CN108165573B

CN108165573B - Chloroplast genome editing method

Info

Publication number: CN108165573B
Application number: CN201711287309.3A
Authority: CN
Inventors: 朱健康; 王东; 华凯; 刘志红
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2016-12-07
Filing date: 2017-12-07
Publication date: 2022-01-14
Anticipated expiration: 2037-12-07
Also published as: WO2018103686A1; CN108165573A

Abstract

The invention provides a chloroplast genome editing method. In particular, the invention provides CRISPR technology-based nucleic acid constructs, vectors, or vector combinations for site-directed editing of plant genomes, and methods for site-directed editing of plant genomes. The nucleic acid constructs of the invention include a nucleic acid construct of formula I comprising a chloroplast localization signal peptide-nuclease expression cassette and/or a nucleic acid construct of formula II comprising a ncRNA-sgRNA expression cassette. By using the method, nuclease and corresponding sgRNA can be introduced into chloroplast, so that gene knockout, homologous recombination and directional insertion of an exogenous fragment can be conveniently and efficiently carried out at a predetermined chloroplast genome site. The method of the invention can be used for improving the crop traits from the chloroplast genome level.

Description

Chloroplast genome editing method

Technical Field

The invention relates to the field of biotechnology, in particular to RNA-guided plant chloroplast genome editing.

Background

The existing chloroplast genome editing technology mainly depends on a gene gun technology, exogenous DNA is inserted into the chloroplast genome of plants through a homologous recombination method, and chloroplast transgenic plants which are stably inherited can be obtained only in a few plants. In addition, chloroplast transformation based on homologous recombination did not result in double-stranded DNA damage on the chloroplast genome. The newly emerging crispr (clustered regulated short genomic repeats) technology is widely used for editing plant nuclear genomes by bringing a DNA endonuclease, such as Cas9, into a DNA region matching an RNA sequence for cleavage by RNA.

As the chloroplast genome of plants has not been edited based on CRISPR technology, there is an urgent need in the art to develop a simple and efficient method for editing chloroplast genome.

Disclosure of Invention

The purpose of the present invention is to provide a method for highly versatile, highly specific, and efficient gene editing of plant chloroplasts.

In a first aspect of the invention, there is provided a nucleic acid construct selected from the group consisting of:

(1) a nucleic acid construct of formula I:

X1-X2-X3-X4-X5 (I)

in the formula (I), the compound is shown in the specification,

x1 is a promoter element;

x2 is a chloroplast localization signal peptide element;

x3 is a nuclease element;

x4 is a null or marker gene element;

x5 is a terminator;

(2) a nucleic acid construct of formula II:

Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)

in the formula (I), the compound is shown in the specification,

y1 is a promoter element;

y2 is a ncRNA element;

y3 is a null or marker gene element;

y4 is no or an RNA cleaving enzyme element;

ya and Yb are each independently a zero or RNA cleaving enzyme recognition element;

y5 is a sgRNA element;

y6 is a terminator;

(3) a construct comprising a construct of formula I and a construct of formula II.

In another preferred embodiment, the structures of formula I and formula II are in the 5 'to 3' direction.

In another preferred embodiment, said X1 is selected from: 35S, UBQ.

In another preferred embodiment, said X2 is selected from: infA, RbcS.

In another preferred embodiment, said X4 is selected from the group consisting of: GFP, YFP, RFP.

In another preferred embodiment, the X5 is a Nos terminator.

In another preferred embodiment, Y1 is the 35S promoter.

In another preferred embodiment, said Y3 is selected from the group consisting of: GFP, YFP, RFP.

In another preferred example, the Ya is a Csy4 recognition sequence.

In another preferred example, the Yb is a Csy4 recognition sequence.

In another preferred example, the Y6 is an Nos terminator.

In another preferred embodiment, the nuclease element X3 in the nucleic acid construct of formula I is selected from the group consisting of:

(1)Cas9；

(2)Cpf1；

(3) zinc Finger Nucleases (ZFNs);

(3) transcription activator-like nucleases (TALENS);

(4) meganuclease (meganuclease);

or a combination thereof.

In another preferred embodiment, the chloroplast localization signal peptide element X2 of the nucleic acid construct of formula I is the chloroplast signal peptide infA.

In another preferred embodiment, the ncRNA element Y2 in the nucleic acid construct of formula II is from a viroid, or a virus.

In another preferred embodiment, the ncRNA element sequence in the nucleic acid construct of formula II is as shown in SEQ ID No. 5.

In another preferred embodiment, the RNA cleaving enzyme element Y4 in the nucleic acid construct of formula II is Csy 4.

In another preferred example, the sequence of Csy4 is shown in SEQ ID No. 6.

In another preferred embodiment, the sgRNA element Y5 in the nucleic acid construct of formula II is spCas9 sgRNA.

In another preferred embodiment, the Y5 is shown in SEQ ID No. 8 or 9.

In a second aspect of the invention, there is provided a vector or combination of vectors comprising a nucleic acid construct according to the first aspect of the invention.

In another preferred embodiment, the nucleic acid construct of formula I and the nucleic acid construct of formula II are located on separate vectors.

In another preferred embodiment, the nucleic acid construct of formula I and the nucleic acid construct of formula II are located on the same vector.

In a third aspect of the invention, there is provided a reagent combination comprising:

(i) a vector or combination of vectors according to the second aspect of the invention.

In a fourth aspect of the present invention, there is provided a method for editing a plant chloroplast gene, comprising the steps of:

(i) introducing (a) a vector or a combination of vectors according to the second aspect of the invention and (b) optionally a donor nucleic acid fragment into a plant cell, plant tissue or plant (plant) to produce gene editing in said plant cell, plant tissue or plant; and

(ii) optionally, the plant cell or plant in which the gene editing occurs is detected, screened or identified.

In another preferred example, the method further comprises:

(iii) (iii) regenerating or culturing the plant cells, plant tissues or plants identified in step (ii) as having undergone said gene editing.

In another preferred embodiment, the gene editing comprises gene knockout, site-directed insertion, gene replacement, or a combination thereof.

In another preferred embodiment, said targeted insertion comprises a site-directed insertion based on homologous recombination or non-homologous recombination end-joining.

In another preferred embodiment, the gene editing comprises single-site or multi-site gene editing.

In another preferred embodiment, the introduction is by Agrobacterium.

