CN108165573A - Chloroplast gene edit methods - Google Patents

Chloroplast gene edit methods Download PDF

Info

Publication number
CN108165573A
CN108165573A CN201711287309.3A CN201711287309A CN108165573A CN 108165573 A CN108165573 A CN 108165573A CN 201711287309 A CN201711287309 A CN 201711287309A CN 108165573 A CN108165573 A CN 108165573A
Authority
CN
China
Prior art keywords
nucleic acid
acid constructs
plant
carrier
chloroplast
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711287309.3A
Other languages
Chinese (zh)
Other versions
CN108165573B (en
Inventor
朱健康
王东
华凯
刘志红
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Center for Excellence in Molecular Plant Sciences of CAS
Original Assignee
Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institutes for Biological Sciences SIBS of CAS filed Critical Shanghai Institutes for Biological Sciences SIBS of CAS
Publication of CN108165573A publication Critical patent/CN108165573A/en
Application granted granted Critical
Publication of CN108165573B publication Critical patent/CN108165573B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Abstract

The present invention provides Chloroplast gene edit methods.Specifically, the present invention provides nucleic acid constructs, carrier or the carrier combination of the Plant Genome fixed point editor based on CRISPR technologies and Plant Genome fixed point edit methods.The nucleic acid constructs of the present invention includes Formulas I nucleic acid constructs and/or Formula II nucleic acid constructs, and the Formulas I nucleic acid constructs includes chloroplast localisation signal peptide nucleic acid expression of enzymes box, and the Formula II nucleic acid constructs includes ncRNA sgRNA expression cassettes.Using the method for the present invention, nuclease and corresponding sgRNA can be imported chloroplaset, so as to which in scheduled Chloroplast gene site, orientation that is easy and efficiently carrying out gene knockout or homologous recombination and exogenous sequences is inserted into.The method of the present invention can be used for the character from the horizontal Crop Improvement of Chloroplast gene.

