ArgAsnLysLeuSer 200

LeuGluAlaAspIle AspLeuGluGlyHis ArgProArgValArg ArgTyrAlaSerGly 220

LeuLysLysLeuIle ArgIleGlyGlyGly ProGluLeuLeuSer ArgSerSerSerSer 240

LeuGlyThrGlySer SerAspGlyAspPhe GluGlyGluPheGly AspAlaValGluAla 260

HisGluTrpLysCys ValArgThrIleAsn GlyValArgIleLeu GluAspValAlaAsp 280

GlyLysGlyGlyLys AlaSerLeuValLys AlaValAlaProVal AspAlaSerAlaAsp 300

ThrValLeuGluVal IleLeuAsnLeuAsp ArgHisLysArgTyr GluTrpAspMetLeu 320

ThrGlyAspLeuGlu LeuValAspSerTyr AspGlyAsnTyrAsp ValValTyrGlyThr 340

TyrAspProLysTyr LeuGlyArgTrpGln SerLysArgAspPhe ValPheSerArgGln 360

TrpPheGlnGlyGln AspGlyAlaTyrThr IleLeuGlnPhePro AlaAlaHisLysLys 380

ArgProThrArgAsn GlyTyrGlnArgThr SerIleLysProSer ThrTrpGluIleArg 400

SerLeuThrAsnGlu LysCysLeuValThr HisMetLeuGluMet AsnAlaAlaGlyTrp 420

GlyArgTrpLysLys SerSerSerCysSer LysPheGluLysThr IleProPheAlaLeu 440

LeuSerGlnValAla GlyLeuLysGluTyr IleGlyAlaAsnPro SerLeuLysCysGlu 460

ProSerSerLeuAla LeuHisSerLysHis SerGluGlyAspPro ProAspGluPheTyr 480

AspAlaValAlaGly AspSerSerSerThr SerGluAspGlyGlu SerAspAspGluSer 500

GluLysGluGluLys ProIleLysGlnLys ProAlaProAlaAla IleSerSerThrAla 520

LeuLysGlnAlaSer AspAlaAlaGluAsn AlaSerLysGluLeu AspLeuSerValPro 540

ProIleHisValAsp ProSerGlnPheAsn SerValLeuHisLys GlyLysAspAspAla 560

AspThrAsnCysTrp ThrSerProGlyGly AlaGlyPheMetIle ArgGlyGlnThrTyr 580

LeuLysAsnSerAla LysIleMetGlyGly LysProLeuLeuLys LeuIleAlaValAsp 600

TrpPheLysValAsp LysAlaThrAspLys IleAlaLeuHisPro LysSerLeuAlaGln 620

SerAspAlaGlyLys AsnLeuProPheIle LeuValIleAsnLeu GluIleProAlaLys 640

ProAsnTyrSerLeu ValLeuTyrHisAla AlaGluArgProVal ArgLysAspSerLeu 660

LeuGluLysPheAla AspGlyThrAspGln PheArgAspAlaArg PheLysLeuIlePro 680

SerIleValGluGly TyrTrpMetValLys ArgAlaValGlyThr LysAlaCysLeuLeu 700

GlyLysAlaValThr CysLysTyrPheArg GlnAspAsnPheLeu GluIleAspValAsp 720

IleGlySerSerSer ValAlaArgSerVal IleGlyLeuValLeu GlyTyrValThrSer 740

LeuValValAspLeu AlaIleLeuIleGlu AlaAsnAspAlaAla GluLeuProGluTyr 760

IleLeuGlySerVal ArgLeuAsnArgVal ArgLeuGluSerAla ValProLeuAspGly 780

AspProAlaPheLeu TyrLysValGlyIle IleArgLysHisCys LeuSerIleCysCys 800

AsnGluGlnValThr IleSerGlnAsnLys IleIleIleAlaIle Gln 816

Claims (7)

1. cottonGhEDR2Gene, it is characterised in that the base sequence of the gene is SEQ ID NO.1；The gene is used for Plant is improved to resistance to verticillium wilt.

2. cottonGhEDR2The albumen of gene code, it is characterised in that the amino acid sequence of the albumen is SEQ ID NO.2.

3. the recombinant vector containing gene described in claim 1.

4. recombinant vector according to claim 3, it is characterised in that the recombinant vector is in pIP101 polyclonal position The recombinant vector that encoding gene described in point insertion claim 1 is obtained.

5. a kind of method cultivated to the genetically modified plants of resistance to verticillium wilt, it is characterised in that the restructuring for obtaining claim 4 Vector introduction cultivates the genetically modified plants that screening obtains improving resistance to verticillium wilt into plant.

6. the method according to claim 5 for cultivating resistance to verticillium wilt genetically modified plants, it is characterised in that described plant For dicotyledon and monocotyledon.

7. the method for the genetically modified plants according to claim 6 for cultivating resistance to verticillium wilt, it is characterised in that described plant Thing is arabidopsis, cotton and corn.