In another preferred embodiment, the introduction is by gene gun.

In another preferred embodiment, the introduction is by microinjection, electroporation, ultrasonication, and polyethylene glycol (PEG) mediated introduction.

In another preferred embodiment, the plant is selected from the group consisting of: crops, trees and flowers.

In another preferred embodiment, the plant is selected from the group consisting of: gramineae, leguminous plants and crucifers.

In another preferred embodiment, the plant comprises: arabidopsis, wheat, barley, oats, maize, rice, sorghum, millet, soybeans, peanuts, tobacco, and tomatoes.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features described in detail below (e.g., examples) can be combined with each other to constitute a new or preferred technical solution. Not to be reiterated herein, but to the extent of space.

Drawings

Figure 1 shows the mutation of GFP in chloroplasts with CRISPR/Cas 9;

(A) the plasmid map used is shown. The vector used was the 35S promoter (P35S) and nos terminator (Tnos). The signal peptide of infA (TPinfA) and a non-coding rna (ncrna) on the viroid were used to bring Cas9 and sgRNA from Streptococcus pyogenes (Streptococcus pyogenes) to the chloroplast.

(B) The Cas9-GFP fusion protein (upper panel) and GFP mRNA (lower panel) are shown to be transported into the chloroplasts.

(C) Mutation of the aadA16gfp gene on the chloroplast genome by CRISPR/Cas9 is shown. 2 sgRNA targets (sgRNA1 and sgRNA2) used in the experiment; with 2 vectors: cas9 with chloroplast signal peptide infA driven by the 35S promoter and sgRNA2 with Csy4 and 2 Csy4 recognition sites, non-coding RNA guided by the 35S promoter, were transiently transformed into pMSK56 plants (lower panel) and without transformation vector (upper panel), and fluorescence microscopy pictures were taken.

(D) It was shown that the number of GFP proteins in chloroplasts of the plants transformed with CRISPR/Cas9pMSK56 was less than that of the untransformed plants. Plants transformed with sgRNA1 and sgRNA2 were designated Cas9_ PT1 and Cas9_ PT 2. Protein extracted from chloroplasts of Nicotiana tabacum (tobacco) was used as wild type control (WT). BiP proteins located on the endoplasmic reticulum are used as cytoplasmic markers; the Toc75 protein located on the chloroplast outer membrane (position indicated by arrow) was used as a chloroplast marker. The loading was 30 micrograms of protein per sample. (scale: 10 μm).

FIG. 2 shows the extraction of intact chloroplasts from 2 model plants. Western blot results of tobacco (A) and Arabidopsis (B). The arrow marks the position of the Toc75 specific protein. Proteins were extracted from the leaves and intact chloroplasts, respectively. For leaf, the loading was 20 micrograms of protein; for chloroplasts, the loading was 30 micrograms of protein.

Fig. 3 shows sequencing validation of circularized reverse transcription PCR products of sgRNA1 and sgRNA 2. sequence chromatography of circularized reverse transcription PCR products of sgRNA1 and sgRNA2, 3 independent clones each were tested.

FIG. 4 shows the sequencing results found that there was an inserted DNA fragment in aadA16GFP in pMSK56 plants transformed with sgRNA2 (FIG. 4A); PCR confirmed that only the chlorophyll DNA of pMSK56 plants transformed with sgRNA2 could be amplified to bands (fig. 4B).

Fig. 5 shows the use of CRISPR/Cas9 to reduce the expression of the aadA16gfp gene on the chloroplast genome. Cas9(dCas9) expression without nuclease activity is detected in CRISPR/Cas9T1 generation transgenic plants (aadA16gfp T1-1-aadA 16gfp T1-5) of pMSK 56. The expression level of GFP in the plants with high expression level of dCas9 protein is low. pMSK56 plants without CRISPR/Cas9 served as control, i.e. control.

FIG. 6 shows the targeted reduction of the expression of rpl33 in Arabidopsis thaliana. (A) Plasmid map used in the experiments. PUBQ and TUBQ represent the promoter and terminator of AtUBQ1, respectively. (B) The rpl33 gene on the chloroplast genome of arabidopsis var2 plants was knockdown by the CRISPR/Cas9 system. The 2 sgRNAs used in this experiment target the template strand (T) and non-template strand (NT) of the rpl33 gene, respectively. CK is represented from var2 plants transformed with only CRISPR/Cas9 system without sgRNA. Arabidopsis var2T1 generation plants containing sgRNA-targeting rpl33 template strand and sgRNA-targeting rpl33 non-template strand CRISPR/Cas9 vector were labeled 33T and 33NT, respectively. Plants with restored and non-restored leaf variegated phenotype caused by var2 were labeled S and NS, respectively.

FIG. 7 shows that targeted reduction of rpl33 expression can restore the var2 mutation-mediated leaf mottle phenotype. From left to right, arabidopsis var2 plants were transformed without sgRNA, sgRNA-targeting rpl33 template strand and sgRNA-targeting rpl33 non-template strand CRISPR/Cas9 vector, respectively. The grey arrows indicate plants that have restored the leaf mottle phenotype by targeted reduction of the expression of rpl 33.

Detailed Description

The present inventors have made extensive and intensive studies and, for the first time, have constructed a chloroplast genome site-directed editing system based on CRISPR technology, and a nucleic acid construct, vector or vector combination for chloroplast genome site-directed editing, and a chloroplast genome site-directed editing method. The method of the present invention can perform gene knockout or homologous recombination and targeted insertion of foreign fragments in a predetermined plant genomic site simply and efficiently. The present invention has been completed based on this finding.

Typically, the nuclease in the CRISPR editing system of the invention adopts Cas9 protein to bring Cas9 protein into chloroplast through chloroplast signal peptide infA; knockout of genes on the chloroplast genome is achieved by bringing sgrnas (e.g., spCas9 sgrnas) into the chloroplast using non-coding rnas (ncrnas), e.g., ncrnas from viroids. Compared with the traditional gene gun technology, the method disclosed by the invention not only reduces the operation difficulty, improves the efficiency and accuracy of chloroplast gene fixed-point editing, but also reduces the operation cost. In addition, the method of the present invention can be effectively applied to plant varieties that cannot be transformed by a gene gun.

Term(s) for

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and other references mentioned herein are incorporated herein by reference.

As used herein, the terms "comprising," having, "or" including "include" comprising, "" consisting essentially of … …, "" consisting essentially of … …, "and" consisting of … ….