Description

Chloroplast gene edit methods
Technical field
The present invention relates to biotechnologies, and in particular, to the plant chloroplast genome editor of RNA guiding.
Background technology
Existing Chloroplast gene editing technique depends on gene gun technology, and exogenous DNA passes through homologous recombination Method is inserted on the Chloroplast gene of plant, and the chloroplaset turn for stablizing heredity can only be obtained in a small number of plants Gene plant.Being additionally based on the chloroplast transformation of homologous recombination cannot cause double-stranded DNA to destroy on Chloroplast gene.Most Emerging CRISPR (clustered regularly interspaced short palindromic repeats) technology Plant cell Matrix attachment region editor is widely used in, it takes DNA endonucleases such as Cas9 and RNA to by RNA It is cut in the region of DNA domain of sequences match.
So far there are no based on CRISPR technologies to the Chloroplast gene of plant into edlin, so this field There is an urgent need to develop the Chloroplast gene edit methods of simple and effective.
Invention content
The purpose of the present invention is to provide a kind of high universalizable, high specific, gene efficiently is carried out to plant chloroplast The method of editor.
In the first aspect of the present invention, a kind of nucleic acid constructs is provided, the nucleic acid constructs is selected from the group：
(1) Formulas I nucleic acid constructs：
X1-X2-X3-X4-X5 (I)
In formula,
X1 is promoter element；
X2 is chloroplast localisation signal peptide element；
X3 is nuclease element；
X4 is nothing or marker gene element；
X5 is terminator；
(2) Formula II nucleic acid constructs：
Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)
In formula,
Y1 is promoter element；
Y2 is ncRNA elements；
Y3 is nothing or marker gene element；
Y4 is nothing or RNA nickase elements；
Ya and Yb is each independently nothing or RNA nickase recognition components；
Y5 is sgRNA elements；
Y6 is terminator；
(3) construction including Formulas I construction and Formula II construction.
In another preferred example, the Formulas I and Formula II structure are 5 ' to 3 ' directions.
In another preferred example, the X1 is selected from：35S、UBQ.
In another preferred example, the X2 is selected from：infA、RbcS.
In another preferred example, the X4 is selected from the group：GFP、YFP、RFP.
In another preferred example, the X5 is Nos terminators.
In another preferred example, the Y1 is 35S promoter.
In another preferred example, the Y3 is selected from the group：GFP、YFP、RFP.
In another preferred example, the Ya identifies sequence for Csy4.
In another preferred example, the Yb identifies sequence for Csy4.
In another preferred example, the Y6 is Nos terminators.
In another preferred example, the Formulas I nucleic acid constructs amplifying nucleic acid enzyme element X3 is selected from the group：
(1)Cas9；
(2)Cpf1；
(3) Zinc finger nuclease (ZFN)；
(3) transcriptional activator sample nuclease (TALENS)；
(4) huge nuclease (meganuclease)；
Or combination.
In another preferred example, the Formulas I nucleic acid constructs Chloroplast localization signal peptide element X2 is chloroplast signal Peptide infA.
In another preferred example, ncRNA elements Y2 comes from viroid or virus in the Formula II nucleic acid constructs.
In another preferred example, ncRNA element sequences such as SEQ ID No. in the Formula II nucleic acid constructs:Shown in 5.
In another preferred example, RNA nickase elements Y4 is Csy4 in the Formula II nucleic acid constructs.
In another preferred example, the Csy4 sequences such as SEQ ID No.:Shown in 6.
In another preferred example, sgRNA elements Y5 is spCas9sgRNA in the Formula II nucleic acid constructs.
In another preferred example, the Y5 such as SEQ ID No.:Shown in 8 or 9.
In the second aspect of the present invention, a kind of carrier or carrier combination are provided, the carrier or carrier combination contain this Nucleic acid constructs described in the first aspect of invention.
In another preferred example, the Formulas I nucleic acid constructs and Formula II nucleic acid constructs are located on different carriers.
In another preferred example, the Formulas I nucleic acid constructs and Formula II nucleic acid constructs are located in identical carrier.
In the third aspect of the present invention, a kind of reagent combination is provided, including：
(i) carrier described in the second aspect of the present invention or carrier combination.
In the fourth aspect of the present invention, a kind of plant chloroplast gene editing method is provided, including step：
(i) by the optional donor nucleic acid piece of the carrier described in (a) the second aspect of the present invention or carrier combination and (b) Section imports plant cell, plant tissue or plant (plant), so as to be generated in the plant cell, plant tissue or plant Gene editing；With
(ii) optionally, plant cell or plant that the gene editing occurs are detected, screened or identified.
In another preferred example, the method further includes：
(iii) to the plant cell, plant tissue or plant that the gene editing has occurred identified in step (ii) into Row regeneration or culture.
In another preferred example, the gene editing includes gene knockout, fixed point insertion, gene substitution or its group It closes.
In another preferred example, the orientation, which is inserted into, includes what is connected based on homologous recombination or non-homogeneous recombination end Fixed point is inserted into.
In another preferred example, the gene editing includes the gene editing of unit point or multidigit point.
In another preferred example, it is described to import to be imported by Agrobacterium.
In another preferred example, it is described to import to be imported by particle gun.
In another preferred example, it is described to import to pass through microinjection, electric shocking method, supercritical ultrasonics technology and polyethylene glycol (PEG) mediated method imports.
In another preferred example, the plant is selected from the group：Crops, trees, flowers.
In another preferred example, the plant is selected from the group：Grass, legume and crucifer.
In another preferred example, the plant includes：Arabidopsis, wheat, barley, oat, corn, rice, sorghum, Grain, soybean, peanut, tobacco and tomato.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, so as to form new or preferred technical solution.As space is limited, Not repeated them here.
Description of the drawings
Fig. 1 shows the GFP being mutated with CRISPR/Cas9 in chloroplaset；
(A) plasmid map used is shown.The carrier is 35S promoter (P35S) and no terminators (Tnos).One section of non-coding RNA (ncRNA) on the signal peptide (TPinfA) of infA and viroid be used to by from The Cas9 and sgRNA of Streptococcus pyogenes (streptococcus pyogenes) takes chloroplaset to.
(B) show that the mRNA (figure below) of Cas9-GFP fusion proteins (above) and GFP are transported chloroplaset.
(C) display is mutated the aadA16gfp genes on Chloroplast gene by CRISPR/Cas9.This experiment The target spot (sgRNA1 and sgRNA2) of 2 sgRNA used；With 2 carriers：35S promoter driving is with chloroplast signal peptide The sgRNA2 winks with Csy4 and 2 Csy4 recognition site of Cas9 and 35S promoter the driving non-coding RNA guiding of infA When conversion pMSK56 plant (figure below) and the (above) without conversion carrier, then shoot fluorescence microscope picture.
(D) display conversion has in the chloroplasets of CRISPR/Cas9pMSK56 plant GFP protein quantities than no conversion Plant is few.Plant Transformation has sgRNA1 and sgRNA2 to be named as Cas9_PT1 and Cas9_PT2.From Nicotiana The albumen extracted in tabacum (tobacco) chloroplaset is used as wild type control (WT).BiP albumen quilts in endoplasmic reticulum It is marked as cytoplasm；Toc75 albumen (position pointed out with arrow) on outer chloroplast membrane is taken as chloroplaset mark Note.The applied sample amount of each sample is 30 micrograms of protein.(scale:10 microns).
Fig. 2 is shown extracts complete chloroplaset in 2 model plants.Tobacco (A) and the Western of arabidopsis (B) Blot results.Arrow mark goes out the position of Toc75 differential proteins.Respectively albumen is extracted in blade and complete chloroplaset.It is right In blade, applied sample amount is 20 micrograms of protein；For chloroplaset, applied sample amount is 30 micrograms of protein.
Fig. 3 shows the cyclisation reverse transcription PCR product of sequence verification sgRNA1 and sgRNA2.The ring of sgRNA1 and sgRNA2 Change the sequence chromatography of reverse transcription PCR product, each survey 3 independent clones.
Fig. 4 shows that sequencing result finds there is insertion DNA in the aadA16GFP for the pMSK56 plants for having sgRNA2 in conversion Segment (Fig. 4 A)；PCR verifications only have the chloroplast DNA of the pMSK56 plants of sgRNA2 that can expand to band (figure in conversion 4B)。
Fig. 5 shows the expression that aadA16gfp genes on Chloroplast gene are reduced with CRISPR/Cas9.In pMSK56 CRISPR/Cas9T1 detect no enzymatically active nucleic acid for (aadA16gfpT1-1~aadA16gfpT1-5) in transfer-gen plant Cas9 (dCas9) expression quantity of property.The expression quantity of GFP is low in the high plant of dCas9 expressing quantities.There is no CRISPR/Cas9 PMSK56 plant as control, i.e. control.
Fig. 6, which is shown in targeting in arabidopsis, reduces the expression quantity of rpl33.(A) plasmid map used in testing. PUBQ and TUBQ represents the promoter and terminator of AtUBQ1 respectively.(B) by CRISPR/Cas9 systems to arabidopsis var2 Rpl33 genes on plant Chloroplast gene carry out knockdown.2 sgRNAs that this experiment is used are targeted respectively The template strand (T) of rpl33 genes and non-template chain (NT).CK represents to be from the CRISPR/ only converted without sgRNA The var2 plant of Cas9 systems.Rpl33 template strands and sgRNA targeting rpl33 non-template chains CRISPR/ are targeted containing sgRNA The arabidopsis var2T1 of Cas9 carriers is respectively labeled as 33T and 33NT for plant.The variegated phenotype of leaf caused by var2 is resumed The plant not being resumed is respectively labeled as S and NS.
The expression that Fig. 7 display targetings reduce rpl33 can restore the variegated phenotype of leaf that var2 mutation mediate.From left to right It is that conversion does not contain sgRNA, sgRNA targeting rpl33 template strands and sgRNA targeting rpl33 non-template chains CRISPR/ respectively The arabidopsis var2 plant of Cas9 carriers.Grey arrow points out to be that recovered leaf is miscellaneous by targeting the expression of reduction rpl33 The plant of color table type.
Specific embodiment
The present inventor constructs a kind of chloroplaset base based on CRISPR technologies after extensive and in-depth study, for the first time Because group fixed point editing system and for Chloroplast gene fixed point editor nucleic acid constructs, carrier or carrier combination, with And Chloroplast gene fixed point edit methods.The present invention method can scheduled Plant Genome site, simplicity and it is efficient Ground carries out gene knockout or homologous recombination and the orientation of exogenous sequences is inserted into.The present invention is completed on this basis.
Typically, CRISPR editing systems amplifying nucleic acid enzyme of the present invention uses Cas9 albumen, passes through chloroplast signal peptide infA Bring Cas9 albumen into chloroplaset；Using non-coding RNA (ncRNA), for example, the ncRNA from viroid by sgRNA (such as SpCas9sgRNA chloroplaset) is brought into, so as to fulfill the knockout to gene on Chloroplast gene.With traditional gene gun technology It compares, the method for the present invention not only reduces operation difficulty, improves the efficiency and accuracy of chloroplast gene fixed point editor, and And reduce operating cost.In addition, the method for the present invention, which also can be effectively used for those, can not carry out the plant product of via Particle Bombardment Transformation Kind.
Term
Unless otherwise defined, the meaning of all technical and scientific terms used herein and fields of the present invention are common Technical staff is generally understood identical.All publications and other bibliography addressed herein are all incorporated by reference Herein.
As used herein, described " containing ", " having " or " comprising " include "comprising", " mainly by ... form ", " substantially by ... form " and " by ... form ".
As used herein, term " being operatively connected " or " being operably coupled to " refer to such a situation, i.e. linear DNA Certain parts of sequence can adjust or control the activity of same linear DNA molecule other parts.Such as if promoter control The transcription of sequence processed, so it be exactly to be operably coupled to coded sequence.
The nucleic acid constructs and method of Plant Genome fixed point editor based on nuclease
The present invention provides a kind of nucleic acid constructs, the nucleic acid constructs is selected from：
(1) Formulas I nucleic acid constructs：
X1-X2-X3-X4-X5 (I)
In formula,
X1 is promoter element；
X2 is chloroplast localisation signal peptide element；
X3 is nuclease element；
X4 is nothing or marker gene element；
X5 is terminator；
(2) Formula II nucleic acid constructs：
Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)
In formula,
Y1 is promoter element；
Y2 is ncRNA elements；
Y3 is nothing or marker gene element；
Y4 is nothing or RNA nickase elements；
Ya, Yb are nothing or RNA nickase recognition components；
Y5 is sgRNA elements；
Y6 is terminator；
(3) construction including Formulas I construction and Formula II construction.
In structure above, "-" represents key.
In the present invention, above-mentioned each element can use conventional method (such as PCR methods, artificial fully synthetic) to prepare and then with normal Rule method is attached, so as to form nucleic acid constructs of the present invention.If desired for, before coupled reaction, can be optional Ground carries out endonuclease reaction.
In addition, the nucleic acid constructs of the invention can be linear, can also be cricoid.The present invention's is described Nucleic acid constructs can be single-stranded, can also be double-strand.The present invention the nucleic acid constructs can be DNA, can also It is RNA or DNA/RNA heterozygosis.
As used herein, " marker gene " refers to the base that gene editing is used for the successful cell of screening-gene editor in the process Cause, the marker gene available for the application were not particularly limited, including the common various marker gene in gene editing field, generation Table example includes (but being not limited to)：Green fluorescent protein (GFP), yellow fluorescence protein (YFP), hygromycin gene (Hyg), kalamycin resistance gene (NPTII), neomycin gene or puromycin resistance gene.
As used herein, term " plant promoter " refers to start in plant cell the nucleic acid sequence of transcribed nucleic acid. The plant promoter can be derived from plant, microorganism (such as bacterium, virus) or animal or artificial synthesized or change The promoter made.Representative example includes (but being not limited to)：35S promoter.
As used herein, term " plant terminators " refers to the terminator that in plant cell transcription can stop.It should Plant transcription terminator can be derived from plant, microorganism (such as bacterium, virus) or animal or it is artificial synthesized or The terminator being transformed.Representative example includes (but being not limited to)：Nos terminators.
As used herein, term " signal peptide " refers to newly synthesized protein to the short peptide chain of secretion access transfer.It represents Property example include (but being not limited to)：InfA signal peptides.
As used herein, typically, the Formulas I nucleic acid constructs amplifying nucleic acid enzyme element X3 is selected from the group：
(1)Cas9；
(2)Cpf1；
(3) Zinc finger nuclease (ZFN)；
(3) transcriptional activator sample nuclease (TALENS)；
(4) huge nuclease (meganuclease)；
Or combination.
As used herein, term " nuclease element " refers to the nucleotide sequence of nuclease of the coding with cleavage activity. The polynucleotide sequence of insertion be transcribed and translated so as to generate functional nucleic acid enzyme in the case of, technical staff will appreciate that To, because codon degeneracy, have a large amount of polynucleotide sequences that can encode identical polypeptide.In addition, technical staff Will appreciate that different plant species for codon have certain Preference, may according to the needs expressed in different plant species, The codon of nuclease can be optimized, these variants are all specifically covered by term " nuclease element ".
In addition, term " nuclease element " specifically include it is overall length, basic with Cas9 and/or Cpf1 gene orders Identical sequence and the sequence for the protein for encoding out reservation Cas9 and/or Cpf1 protein function.
Typically, term " nuclease element " is from streptococcus pyogenes (Streptococcus pyogenes) The coded sequence of Cas9 albumen.
Preferably, Formulas I nucleic acid constructs Chloroplast localization signal peptide element X2 of the present invention is chloroplast signal peptide infA。
Typically, ncRNA elements Y2 comes from viroid in Formula II nucleic acid constructs of the present invention.
Preferably, ncRNA element sequences such as SEQ ID No. in Formula II nucleic acid constructs of the present invention:Shown in 5.
Typically, RNA nickase elements Y4 is Csy4 in Formula II nucleic acid constructs of the present invention.
Preferably, Csy4 sequences of the present invention such as SEQ ID No.:Shown in 6.
Typically, sgRNA elements Y5 is spCas9sgRNA in Formula II nucleic acid constructs of the present invention.
Preferably, sgRNA sequences of the present invention such as SEQ ID No.:Shown in 8 or 9.
The present invention also provides a kind of carriers or carrier to combine, and the carrier or carrier combination are containing of the present invention Nucleic acid constructs.
Preferably, Formulas I nucleic acid constructs and Formula II nucleic acid constructs of the present invention are located in identical carrier.