The term "operably linked" or "operably linked" as used herein refers to the condition in which certain portions of a linear DNA sequence are capable of modulating or controlling the activity of other portions of the same linear DNA sequence. For example, a promoter is operably linked to a coding sequence if it controls the transcription of that sequence.

Nucleic acid constructs and methods for site-directed nuclease-based editing of plant genomes

The invention provides a nucleic acid construct selected from the group consisting of:

(1) a nucleic acid construct of formula I:

X1-X2-X3-X4-X5 (I)

in the formula (I), the compound is shown in the specification,

x1 is a promoter element;

x2 is a chloroplast localization signal peptide element;

x3 is a nuclease element;

x4 is a null or marker gene element;

x5 is a terminator;

(2) a nucleic acid construct of formula II:

Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)

in the formula (I), the compound is shown in the specification,

y1 is a promoter element;

y2 is a ncRNA element;

y3 is a null or marker gene element;

y4 is no or an RNA cleaving enzyme element;

ya and Yb are non-or RNA cutting enzyme recognition elements;

y5 is a sgRNA element;

y6 is a terminator;

In the above structural formulae, "-" represents a bond.

In the present invention, each of the above elements can be prepared by a conventional method (e.g., PCR method, artificial total synthesis) and then ligated by a conventional method to form the nucleic acid construct of the present invention. If desired, an enzymatic cleavage reaction may optionally be carried out prior to the ligation reaction.

In addition, the nucleic acid constructs of the invention may be linear or circular. The nucleic acid construct of the present invention may be single-stranded or double-stranded. The nucleic acid constructs of the invention may be DNA, RNA, or DNA/RNA hybrids.

As used herein, "marker gene" refers to a gene used in a gene editing process to screen cells for successful gene editing, and marker genes that can be used in the present application are not particularly limited, and include various marker genes commonly used in the field of gene editing, representative examples include (but are not limited to): green Fluorescent Protein (GFP), Yellow Fluorescent Protein (YFP), hygromycin resistance gene (Hyg), kanamycin resistance gene (NPTII), neomycin gene, or puromycin resistance gene.

As used herein, the term "plant promoter" refers to a nucleic acid sequence capable of initiating transcription of a nucleic acid in a plant cell. The plant promoter may be derived from plants, microorganisms (such as bacteria, viruses) or animals, or may be a promoter artificially synthesized or modified. Representative examples include (but are not limited to): 35S promoter.

The term "plant terminator" as used herein refers to a terminator capable of stopping transcription in a plant cell. The plant transcription terminator can be derived from plants, microorganisms (such as bacteria and viruses) or animals, or is a synthetic or modified terminator. Representative examples include (but are not limited to): nos terminator.

As used herein, the term "signal peptide" refers to a short peptide chain of a newly synthesized protein that is transferred to the secretory pathway. Representative examples include (but are not limited to): infA signal peptide.

As used herein, typically, the nuclease element X3 in the nucleic acid construct of formula I is selected from the group consisting of:

(1)Cas9；

(2)Cpf1；

(3) zinc Finger Nucleases (ZFNs);

(3) transcription activator-like nucleases (TALENS);

(4) meganuclease (meganuclease);

or a combination thereof.

The term "nuclease element" as used herein refers to a nucleotide sequence that encodes a nuclease with cleavage activity. In the case where the inserted polynucleotide sequence is transcribed and translated to produce a functional nuclease, one of skill will recognize that, because of the degeneracy of the codons, a large number of polynucleotide sequences can encode the same polypeptide. In addition, the skilled artisan will recognize that different species have certain preferences for codons, that codons for nucleases can be optimized, possibly according to the requirements for expression in different species, and that such variants are specifically covered by the term "nuclease element".

Furthermore, the term "nuclease element" specifically includes full-length sequences substantially identical to Cas9 and/or Cpf1 gene sequences, as well as sequences encoding proteins that retain the function of Cas9 and/or Cpf1 proteins.

Typically, the term "nuclease element" is the coding sequence of the Cas9 protein from Streptococcus pyogenes (Streptococcus pyogenes).

Preferably, the chloroplast localization signal peptide element X2 of the nucleic acid construct of formula I of the present invention is the chloroplast signal peptide infA.

Typically, the ncRNA element Y2 in the nucleic acid constructs of formula II of the present invention is from a viroid.

Preferably, the ncRNA element sequence in the nucleic acid construct of formula II according to the invention is as shown in SEQ ID No. 5.

Typically, the RNA cleaving enzyme element Y4 in the nucleic acid construct of formula II of the present invention is Csy 4.

Preferably, the sequence of Csy4 is shown as SEQ ID No. 6.

Typically, the sgRNA element Y5 in the nucleic acid constructs of formula II of the invention is spCas9 sgRNA.

Preferably, the sgRNA sequence of the invention is shown in SEQ ID No. 8 or 9.

The invention also provides a vector or vector combination comprising a nucleic acid construct of the invention.

Preferably, the nucleic acid construct of formula I and the nucleic acid construct of formula II according to the invention are located on the same vector.

Some elements are operably linked in the nucleic acid constructs and/or vectors of the invention. For example, a promoter, when operably linked to a coding sequence, means that the promoter is capable of initiating transcription of the coding sequence.

The invention also provides a reagent combination and a kit containing the vector or the vector combination, which can be used for the plant chloroplast gene editing method.

The invention also provides a plant chloroplast gene editing method, which comprises the following steps:

(i) introducing (a) a vector or combination of vectors of the invention and (b) optionally a donor nucleic acid fragment into a plant cell, plant tissue or plant, thereby producing gene editing in said plant cell, plant tissue or plant; and

In the present invention, the gene editing includes gene knockout, site-specific insertion, gene replacement, or a combination thereof.

The plant gene editing method can be used for improving various plants, particularly for improving crops.

As used herein, the term "plant" includes whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, and plant cells and progeny of same. The type of plant that can be used in the method of the invention is not particularly limited and generally includes any higher plant type that can be subjected to transformation techniques, including monocotyledonous, dicotyledonous and gymnosperms.

The main advantages of the invention are:

(1) the CRISPR technology is utilized for the first time to cause effective double-stranded DNA cutting and gene editing on a chloroplast genome;

(2) the cost and difficulty of chloroplast gene editing are effectively reduced;

(3) the breadth of chloroplast gene editing species is greatly expanded.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight. The experimental materials referred to in the present invention are commercially available without specific reference.