It is operatively connected in the nucleic acid constructs and/or carrier of the present invention, between some elements.Such as when opening When mover and coded sequence are operatively connected, refer to the promoter and can start the transcription of the coded sequence.
The present invention also provides the reagent combination containing above-mentioned carrier or carrier combination and kits, they can be used for The plant chloroplast gene editing method of the present invention.
The present invention also provides a kind of plant chloroplast gene editing method, including step：
(i) by the optional donor nucleic acid fragment of (a) carrier of the present invention or carrier combination and (b), plant is imported Cell, plant tissue or plant, so as to generate gene editing in the plant cell, plant tissue or plant；With
(ii) optionally, plant cell or plant that the gene editing occurs are detected, screened or identified.
In the present invention, the gene editing includes gene knockout, fixed point insertion, gene substitution, or combination.
The present invention plant gene edit methods, available for improveing all kinds of plants, especially crops being improved.
As used herein, term " plant " is thin including whole plant, plant organ (such as leaf, stem, root), seed and plant Born of the same parents and their filial generation.The type of plant available for the method for the present invention is not particularly limited, generally comprises any carry out The higher plant type of transformation technology, including unifacial leaf, dicotyledon and gymnosperm.
Main advantages of the present invention are：
(1) cutting and the base of effective double-stranded DNA are caused on Chloroplast gene using CRISPR technologies for the first time Because of editor；
(2) cost and difficulty of chloroplast gene editor is effectively reduced；
(3) range of chloroplast gene editor's species has substantially been widened.
With reference to specific embodiment, the present invention is further explained.It should be understood that these embodiments are merely to illustrate this hair It is bright rather than limit the scope of the invention.Test method without specific conditions in the following example, usually according to routine Condition such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and Number is calculated by weight.Involved experiment material can obtain unless otherwise specified from commercially available channel in the present invention.
Material
Arabidopsis material used in experiment is wild type Col-0.Col-0 seeds after 5% hypochlorite disinfectant with sowing In on 1/2MS solid mediums, 4 DEG C of tablet is put into illumination box (22 degree, 16hrs illumination/8hrs is dark) after handling three days Culture 10-14 days, then transplants seedlings into Nutrition Soil, greenhouse continues to cultivate.
Tobacco used in experiment be wild type Nicotiana tabacum (tobacco) and using Nicotiana tabacum as by The chloroplast transgenic plant pMSK56 of body (coding has aadAGFP fusions on pMSK56 Chloroplast genes).pMSK56 Transfer-gen plant is a kind of conventional tobacco plant (Khan and Maliga, 1999).Nicotiana tabacum and The seed of pMSK56 is sowed in Nutrition Soil, is positioned over (26 degree, 16hrs illumination/8hrs) of greenhouse and is cultivated 10 days or so, single plant children In seedling transfer to Nutrition Soil, the same terms continue culture 3 weeks or so for transient assay.
Method
Target site designs
For SpCas9 albumen, PAM sequence requirements are 5 '-NGG-3 ', therefore suitable target position on Chloroplast gene Point is 5 '-N20NGG-3’。
Vector construction
The structure of pCam1300-35S-ncRNA-GFP, pCam1300-35S-ncRNA-GFP-spsgRNA carrier
The ncRNA that RNA can be imported into chloroplaset in experiment is had references in (G ó mez and Pall á s, 2010) text Sequence, be connected into after artificial synthesized in commercially available pUC57 carriers and obtain pUC57-ncRNA.NcRNA sequences, GFP code sequences Row, spsgRNA skeletons are respectively from pUC57-ncRNA, and pGWB505, pCas9 (AtU6) vector amplification obtains, ncRNA-GFP, NcRNA-GFP-spsgRNA can be connected in turn by the method for folded even PCR, PCR product recycling, with XmaI, 35S promoter (the SEQ ID No. being connected into after BamHI digestion in pCam1300-35S carriers:And NOS terminator (SEQ 1) ID No.:2) carrier pCam1300-35S-ncRNA-GFP, pCam1300-35S-ncRNA-GFP-sgRNA are obtained between.
Nucleotide sequence SEQ ID No.:1
TCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACC AAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATC TGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAA GGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGG AAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATAACATGGTGGAGCACGACACA CTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAG GGTGATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAA AGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGAC AGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCA AGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAG ACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGACCTCAACACAACATATACAAAAC AAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCAAAAG CAATTTTCTGAAAATTTTCACCATTTACGAACGATA
Nucleotide sequence SEQ ID No.:2
TGATTGATCGATAGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGAT TGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATT AACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATA CGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAG ATCGG
The structure of pCam1300-35S-infA-Cas9-GFP carriers
Chloroplast localisation signal infA (SEQ ID No.:3) it expands and obtains from arabidopsis cDNA library.Cas9, GFP (SEQ ID No.:4) coded sequence expands from carrier pCas9 (AtU6), pGWB505 obtain respectively, infA, Cas9, GFP Three segments are connected into the 35S promoter and NOS terminator of pCam1300-35S carriers by the method for Gibson assembly Between obtain pCam1300-35S-infA-Cas9-GFP carriers.
Nucleotide sequence SEQ ID No.:3
ATGCTTCAACTCTGCTCCACTTTCCGTCCTCAACTTCTTCTTCCTTGTCAATTCCGATTTACAAAT GGCGTTTTGATTCCCCAAATAAACTATGTTGCAAGCAATTCAGTTGTGAATATCCGGCCAATGATACGATG CCAGAGAGCAAGCGGAGGAAGAGGAGGAGCTAATAGAAGCAAA
Nucleotide sequence SEQ ID No.:4
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAA GTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGC AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTAC GTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGG AGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTG AACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACC CCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGAC GAGCTGTACAAGTAA
The structure of pCam1300-35S-infA-Cas9 carriers
NOS is amplified from pCam1300-35S carriers with primer of the end of sense primer 5 ' with terminator codon to terminate Son carries out double digestion after PCR product recycling with BamHI and EcoRI.Again by GFP genes and NOS terminator from pCam1300- 35S-infA-Cas9-GFP carriers are cut off with BamHI and EcoRI, are connect after segment recycling with the NOS terminator of above-mentioned recycling Obtain pCam1300-35S-infA-Cas9 carriers.
The structure of pCam1300-35S-ncRNA-Csy4-sgRNA carriers
C-terminal carries Csy4 genes (the SEQ ID No. of 3 × Frag labels:6) pUC57 carriers are connected by artificial synthesized In obtain pUC57-Csy4.NcRNA sequences (SEQ ID No.:5), Csy4-3 × Frag code areas, sgRNA skeletons respectively from PUC57-ncRNA, pUC57-Csy4, pCas9 (AtU6) vector amplification obtains.On sgRNA skeletons, downstream is added with 20nt's Csy4 recognition sites (SEQ ID No.:7).Other two AarI restriction enzyme site is added in Csy4-3 × Frag code areas downstream. NcRNA sequences, Csy4-3 × Frag code areas, sgRNA skeletons are connected in turn with the method for folded even PCR, PCR product Recycling with XmaI, is connected into after BamHI digestion between the 35S promoter in pCam1300-35S carriers and NOS terminator.
Nucleotide sequence SEQ ID No.:5
TTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGAG GTCGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTT AAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTG GTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCG TCGACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCC
Nucleotide sequence SEQ ID No.:6
ATGGACCACTATCTGGACATCAGACTGAGGCCCGATCCTGAGTTCCCTCCCGCCCAGCTGATGAGC GTGCTGTTTGGCAAGCTGCATCAGGCTCTGGTCGCCCAAGGCGGAGACAGAATCGGCGTGTCCTTCCCCGACCTGGA CGAGTCCCGGAGTCGCCTGGGCGAGCGGCTGAGAATCCACGCCAGCGCAGACGATCTGCGCGCCC TGCTGGCCCGGCCTTGGCTGGAGGGCCTGCGGGATCATCTGCAGTTTGGCGAGCCCGCCGTGGTGCCACAC CCAACACCCTACCGCCAGGTGAGCCGCGTGCAGGCCAAGTCAAATCCCGAGAGACTGCGGCGGAGGCTGAT GAGGCGACATGATCTGAGCGAGGAGGAGGCCAGAAAGAGAATCCCCGACACAGTGGCCAGAGCCCTGGATC TGCCATTTGTGACCCTGCGGAGCCAGAGCACTGGCCAGCATTTCAGACTGTTCATCAGACACGGGCCCCTG CAGGTTACAGCCGAGGAGGGCGGATTTACATGCTATGGCCTGTCTAAAGGCGGCTTCGTGCCCTGGTTCTA A
Nucleotide sequence SEQ ID No.:7
GTTCACTGCCGTATAGGCAG
The structure of pCam1300-UBQ-spsgRNA-35S-Cas9 carriers
Amplify the promoter UBQpro of UBQ1 genes (AT3G52590) respectively using arabidopsis Col-0 genomes as template With terminator UBQTer.NcRNA-Csy4-sgRNA pieces are amplified from pCam1300-35S-ncRNA-Csy4-sgRNA carriers UBQpro, ncRNA-Csy4-spsgRNA, UBQTer are connected in turn for tri- sections by section in the method for folded even PCR, and PCR is returned It receives among being connected into pCambia1300 carriers after product is digested with HindIII and XmaI, obtains pCam1300-UBQ-spsgRNA Carrier.35S-infA-Cas9-NOS segments, PCR product recycling are amplified from pCam1300-35S-infA-Cas9 carriers It is connected into pCam1300-UBQ-sgRNA carriers using the method for Gibson assembly afterwards and obtains pCam1300-UBQ- sgRNA-35S-Cas9。
SgRNA is packed into respective objects carrier
For carrier pCam1300-35S-ncRNA-Csy4-sgRNA and pCam1300-UBQ-sgRNA-35S- Cas9, Choose 5 '-N20NGG-3 ' is as target sequence.It is respectively synthesized sense primer GCAGN20With downstream primer AAACN20, upstream and downstream draws The short double chain DNA fragment with 4nt connectors is formed after object annealing.Carrier pC am1300-35S-ncRNA-Csy4-sgRNA and Then pCam1300-UBQ-sgRNA-35S-Cas9 4 hours rear electrophoresis of AarI enzymic digestions, gel extraction are formed with annealing Short chain DNA fragmentation connects.
The instantaneous positioning experiment of albumen
Carrier pCam1300-35S-ncRNA-GFP, pCam1300-35S-ncRNA-GFP-sgRNA, pCam1300- 35S-infA-Cas9-GFP is transferred to by freeze-thaw method in Agrobacterium GV3101 competence, 28 degree of Agrobacterium dark culturing two days, Picking monoclonal is in 5ml LB resistance cultures base (50mg/L kanamycins, 25mg/L rifampins), 28 DEG C, 240rpm cultures 16 hours, with 1：100 ratio is transferred in new 5ml LB resistance culture bases (the another acetyl cloves added with 2 μM in culture medium Ketone, 10mM MES, pH 5.6), 28 DEG C, 240rpm overnight incubations to OD600=3.4000rpm, 10min collect thalline, use 10mM MES pH 5.6,10mM MgCl2, 10 μm of acetosyringone solution have hanged thalline, adjust OD600To 0.6-0.8.Room temperature After standing 2-3 hours, Agrobacterium is injected into 4 weeks or so the good tobaccos of growth conditions with the 1ml injector for medical purpose without syringe needle Vacuum side of blade.Sampling observation albumen positioning after culture 60-72 hours.
PMSK56 reporter genes aadA-GFP is knocked out
It chooses in aadA-GFP reporter genes and meets 5 '-N20The site of NGG-3 ' sequence requirements.Synthesize corresponding sgRNA Sequence is connected into after annealing in the pCam1300-35S-ncRNA-Csy4-spsgRNA carriers of AarI digestions.The load built Body is transferred to together with unloaded pCam1300-35S-infA-Cas9 carriers in Agrobacterium GV3101 competence.In addition, in order to inhibit The carrier for expressing p19 albumen is also transferred in Agrobacterium GV3101 competence by post-transcriptional silencing phenomenon caused by RNAi.Agriculture bar 28 DEG C of bacterium dark culturing two days, picking monoclonal is in 5ml LB resistance cultures base (50mg/L kanamycins, 25mg/L rifampins) In, 28 DEG C, 240rpm is cultivated 16 hours, with 1：100 ratio is transferred in new 5ml LB resistance culture bases (in culture medium The separately acetosyringone added with 2 μM, 10mM MES, pH 5.6), 28 degree, 240rpm overnight incubations to OD600=3.4000rpm, 10min collects thalline, with 10mM MES pH 5.6,10mM MgCl2, 10 μm of acetosyringone solution have hanged thalline, adjust OD600To 1.5.Express the Agrobacterium OD of p19600It is transferred to 1.0.PCam1300-35S-ncRNA-Csy4-sgRNA will be contained, Three kinds of Agrobacteriums of pCam1300-35S-infA-Cas9, p19 carrier are with 1：1：1 ratio mixing, is stored at room temperature 2-3 hours Afterwards, Agrobacterium is injected into the good tobacco leaf back side of 4 weeks or so growth conditions with the 1ml injector for medical purpose without syringe needle.Training The variation of sampling observation GFP signals after supporting 60-72 hours.
Transformation of Arabidopsis thaliana and screening
Suitable sgRNA sequences are chosen to be fitted into pCam1300-UBQ-sgRNA-35S-Cas9 carriers according to preceding method. Respective carrier is transferred in Agrobacterium GV3101.It chooses the Col-0 of healthy and strong full-bloom stage and genetic transformation is carried out with flower-dipping method, normally Sowing obtains T after nursing one month0For seed.T0For 1/2MS of the seed in the hygromycin containing 50mg/L after 5% hypochlorite disinfectant It is screened on tablet, greenhouse is positioned in positive transplantation of seedlings to Nutrition Soil and continues to cultivate.
Chloroplaset is extracted to be detected with Western blot
By plant tissue in 0.33M sorbitol, the 20mM tricine (pH 8.4) of precooling, 5mM in freezer EGTA, 5mM EDTA, 10mM NaHCO3, used according to ratios of the 4ml per mg in 0.1% (w/v) BSAHomogenate Device is smashed.It is primary with 3 layers of filtered through gauze then primary with one layer of Miracloth filtering.2000g centrifuges 2 points in 4 degree of centrifuges Clock, with 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl2, 2.5mM EDTA, 10mM NaHCO3, 0.1% (w/v) BSA, 2mM ascorbate will be precipitated and suspended.Suspension is placed in the Percoll of 40/100% (v/v) (sigma) 4 degree of centrifugations, 30 minutes (40% (v/v) Percoll solution in gradient：0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl2, 2.5mM EDTA, 10mM NaHCO3, 0.2% (w/v) BSA, 2 mM ascorbate, 40% (v/v) Percoll；100% (v/v) Percoll solution：0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl2, 2.5mM EDTA, 10mM NaHCO3, 0.2% (w/v) BSA, 2mM ascorbate, 100% (v/v).It collects and is located at two layers Complete excision among Percoll gradients adds in 10ml 0.33M sorbitol, 20mM HEPES (pH 7.9), 5mM MgCl2, 2.5mM EDTA, 10mM NaHCO3, 0.1% 4 degree of (w/v) BSA, 2mM ascorbate, 2000g centrifugations 2 minutes. Obtained precipitation is chloroplaset.
200 μ l 50mM Tris-Hcl (pH6.8), 2% (w/v) SDS, 10% (v/v) are added in the chloroplaset carried Glycerine, 1% (v/v) mercaptoethanol.It boils 5 minutes, is centrifuged 15 minutes at 4 degree with maximum speed, transfer supernatant to one at 95 degree In a new pipe.2 μ l 150mM Tris-Hcl (pH6.8), 6% (w/v) SDS, 0.3% (w/v) bromine phenol are added in per μ l supernatants Indigo plant, 30% (v/v) glycerine, 3% (v/v) mercaptoethanol.With 8% SDS-PAGE glue protein isolates, the albumen after separation is existed It is transferred on PVDF (Millipore) film with Bio-Rad instruments under the voltage of 105V.At 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20,5%SKIM MILK POWDER, middle closing 1 hour.In 20mM Tris-HCl (pH 8), in 150mM NaCl, 0.1% (V/V) Tween 20,2%SKIM MILK POWDER by primary antibody (anti-TOC75, Anti-Bip (agrisera), anti-GFP (abcam)) with after suitable dilution proportion, pvdf membrane is incubated 1 hour.With 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20 are washed 4 times, and the time is respectively 15 minutes, 5 points Clock, 5 minutes, 5 minutes.In 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20,2%SKIM By after the suitable dilution proportion of secondary antibody (abmart) in MILK POWDER, pvdf membrane is incubated 1 hour.Use 20mM Tris-HCl (pH 8), 150mM NaCl, 0.1% (V/V) Tween 20 are washed 4 times, and the time is respectively 15 minutes, 5 minutes, 5 points Clock, 5 minutes.Use TanonTMDeveloped after High-sig ECL Western Blotting Substrate colour developings with X-ray.
Chloroplast DNA extracts and sequencing
Extract chloroplast DNA with DNeasy Plant Maxi Kit (QIAGEN), run glue to the chloroplast DNA of extraction into Row quality testing determines no RNA pollutions and the DNA molecular amount approximate range obtained.Then using COVARIS S220 leaf Green body DNA fragmentation selection is interrupted to 450-600bp, constant volume to 60ul, uses Illumina DNA Sample Preparation Kit add in 40ul End Repair Mix, and 30 degree are handled 30 minutes, add in 160ul AMPure XP Beads is purified, and constant volume to 17.5ul adds in 12.5ul A-Tailing Mix, 37 degree 30 minutes, addition 2ul DNA Adapter Index, 3ul Resuspension Buffer and 2.5ul Ligation Mix, 30 degree are reacted 30 minutes, add in 5ul Stop 42ul AMPure XP Beads purifying is added in after Ligation Buffer mixings, 10ul is then settled to, is quantified with Qubit Clip size is detected with Agilent 2100Bioanalyzer.Finally use illumina HiSeq2500 Rapid patterns PE250 Sequencing.
Embodiment 1
Verify that chloroplast signal peptide infA and non-coding RNA can be respectively Cas9-GFP fusion proteins and GFP in tobacco MRNA brings chloroplaset into
Build Cas9 the and GFP fusion proteins (Figure 1A) with chloroplast signal peptide infA of 35S promoter driving；Structure Build the GFP for being connected with non-coding RNA of 35S promoter driving.This 2 carriers in tobacco are carried out instantaneous conversion verification, are sent out The red fluorescence now sent out by the GFP green fluorescences sent out and chlorophyll common location in chloroplaset, it was demonstrated that chloroplast signal peptide Cas9-GFP fusion proteins and GFP mRNA can be brought into chloroplaset (Figure 1B) by infA and non-coding RNA respectively.
Embodiment 2
Verify that non-coding RNA can guide the sgRNA with Csy4 and 2 Csy4 recognition site to chloroplaset in tobacco In