Material

The Arabidopsis thaliana material used in the experiment was wild type Col-0. Disinfecting Col-0 seeds with 5% sodium hypochlorite, sowing on 1/2MS solid culture medium, treating at 4 deg.C for three days, culturing in light incubator (22 deg.C, 16hrs light/8 hrs dark) for 10-14 days, transplanting to nutrient soil, and culturing in greenhouse.

The tobacco used in the experiment is wild Nicotiana tabacum (tobacco) and a chloroplast transgenic plant pMSK56 taking Nicotiana tabacum as a receptor (aadAgFP fusion gene is coded on the chloroplast genome of pMSK 56). The pMSK56 transgenic plant is a conventional tobacco plant (Khan and Maliga, 1999). Seeds of Nicotiana tabacum and pMSK56 were sown in nutrient soil, cultured in a greenhouse (26 ℃ for 16hrs illumination/8 hrs) for about 10 days, individual seedlings were transplanted into nutrient soil, and cultured for about 3 weeks under the same conditions for transient transformation experiments.

Method

Target site design

For the SpCas9 protein, the PAM sequence is required to be 5 ' -NGG-3 ', so the appropriate target site on the chloroplast genome is 5 ' -N₂₀NGG-3’。

Vector construction

Construction of pCam1300-35S-ncRNA-GFP and pCam1300-35S-ncRNA-GFP-spsgRNA vectors

In the experiment, the sequence of ncRNA introduced into chloroplast is referred to (G Lou mez and Pall as, 2010), and the sequence is artificially synthesized and then is connected into a commercial pUC57 vector to obtain pUC 57-ncRNA. The ncRNA sequence, GFP coding sequence and spsgRNA skeleton are respectively obtained by amplifying pUC57-ncRNA, pGWB505 and pCas9(AtU6) vectors, the ncRNA-GFP and the ncRNA-GFP-spsgRNA can be sequentially connected together by a stacking PCR method, PCR products are recovered, and after digestion with XmaI and BamHI, the vectors pCam1300-35S-ncRNA-GFP and pCam 1300-35S-ncRNA-sgRNA are obtained between a 35S promoter (SEQ ID No.:1) and an NOS terminator (SEQ ID No.:2) which are connected into the pCam1300-35S vectors.

Nucleotide sequence SEQ ID No. 1

TCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACC AAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATC TGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAA GGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGG AAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATAACATGGTGGAGCACGACACA CTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAG GGTGATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAA AGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGAC AGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTC AAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAG ACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGACCTCAACACAACATATACAAAAC AAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCAAAAG CAATTTTCTGAAAATTTTCACCATTTACGAACGATA

Nucleotide sequence SEQ ID No. 2

TGATTGATCGATAGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGAT TGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATT AACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATA CGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAG ATCGG

Construction of pCam1300-35S-infA-Cas9-GFP vector

The chloroplast localization signal infA (SEQ ID No.:3) was amplified from an Arabidopsis cDNA library. Cas9, GFP (SEQ ID No.:4) coding sequence from vector pCas9(AtU6), pGWB505 amplification respectively, infA, Cas9, GFP three fragments through Gibson assembly method into pCam1300-35S vector between the 35S promoter and NOS terminator to get pCam1300-35S-infA-Cas9-GFP vector.

Nucleotide sequence SEQ ID No. 3

ATGCTTCAACTCTGCTCCACTTTCCGTCCTCAACTTCTTCTTCCTTGTCAATTCCGATTTACAAAT GGCGTTTTGATTCCCCAAATAAACTATGTTGCAAGCAATTCAGTTGTGAATATCCGGCCAATGATACGATG CCAGAGAGCAAGCGGAGGAAGAGGAGGAGCTAATAGAAGCAAA

Nucleotide sequence SEQ ID No. 4

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAA GTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGC AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTAC GTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACA AGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTG AACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGAC GAGCTGTACAAGTAA

Construction of pCam1300-35S-infA-Cas9 vector

The NOS terminator was amplified from pCam1300-35S vector using a primer having a stop codon at the 5' -end of the upstream primer, and the PCR product was recovered and digested with BamHI and EcoRI. Then, the GFP gene and NOS terminator were excised from the pCam1300-35S-infA-Cas9-GFP vector with BamHI and EcoRI, and the fragments were recovered and ligated with the above-recovered NOS terminator to obtain pCam1300-35S-infA-Cas9 vector.

Construction of pCam1300-35S-ncRNA-Csy4-sgRNA vector

The Csy4 gene (SEQ ID No.:6) with a 3 XFrag tag at the C-terminus was artificially synthesized and ligated into a pUC57 vector to obtain pUC57-Csy 4. ncRNA sequence (SEQ ID No.:5), Csy4-3 xFrag coding region, sgRNA skeleton from pUC57-ncRNA, pUC57-Csy4, pCas9(AtU6) vector amplification. The sgRNA backbone was flanked by 20nt Csy4 recognition sites (SEQ ID No.: 7). Two additional AarI cleavage sites were added downstream of the Csy4-3 xFrag coding region. The ncRNA sequence, the Csy4-3 xFrag coding region and the sgRNA framework are sequentially connected together by a method of overlapping PCR, and a PCR product is recovered, digested by XmaI and BamHI and then connected between a 35S promoter and an NOS terminator in a pCam1300-35S vector.