The sgRNA with Csy4 and 2 Csy4 recognition site of 35S promoter driving non-coding RNA guiding is built, so Pass through instantaneous conversion tobacco afterwards.After Agrobacterium conversion tobacco 3 days half, the chloroplaset of tobacco is extracted.It is demonstrate,proved by Western blot The chloroplaset of bright tobacco obtains (Fig. 2) by good purifying, and BiP and Toc75 are respectively as cytoplasm and the label of chloroplaset.
Next RNA is extracted to the chloroplaset of acquisition, then by being cyclized reverse transcription PCR (circularized Reverse transcription PCR, cRT-PCR) sgRNA is detected.Sequencing result：In 6 clones of detection , respectively there is the ripe sgRNA (Fig. 3) formed after being cut by Csy4 in chloroplaset in (each 3 clones).
Embodiment 3
Double-stranded DNA destruction is carried out on the Chloroplast gene of pMSK56 plant using CRISPR
The Cas9 with chloroplast signal peptide infA of 35S promoter driving is built, then in it and experimental procedure 2 The sgRNA (Figure 1A) with Csy4 and 2 Csy4 recognition site of the 35S promoter driving non-coding RNA guiding of structure.
In the present embodiment, 2 different target spots are had chosen respectively：sgRNA1(SEQ ID No.:And sgRNA2 8) (SEQ ID No.:9) cotransformation pMSK56 plant.There are aadA16GFP genes on the Chloroplast gene of pMSK56 plant, The aadA-GFP fusion proteins of this gene code fluoresced green in chloroplaset, so each chloroplaset comes from The green fluorescence of aadA-GFP and the red fluorescence (Fig. 1 C) from chlorophyll.And by the pMSK56 after this 2 carrier cotransformations In plant, observed only red fluorescence, without the chloroplaset (Fig. 1 C) of green fluorescence, this is indicated that on chloroplaset AadA16GFP may be mutated, and is next extracted wild-type tobacco, pMSK56 and has been converted 35S promoter respectively Cas9 with chloroplast signal peptide infA and 35S promoter the driving non-coding RNA guiding of driving with Csy4 and 2 The chloroplaset of the sgRNA of Csy4 recognition sites.Western blot prove that conversion has in the pMSK56 plant of Cas9 and sgRNA The quantity of aadA-GFP albumen reduce.
Nucleotide sequence SEQ ID No.:8
TGCACGACGACATCATTCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT
Nucleotide sequence SEQ ID No.:9
AGAAGGTCTTAAAGTCGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT
Embodiment 4
Utilize mutation of the two generation sequencing technologies detection CRISPR on Chloroplast gene
The blade for having the pMSK56 plants of sgRNA2 to conversion in embodiment 3 extracts chloroplaset, then uses DNeasy Plant Maxi Kit (Qiagen) extract chloroplast DNA, are then detected with two generation sequencing technologies in reporter gene The mutation of aadA16GFP.Sequencing result finds there is insertion DNA in the aadA16GFP for the pMSK56 plants for having sgRNA2 in conversion Segment (Fig. 4 A, the sequence in box is is inserted into DNA fragmentation), then demonstrates this according to corresponding primers PCR As a result, the chloroplast DNA for only having the pMSK56 plants of sgRNA2 in conversion can be expanded to band (Fig. 4 B).
Embodiment 5
Targeting knockdown is carried out on the Chloroplast gene of pMSK56 plant using CRISPR
Build the Cas9 (dCas9 without nuclease with chloroplast signal peptide infA of 35S promoter driving: D10A and H840A) and 35S promoter driving non-coding RNA guiding the sgRNA with Csy4 and 2 Csy4 recognition site (targeting aadA16gfp genes) conversion pMSK56 plant.Inventor uses western respectively in 5 T1 are for transgenosis single plant Blot and real-time quantitative PCR have detected the expression quantity of dCas9 and gfp genes respectively.Inventor has found the expression of dCas9 albumen Negatively correlated (Fig. 5) is presented in amount and the expression quantity of GFP, i.e., the expression quantity of GFP is low in the high plant of dCas9 expressing quantities.
Embodiment 6
Targeting knockdown is carried out on the Chloroplast gene of arabidopsis var2 plant using CRISPR, so as to restore Its variegated phenotype of leaf.
Build the Cas9 without nuclease with chloroplast signal peptide infA of UBQ promoters driving (dCas9) intend with the sgRNA conversions with Csy4 and 2 Csy4 recognition site of 35S promoter driving non-coding RNA guiding Southern mustard var2 plant (Fig. 6 A).The gene of sgRNA targetings is the rpl33 (Fig. 6 B) on Chloroplast gene.Inventor is in T1 generations The expression of targeting reduction rpl33 is found in transfer-gen plant can restore leaf variegated phenotype (Fig. 7, the table of var2 mutation mediations 1), then these phenotypes are restored and the plant extract RNA without restoring carries out real-time quantitative PCR detection.It was found that in rpl33 Expression quantity have reduction (Fig. 6) in this 2 class plant, the relatively low plant of expression quantity can restore the leaf of var2 mutation mediations Variegated phenotype.
The variegated phenotype statistics of leaf after low rpl33 is struck in the targeting of table 1.var2 mutant
All references mentioned in the present invention is incorporated herein by reference, just as each document coverlet It is solely incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, people in the art Member can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims and limited Fixed range.
Bibliography
Gómez,G.,and Pallás,V.(2010).Noncoding RNA Mediated Traffic of Foreign mRNA into Chloroplasts Reveals a Novel Signaling Mechanism in Plants.PloS one 5,e12269.
Haurwitz,R.E.,Jinek,M.,Wiedenheft,B.,Zhou,K.,and Doudna, J.A.(2010) .Sequence-and Structure-Specific RNA Processing by a CRISPR Endonuclease.Science 329,1355-1358.
Khan,M.S.,and Maliga,P.(1999).Fluorescent antibiotic resistance marker for tracking plastid transformation in higher plants. Nat Biotech 17, 910-915.
Sequence table
<110>Shanghai Inst. of Life Science, CAS
<120>Chloroplast gene edit methods
<130> P2017-2453
<150> 201611115749.6
<151> 2016-12-07
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 883
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 1
tcaacatggt ggagcacgac acacttgtct actccaaaaa tatcaaagat acagtctcag 60
aagaccaaag ggcaattgag acttttcaac aaagggtaat atccggaaac ctcctcggat 120
tccattgccc agctatctgt cactttattg tgaagatagt ggaaaaggaa ggtggctcct 180
acaaatgcca tcattgcgat aaaggaaagg ccatcgttga agatgcctct gccgacagtg 240
gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300
cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacaca cttgtctact 360
ccaaaaatat caaagataca gtctcagaag accaaagggc aattgagact tttcaacaaa 420
gggtgatatc cggaaacctc ctcggattcc attgcccagc tatctgtcac tttattgtga 480
agatagtgga aaaggaaggt ggctcctaca aatgccatca ttgcgataaa ggaaaggcca 540
tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600
tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660
ccactgacgt aagggatgac gcacaatccc actatccttc gcaagaccct tcctctatat 720
aaggaagttc atttcatttg gagaggacct cgacctcaac acaacatata caaaacaaac 780
gaatctcaag caatcaagca ttctacttct attgcagcaa tttaaatcat ttcttttaaa 840
gcaaaagcaa ttttctgaaa attttcacca tttacgaacg ata 883
<210> 2
<211> 284
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 2
tgattgatcg atagagctcg aatttccccg atcgttcaaa catttggcaa taaagtttct 60
taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg 120
ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga 180
ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact 240
aggataaatt atcgcgcgcg gtgtcatcta tgttactaga tcgg 284
<210> 3
<211> 180
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 3
atgcttcaac tctgctccac tttccgtcct caacttcttc ttccttgtca attccgattt 60
acaaatggcg ttttgattcc ccaaataaac tatgttgcaa gcaattcagt tgtgaatatc 120
cggccaatga tacgatgcca gagagcaagc ggaggaagag gaggagctaa tagaagcaaa 180
<210> 4
<211> 720
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 4
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720
<210> 5
<211> 330
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 5
ttggcgaaac cccatttcga cctttcggtc tcatcagggg tggcacacac caccctatgg 60
ggagaggtcg tcctctatct ctcctggaag gccggagcaa tccaaaagag gtacacccac 120
ccatgggtcg ggactttaaa ttcggaggat tcgtccttta aacgttcctc caagagtccc 180
ttccccaaac ccttactttg taagtgtggt tcggcgaatg taccgtttcg tcctttcgga 240
ctcatcaggg aaagtacaca ctttccgacg gtgggttcgt cgacacctct ccccctccca 300
ggtactatcc cctttccagg atttgttccc 330
<210> 6
<211> 564
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 6
atggaccact atctggacat cagactgagg cccgatcctg agttccctcc cgcccagctg 60
atgagcgtgc tgtttggcaa gctgcatcag gctctggtcg cccaaggcgg agacagaatc 120
ggcgtgtcct tccccgacct ggacgagtcc cggagtcgcc tgggcgagcg gctgagaatc 180
cacgccagcg cagacgatct gcgcgccctg ctggcccggc cttggctgga gggcctgcgg 240
gatcatctgc agtttggcga gcccgccgtg gtgccacacc caacacccta ccgccaggtg 300
agccgcgtgc aggccaagtc aaatcccgag agactgcggc ggaggctgat gaggcgacat 360
gatctgagcg aggaggaggc cagaaagaga atccccgaca cagtggccag agccctggat 420
ctgccatttg tgaccctgcg gagccagagc actggccagc atttcagact gttcatcaga 480
cacgggcccc tgcaggttac agccgaggag ggcggattta catgctatgg cctgtctaaa 540
ggcggcttcg tgccctggtt ctaa 564
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 7
gttcactgcc gtataggcag 20
<210> 8
<211> 100
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 8
tgcacgacga catcattccg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100
<210> 9
<211> 100
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 9
agaaggtctt aaagtcgcca gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100