Nucleotide sequence SEQ ID No. 5

TTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGAG GTCGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTT AAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTG GTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCG TCGACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCC

Nucleotide sequence SEQ ID No. 6

ATGGACCACTATCTGGACATCAGACTGAGGCCCGATCCTGAGTTCCCTCCCGCCCAGCTGATGAGC GTGCTGTTTGGCAAGCTGCATCAGGCTCTGGTCGCCCAAGGCGGAGACAGAATCGGCGTGTCCTTCCCCGA CCTGGACGAGTCCCGGAGTCGCCTGGGCGAGCGGCTGAGAATCCACGCCAGCGCAGACGATCTGCGCGCCC TGCTGGCCCGGCCTTGGCTGGAGGGCCTGCGGGATCATCTGCAGTTTGGCGAGCCCGCCGTGGTGCCACAC CCAACACCCTACCGCCAGGTGAGCCGCGTGCAGGCCAAGTCAAATCCCGAGAGACTGCGGCGGAGGCTGAT GAGGCGACATGATCTGAGCGAGGAGGAGGCCAGAAAGAGAATCCCCGACACAGTGGCCAGAGCCCTGGATC TGCCATTTGTGACCCTGCGGAGCCAGAGCACTGGCCAGCATTTCAGACTGTTCATCAGACACGGGCCCCTG CAGGTTACAGCCGAGGAGGGCGGATTTACATGCTATGGCCTGTCTAAAGGCGGCTTCGTGCCCTGGTTCTA A

Nucleotide sequence SEQ ID No. 7

GTTCACTGCCGTATAGGCAG

Construction of pCam1300-UBQ-spsgRNA-35S-Cas9 vector

The promoter UBQpro and the terminator UBQTer of the UBQ1 gene (AT3G52590) are respectively amplified by taking the arabidopsis thaliana Col-0 genome as a template. Amplifying a ncRNA-Csy4-sgRNA fragment from a pCam1300-35S-ncRNA-Csy4-sgRNA vector, sequentially connecting three sections of UBQpro, ncRNA-Csy4-spsgRNA and UBQTer together by a method of overlapping PCR, digesting a PCR recovery product by HindIII and XmaI, and then connecting the PCR recovery product into a pCambia1300 vector to obtain the pCam1300-UBQ-spsgRNA vector. A35S-infA-Cas 9-NOS fragment is amplified from a pCam1300-35S-infA-Cas9 vector, and is connected into the pCam1300-UBQ-sgRNA vector by a Gibson assembly method after PCR products are recovered to obtain pCam1300-UBQ-sgRNA-35S-Cas 9.

Loading of sgRNA into the corresponding target vector

For the vectors pCam1300-35S-ncRNA-Csy4-sgRNA and pCam1300-UBQ-sgRNA-35S-Cas9, 5' -N was selected₂₀NGG-3' as a target sequence. Respectively synthesizing upstream primer GCAGN₂₀And the downstream primer AAACN₂₀And annealing the upstream primer and the downstream primer to form a short double-stranded DNA fragment with a 4nt adaptor. The vector pC am1300-35S-ncRNA-Csy4-sgRNA and pCam1300-UBQ-sgRNA-35S-Cas9 were digested with AarI enzyme for 4 hours, subjected to electrophoresis, recovered by gel cutting, and then ligated to the short-chain DNA fragment formed by annealing.

Protein transient localization assay

The vectors pCam1300-35S-ncRNA-GFP, pCam1300-35S-ncRNA-GFP-sgRNA, pCam1300-35S-infA-Cas9-GFP were transferred into Agrobacterium GV3101 competence by freeze-thaw method, Agrobacterium was cultured in 28 degrees of darkness for two days, a single clone was picked up in 5ml of LB resistance medium (50mg/L kanamycin, 25mg/L rifampicin), cultured at 28 ℃ and 240rpm for 16 hours at 1: 100 portions were transferred to a new 5ml LB resistant medium (2. mu.M acetosyringone, 10mM MES, pH 5.6) at 28 ℃, 240rpm overnight to OD ₆₀₀3. Collecting thallus at 4000rpm for 10min, and treating with 10mM MES pH 5.6 and 10mM MgCl₂Suspending thallus in 10 μm acetosyringone solution, and adjusting OD₆₀₀To 0.6-0.8. After standing for 2-3 hours at room temperature, the agrobacterium is injected to the back of the tobacco leaves with good growth state for about 4 weeks by using a 1ml medical injector without a needle. After 60-72 hours of culture, samples were taken for protein localization.

pMSK56 reporter gene aadA-GFP knockout

Selecting the 5' -N-matched aadA-GFP reporter gene₂₀The position required by the NGG-3' sequence. The corresponding sgRNA sequence was synthesized and annealed and ligated into the AarI-digested pCam1300-35S-ncRNA-Csy4-spsgRNA vector. Construction ofThe good vector together with the empty pCam1300-35S-infA-Cas9 vector was transformed into Agrobacterium GV3101 competent. In addition, in order to suppress post-transcriptional silencing by RNAi, a vector expressing p19 protein was also transferred into the competence of Agrobacterium GV 3101. Agrobacterium was cultured in the dark at 28 ℃ for two days, and a single clone was picked up in 5ml of LB-resistant medium (50mg/L kanamycin, 25mg/L rifampicin), cultured at 28 ℃ and 240rpm for 16 hours, and cultured at 1: 100 portions were transferred to a new 5ml LB resistant medium (2. mu.M acetosyringone, 10mM MES, pH 5.6) at 28 ℃ and 240rpm overnight to OD ₆₀₀3. Collecting thallus at 4000rpm for 10min, and treating with 10mM MES pH 5.6 and 10mM MgCl₂Suspending thallus in 10 μm acetosyringone solution, and adjusting OD₆₀₀To 1.5. Agrobacterium OD expressing p19₆₀₀Adjusted to 1.0. Three agrobacteria containing pCam1300-35S-ncRNA-Csy4-sgRNA, pCam1300-35S-infA-Cas9, p19 vectors were expressed at 1: 1: 1, standing at room temperature for 2-3 hours, and injecting agrobacterium into the back of the tobacco leaves with good growth state for about 4 weeks by using a 1ml medical injector without a needle. Samples were taken after 60-72 hours of incubation to observe changes in GFP signal.

Arabidopsis transformation and selection

An appropriate sgRNA sequence was selected and loaded into the pCam1300-UBQ-sgRNA-35S-Cas9 vector according to the method described above. The corresponding vector was transferred into Agrobacterium GV 3101. Selecting robust Col-0 in full-bloom stage, performing genetic transformation by flower soaking method, and harvesting to obtain T after one month of normal nursing₀And (5) seed generation. T is₀The seeds are sterilized by 5 percent sodium hypochlorite and then screened on 1/2MS plates containing 50mg/L hygromycin, and positive seedlings are transplanted into nutrient soil and placed in a greenhouse for continuous culture.

Chloroplast extraction and Western blot detection

Plant tissue was chilled in a freezer in pre-cooled 0.33M sorbitol, 20mM tricine (pH 8.4), 5mM EGTA, 5mM EDTA, 10mM NaHCO₃0.1% (w/v) BSA in a proportion of 4ml per mg

The homogenizer is broken up. Filter once with 3 layers of gauze and once again with one layer of Miracloth.Centrifuged at 2000g for 2 minutes in a 4 degree centrifuge using 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl₂，2.5mM EDTA，10mM NaHCO₃0.1% (w/v) BSA, 2mM ascorbate suspended the pellet. The suspension was centrifuged at 4 ℃ for 30 minutes on a 40/100% (v/v) Percoll (sigma) gradient (40% (v/v) Percoll solution: 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl₂，2.5mM EDTA，10mM NaHCO₃0.2% (w/v) BSA, 2mM ascorbate, 40% (v/v) Percoll; 100% (v/v) Percoll solution: 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl₂，2.5mM EDTA，10mM NaHCO₃0.2% (w/v) BSA, 2mM ascorbate, 100% (v/v). Intact chloroplasts were collected in the middle of two Percoll gradients and 10ml of 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl was added₂，2.5mM EDTA， 10mM NaHCO₃0.1% (w/v) BSA, 2mM ascorbate, 2000g 4 degrees centrifugation for 2 minutes. The obtained precipitate is chloroplast.

To the extracted chloroplasts, 200. mu.l of 50mM Tris-HCl (pH6.8), 2% (w/v) SDS, 10% (v/v) glycerol, 1% (v/v) mercaptoethanol were added. Cooking at 95 ℃ for 5 minutes, centrifuging at 4 ℃ for 15 minutes at maximum speed, and transferring the supernatant to a new tube. Mu.l of 150mM Tris-HCl (pH6.8), 6% (w/v) SDS, 0.3% (w/v) bromophenol blue, 30% (v/v) glycerol, 3% (v/v) mercaptoethanol were added to each. mu.l of the supernatant. The proteins were separated on 8% SDS-PAGE gel, and the separated proteins were transferred to PVDF (Millipore) membrane using a Bio-Rad instrument at a voltage of 105V. Blocking was performed in 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20, 5% SKIM MILK POWDER for 1 hour. After diluting primary antibodies (anti-TOC75, anti-bip (agriera), anti-GFP (abcam)) in 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20, 2% SKIM MILK POWDER with the appropriate ratio, PVDF membranes were incubated for 1 hour. The washing was carried out 4 times with 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20 for 15 minutes, 5 minutes, respectively. After diluting the secondary antibody (abmart) in the appropriate ratio in 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20, 2% SKIM MILK POWDER, the PVDF membrane was incubated for 1 hour. With 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) twon 20 washing for 4 times, and the time is 15 minutes, 5 minutes and 5 minutes respectively. By Tanon^TMHigh-sig ECL Western Blotting Substrate followed by development was developed with X-ray film.

Chloroplast DNA extraction and sequencing

Chloroplast DNA was extracted with DNeasy Plant Maxi Kit (QIAGEN), and quality detection of the extracted chlorophyll DNA by running gel was carried out to confirm the absence of RNA contamination and approximate range of the obtained DNA molecular weight. Then, the chloroplast DNA fragment selection is interrupted to 600bp by using COVARIS S220, the volume is fixed to 60ul, 40ul End Repair Mix is added by using Illumina DNA Sample Preparation Kit, the mixture is processed for 30 minutes at 30 degrees, 160ul AMPure XP Beads are added for purification, the volume is fixed to 17.5ul, 12.5ul A-labeling Mix is added at 37 degrees for 30 minutes, 2ul DNA Adapter Index,3ul Resuspension Buffer and 2.5ul Ligation Mix are added for 30 minutes, the reaction is carried out for 30 minutes at 30 degrees, 5ul Stop Ligation Buffer is added for mixing, 42ul AMPure XP Beads are added for purification, the volume is fixed to 10ul, and the size of the fragment is detected by using the Qubit quantification and Agilent 2100 Bioanalyzer. Finally, sequencing was performed using the illumina HiSeq2500 Rapid model PE 250.

Example 1

Verification that chloroplast signal peptide infA and non-coding RNA can respectively bring Cas9-GFP fusion protein and GFP mRNA into chloroplasts in tobacco

Constructing a 35S promoter-driven Cas9 with chloroplast signal peptide infA and GFP fusion protein (fig. 1A); GFP was constructed with non-coding RNA ligated driven by the 35S promoter. Transient transformation of these 2 vectors in tobacco was verified and found that green fluorescence from GFP and red fluorescence from chlorophyll co-localized in chlorophyll, demonstrating that chloroplast signal peptide infA and non-coding RNA can carry Cas9-GFP fusion protein and GFP mRNA into chloroplasts, respectively (FIG. 1B).

Example 2

Verification in tobacco that non-coding RNA can guide sgRNA with Csy4 and 2 Csy4 recognition sites to chloroplast

A 35S promoter was constructed to drive a non-coding RNA-guided sgRNA with Csy4 and 2 Csy4 recognition sites, followed by transient transformation of tobacco. And 3, after the agrobacterium is transformed into the tobacco for half and 3 days, extracting the chlorophyll body of the tobacco. It was confirmed by Western blot that chloroplast of tobacco was well purified (FIG. 2), and BiP and Toc75 were used as markers for cytoplasm and chloroplast, respectively.

Next, RNA was extracted from the obtained chloroplasts, and then sgRNA was detected by circular reverse transcription PCR (cRT-PCR). And (3) sequencing results: among the 6 clones tested (3 clones each), mature sgrnas formed after cleavage by Csy4 were present in the chloroplasts, respectively (fig. 3).

Example 3

Double-stranded DNA disruption on chloroplast genome of pMSK56 plants using CRISPR

A 35S promoter-driven Cas9 with chloroplast signal peptide infA was constructed and then compared to the 35S promoter-driven non-coding RNA-guided sgRNA with Csy4 and 2 Csy4 recognition sites constructed in experimental step 2 (fig. 1A).

In this example, 2 different target points were selected: sgRNA1(SEQ ID NO.:8) and sgRNA2(SEQ ID NO.:9) were co-transformed into pMSK56 plants. The aadA16GFP gene was present in the chloroplast genome of pMSK56 plants, and the aadA-GFP fusion protein encoded by this gene fluoresces green in the chloroplasts, so each chloroplast had both green fluorescence from aadA-GFP and red fluorescence from chlorophyll (fig. 1C). In pMSK56 plant cotransformed with these 2 vectors, chloroplasts with only red fluorescence but no green fluorescence were observed (fig. 1C), indicating that aadA16GFP on chloroplasts could be mutated, followed by extraction of wild type tobacco, pMSK56, and chloroplasts transformed with Cas9 with chloroplast signal peptide infA driven by 35S promoter and sgRNA with Csy4 and 2 Csy4 recognition sites driven by 35S promoter driven by noncoding RNA. Western blot demonstrated a reduction in the amount of aadA-GFP protein in pMSK56 plants transformed with Cas9 and sgRNA.