Claims (10)

1. a kind of nucleic acid constructs, which is characterized in that the nucleic acid constructs is selected from the group：
(1) Formulas I nucleic acid constructs：
X1-X2-X3-X4-X5 (I)
In formula,
X1 is promoter element；
X2 is chloroplast localisation signal peptide element；
X3 is nuclease element；
X4 is nothing or marker gene element；
X5 is terminator；
(2) Formula II nucleic acid constructs：
Y1-Y2-Y3-Y4-Ya-Y5-Yb-Y6 (II)
In formula,
Y1 is promoter element；
Y2 is ncRNA elements；
Y3 is nothing or marker gene element；
Y4 is nothing or RNA nickase elements；
Ya and Yb is each independently nothing or RNA nickase recognition components；
Y5 is sgRNA elements；
Y6 is terminator；
(3) construction including Formulas I construction and Formula II construction.
2. nucleic acid constructs as described in claim 1, which is characterized in that the Formulas I nucleic acid constructs amplifying nucleic acid enzyme element X3 It is selected from the group：
(1)Cas9；
(2)Cpf1；
(3) Zinc finger nuclease；
(3) transcriptional activator sample nuclease；
(4) huge nuclease；
Or combination.
3. nucleic acid constructs as described in claim 1, which is characterized in that the Formulas I nucleic acid constructs Chloroplast positioning letter Number peptide element X2 is chloroplast signal peptide infA.
4. nucleic acid constructs as described in claim 1, which is characterized in that ncRNA elements Y2 in the Formula II nucleic acid constructs From viroid.
5. nucleic acid constructs as described in claim 1, which is characterized in that RNA nickases member in the Formula II nucleic acid constructs Part Y4 is Csy4.
6. nucleic acid constructs as described in claim 1, which is characterized in that sgRNA elements Y5 in the Formula II nucleic acid constructs For spCas9sgRNA.
7. a kind of carrier or carrier combination, which is characterized in that the carrier or carrier combination contain any institute in claim 1-6 The nucleic acid constructs stated.
8. carrier as claimed in claim 7 or carrier combination, which is characterized in that the Formulas I nucleic acid constructs and Formula II core Acid construct level is in identical carrier.
9. a kind of reagent combination, which is characterized in that including：(i) carrier described in claim 7 or carrier combination.
A kind of 10. plant chloroplast gene editing method, which is characterized in that including step：
(i) by the optional donor nucleic acid fragment of the carrier described in (a) claim 7 or carrier combination and (b), it is thin to import plant Born of the same parents, plant tissue or plant, so as to generate gene editing in the plant cell, plant tissue or plant；With
(ii) optionally, plant cell or plant that the gene editing occurs are detected, screened or identified.
CN201711287309.3A 2016-12-07 2017-12-07 Chloroplast genome editing method Active CN108165573B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201611115749 2016-12-07
CN2016111157496 2016-12-07