Nucleotide sequence SEQ ID No. 8

TGCACGACGACATCATTCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT

Nucleotide sequence SEQ ID No. 9

AGAAGGTCTTAAAGTCGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT

Example 4

Detection of CRISPR (clustered regularly interspaced short palindromic repeats) mutation on chloroplast genome by using next-generation sequencing technology

Chloroplasts were extracted from leaves of the pMSK56 Plant transformed with sgRNA2 in example 3, then chloroplast DNA was extracted with DNeasy Plant Maxi Kit (Qiagen), and then mutations in the reporter gene aadA16GFP were detected by a second generation sequencing technique. Sequencing results found that there was an inserted DNA fragment in aadA16GFP of pMSK56 plants transformed with sgRNA2 (fig. 4A, sequences in boxes are inserted DNA fragments), and then PCR verified the results by designing primers according to the corresponding sequences, only chloroplast DNA of pMSK56 plants transformed with sgRNA2 could be amplified to bands (fig. 4B).

Example 5

Targeting knockdown on chloroplast genome of pMSK56 plant using CRISPR

Construction of a 35S promoter-driven Cas9 with chloroplast signal peptide infA (dCas9: D10A and H840A) without nuclease activity and a 35S promoter-driven sgRNA (targeting aadA16gfp gene) with Csy4 and 2 Csy4 recognition sites, non-coding RNA-guided, were transformed into pMSK56 plants. The inventor respectively detects the expression quantity of dCas9 and gfp genes in 5T 1 generation transgenic single plants by using western blot and real-time quantitative PCR. The inventors found that the expression level of dCas9 protein and the expression level of GFP showed negative correlation (fig. 5), i.e. the expression level of GFP was low in plants with high dCas9 protein expression.

Example 6

CRISPR was used to target knockdown on the chloroplast genome of arabidopsis var2 plants, thus restoring its leaf mottle phenotype.

A UBQ promoter driven Cas9 with chloroplast signal peptide infA (dCas9) without nuclease activity and a 35S promoter driven non-coding RNA guided sgRNA with Csy4 and 2 Csy4 recognition sites were constructed to transform arabidopsis var2 plants (fig. 6A). The sgRNA targeted gene was rpl33 on the chloroplast genome (fig. 6B). The inventors found that targeted reduction of rpl33 expression in transgenic plants of T1 generation restored var2 mutation-mediated leaf mottle phenotype (fig. 7, table 1), and then extracted RNA from these phenotype-restored and non-restored plants was subjected to real-time quantitative PCR detection. The expression level of rpl33 was found to be reduced in all of these 2 plants (FIG. 6), and the lower expression level plants restored the var2 mutation-mediated leaf mottle phenotype.

TABLE 1 Targeted knock-down of leaf variegation phenotype statistics after rpl33 for var2 mutants

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it will be appreciated that various changes or modifications may be made by those skilled in the art after reading the above teachings of the invention, and such equivalents will fall within the scope of the invention as defined in the appended claims.

Reference to the literature

Gómez,G.,and Pallás,V.(2010).Noncoding RNA Mediated Traffic of Foreign mRNA into Chloroplasts Reveals a Novel Signaling Mechanism in Plants.PloS one 5,e12269.

Haurwitz,R.E.,Jinek,M.,Wiedenheft,B.,Zhou,K.,and Doudna, J.A.(2010).Sequence-and Structure-Specific RNA Processing by a CRISPR Endonuclease.Science 329,1355-1358.

Khan,M.S.,and Maliga,P.(1999).Fluorescent antibiotic resistance marker for tracking plastid transformation in higher plants. Nat Biotech 17,910-915.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> chloroplast genome editing method

<130> P2017-2453

<150> 201611115749.6

<151> 2016-12-07

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 883

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

tcaacatggt ggagcacgac acacttgtct actccaaaaa tatcaaagat acagtctcag 60

aagaccaaag ggcaattgag acttttcaac aaagggtaat atccggaaac ctcctcggat 120

tccattgccc agctatctgt cactttattg tgaagatagt ggaaaaggaa ggtggctcct 180

acaaatgcca tcattgcgat aaaggaaagg ccatcgttga agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacaca cttgtctact 360

ccaaaaatat caaagataca gtctcagaag accaaagggc aattgagact tttcaacaaa 420

gggtgatatc cggaaacctc ctcggattcc attgcccagc tatctgtcac tttattgtga 480

agatagtgga aaaggaaggt ggctcctaca aatgccatca ttgcgataaa ggaaaggcca 540

tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagaccct tcctctatat 720

aaggaagttc atttcatttg gagaggacct cgacctcaac acaacatata caaaacaaac 780

gaatctcaag caatcaagca ttctacttct attgcagcaa tttaaatcat ttcttttaaa 840

gcaaaagcaa ttttctgaaa attttcacca tttacgaacg ata 883

<210> 2

<211> 284

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tgattgatcg atagagctcg aatttccccg atcgttcaaa catttggcaa taaagtttct 60

taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg 120

ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga 180

ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact 240

aggataaatt atcgcgcgcg gtgtcatcta tgttactaga tcgg 284

<210> 3

<211> 180

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

atgcttcaac tctgctccac tttccgtcct caacttcttc ttccttgtca attccgattt 60

acaaatggcg ttttgattcc ccaaataaac tatgttgcaa gcaattcagt tgtgaatatc 120

cggccaatga tacgatgcca gagagcaagc ggaggaagag gaggagctaa tagaagcaaa 180

<210> 4

<211> 720

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720

<210> 5

<211> 330

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ttggcgaaac cccatttcga cctttcggtc tcatcagggg tggcacacac caccctatgg 60

ggagaggtcg tcctctatct ctcctggaag gccggagcaa tccaaaagag gtacacccac 120

ccatgggtcg ggactttaaa ttcggaggat tcgtccttta aacgttcctc caagagtccc 180

ttccccaaac ccttactttg taagtgtggt tcggcgaatg taccgtttcg tcctttcgga 240

ctcatcaggg aaagtacaca ctttccgacg gtgggttcgt cgacacctct ccccctccca 300

ggtactatcc cctttccagg atttgttccc 330

<210> 6

<211> 564

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

atggaccact atctggacat cagactgagg cccgatcctg agttccctcc cgcccagctg 60

atgagcgtgc tgtttggcaa gctgcatcag gctctggtcg cccaaggcgg agacagaatc 120

ggcgtgtcct tccccgacct ggacgagtcc cggagtcgcc tgggcgagcg gctgagaatc 180

cacgccagcg cagacgatct gcgcgccctg ctggcccggc cttggctgga gggcctgcgg 240

gatcatctgc agtttggcga gcccgccgtg gtgccacacc caacacccta ccgccaggtg 300

agccgcgtgc aggccaagtc aaatcccgag agactgcggc ggaggctgat gaggcgacat 360

gatctgagcg aggaggaggc cagaaagaga atccccgaca cagtggccag agccctggat 420

ctgccatttg tgaccctgcg gagccagagc actggccagc atttcagact gttcatcaga 480

cacgggcccc tgcaggttac agccgaggag ggcggattta catgctatgg cctgtctaaa 540

ggcggcttcg tgccctggtt ctaa 564

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

gttcactgcc gtataggcag 20

<210> 8

<211> 100

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

tgcacgacga catcattccg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100

<210> 9

<211> 100

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

agaaggtctt aaagtcgcca gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100

Claims

1. A nucleic acid construct selected from the group consisting of:

(1) a nucleic acid construct of formula I:

X1-X2-X3-X4-X5 (I)

in the formula (I), the compound is shown in the specification,

x1 is a promoter element;

x2 is a chloroplast localization signal peptide element;

x3 is a nuclease element, the nuclease element X3 is selected from the group consisting of: (1) cas 9; (2) cpf 1; or a combination thereof;

x4 is a null or marker gene element;

x5 is a terminator;

(2) a nucleic acid construct of formula II:

Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)

in the formula (I), the compound is shown in the specification,

y1 is a promoter element;

y2 is a ncRNA element, and the sequence of the ncRNA element is shown in SEQ ID No. 5;

y3 is a null or marker gene element;

y4 is an RNA cleaving enzyme element;

ya and Yb are each independently absent or RNA cleaving enzyme recognition elements, and Ya and Yb are not absent at the same time;

y5 is a sgRNA element;

y6 is a terminator;

2. The nucleic acid construct of claim 1, wherein the structures of formula I and formula II are in the 5 'to 3' orientation.

3. The nucleic acid construct of claim 1, wherein X1 is selected from the group consisting of: 35S, UBQ.

4. The nucleic acid construct of claim 1, wherein X2 is selected from the group consisting of: infA, RbcS.

5. The nucleic acid construct of claim 1, wherein X4 is selected from the group consisting of: GFP, YFP, RFP.

6. The nucleic acid construct of claim 1, wherein X5 is a Nos terminator.

7. The nucleic acid construct of claim 1, wherein Y1 is a 35S promoter.

8. The nucleic acid construct of claim 1, wherein Y3 is selected from the group consisting of: GFP, YFP, RFP.

9. The nucleic acid construct of claim 1, wherein Ya is a Csy4 recognition sequence.

10. The nucleic acid construct of claim 1, wherein Yb is a Csy4 recognition sequence.

11. The nucleic acid construct of claim 1, wherein Y6 is a Nos terminator.

12. The nucleic acid construct of claim 1, wherein the nuclease element X3 in the nucleic acid construct of formula I is Cas 9.

13. The nucleic acid construct of claim 1, wherein the chloroplast localization signal peptide element X2 is the chloroplast signal peptide infA in the nucleic acid construct of formula I.

14. The nucleic acid construct of claim 1, wherein the ncRNA element Y2 in the nucleic acid construct of formula II is from a viroid.

15. The nucleic acid construct of claim 1, wherein the RNA cleaving enzyme element Y4 in the nucleic acid construct of formula II is Csy 4.

16. The nucleic acid construct of claim 15, wherein the Csy4 sequence is set forth in SEQ ID No. 6.

17. The nucleic acid construct of claim 1, wherein the sgRNA element Y5 in the nucleic acid construct of formula II is spCas9 sgRNA.

18. The nucleic acid construct of claim 1, wherein Y5 is set forth in SEQ ID No. 8 or 9.

19. A vector or vector combination comprising the nucleic acid construct of any one of claims 1-18.

20. The vector or vector combination of claim 19, wherein the nucleic acid construct of formula I and the nucleic acid construct of formula II are on the same vector.

21. A reagent combination, comprising: (i) the vector or combination of vectors of claim 19.

22. A method for editing a plant chloroplast gene, comprising the steps of:

(i) introducing into a plant cell, plant tissue or plant (a) the vector or vector combination of claim 19 and (b) optionally a donor nucleic acid fragment, thereby producing gene editing in said plant cell, plant tissue or plant; and

23. The method of plant chloroplast gene editing of claim 22, further comprising:

24. The method of gene editing in a plant chloroplast of claim 22, wherein said gene editing comprises gene knock-out, site-directed insertion, gene replacement, or a combination thereof.

25. The method of editing a plant chloroplast gene of claim 24, wherein said site-directed insertion comprises site-directed insertion based on homologous recombination or non-homologous recombination end-joining.

26. The method of plant chloroplast gene editing of claim 22, wherein said gene editing comprises single or multiple site gene editing.

27. The method of editing a plant chloroplast gene of claim 22, wherein said introducing is by agrobacterium.

28. The method of plant chloroplast gene editing of claim 22, wherein the introducing is by gene gun introduction.

29. The method of editing a plant chloroplast gene of claim 22, wherein said introducing is by microinjection, electroporation, sonication, or polyethylene glycol-mediated introduction.

30. The method of plant chloroplast gene editing of claim 22, wherein said plant is selected from the group consisting of: crops, trees and flowers.

31. The method of plant chloroplast gene editing of claim 22, wherein said plant is selected from the group consisting of: gramineae, leguminous plants and crucifers.

32. The method of plant chloroplast gene editing of claim 22, wherein said plant comprises: arabidopsis, wheat, barley, oats, maize, rice, sorghum, millet, soybean, peanut, tobacco and tomato.