Publications (2)

Publication Number Publication Date
CN108165573A true CN108165573A (en) 2018-06-15
CN108165573B CN108165573B (en) 2022-01-14

Family

ID=62490732

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711287309.3A Active CN108165573B (en) 2016-12-07 2017-12-07 Chloroplast genome editing method

Country Status (2)

Country Link
CN (1) CN108165573B (en)
WO (1) WO2018103686A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109456990A (en) * 2018-10-24 2019-03-12 湖南杂交水稻研究中心 A method of chloroplast genetic transformation efficiency is improved using genome editing technique
CN111254159A (en) * 2018-11-30 2020-06-09 东北农业大学 Soybean GmST1 gene mutant plant and preparation method thereof
CN112280799A (en) * 2020-10-22 2021-01-29 中国热带农业科学院橡胶研究所 Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system
US11920140B2 (en) 2017-08-22 2024-03-05 Napigen, Inc. Organelle genome modification using polynucleotide guided endonuclease

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2853829C (en) 2011-07-22 2023-09-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
WO2016022363A2 (en) 2014-07-30 2016-02-11 President And Fellows Of Harvard College Cas9 proteins including ligand-dependent inteins
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
IL308426A (en) 2016-08-03 2024-01-01 Harvard College Adenosine nucleobase editors and uses thereof
CN109804066A (en) 2016-08-09 2019-05-24 哈佛大学的校长及成员们 Programmable CAS9- recombination enzyme fusion proteins and application thereof
WO2018039438A1 (en) 2016-08-24 2018-03-01 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
AU2017342543A1 (en) 2016-10-14 2019-05-02 President And Fellows Of Harvard College AAV delivery of nucleobase editors
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
JP7191388B2 (en) 2017-03-23 2022-12-19 プレジデント アンド フェローズ オブ ハーバード カレッジ Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
EP3658573A1 (en) 2017-07-28 2020-06-03 President and Fellows of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
EP3697906A1 (en) 2017-10-16 2020-08-26 The Broad Institute, Inc. Uses of adenosine base editors
DE112020001342T5 (en) 2019-03-19 2022-01-13 President and Fellows of Harvard College Methods and compositions for editing nucleotide sequences
JP2023525304A (en) 2020-05-08 2023-06-15 ザ ブロード インスティテュート，インコーポレーテッド Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015048577A2 (en) * 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions
EP2989206A1 (en) * 2013-04-23 2016-03-02 Rheinische Friedrich-Wilhelms-Universität Bonn Improved gene targeting and nucleic acid carrier molecule, in particular for use in plants
CN105531372A (en) * 2013-06-14 2016-04-27 塞尔克蒂斯股份有限公司 Methods for non-transgenic genome editing in plants
CN105916987A (en) * 2013-08-22 2016-08-31 纳幕尔杜邦公司 Plant genome modification using guide RNA/Cas endonuclease systems and methods of use

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103981215B (en) * 2014-05-23 2016-06-29 安徽省农业科学院水稻研究所 A kind of for engineered key plasmid vector and application
CN103981216B (en) * 2014-05-23 2016-06-22 安徽省农业科学院水稻研究所 A kind of key plasmid vector and application
CN105602935B (en) * 2014-10-20 2020-11-13 聂凌云 Novel mitochondrial genome editing tool

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2989206A1 (en) * 2013-04-23 2016-03-02 Rheinische Friedrich-Wilhelms-Universität Bonn Improved gene targeting and nucleic acid carrier molecule, in particular for use in plants
CN105531372A (en) * 2013-06-14 2016-04-27 塞尔克蒂斯股份有限公司 Methods for non-transgenic genome editing in plants
CN105916987A (en) * 2013-08-22 2016-08-31 纳幕尔杜邦公司 Plant genome modification using guide RNA/Cas endonuclease systems and methods of use
WO2015048577A2 (en) * 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
葛玲巧等: "乌拉尔图小麦叶绿体RNA编辑位点的预测与鉴定 ", 《分子植物育种》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11920140B2 (en) 2017-08-22 2024-03-05 Napigen, Inc. Organelle genome modification using polynucleotide guided endonuclease
CN109456990A (en) * 2018-10-24 2019-03-12 湖南杂交水稻研究中心 A method of chloroplast genetic transformation efficiency is improved using genome editing technique
CN109456990B (en) * 2018-10-24 2022-01-07 湖南杂交水稻研究中心 Method for improving chloroplast genetic transformation efficiency by using genome editing technology
CN111254159A (en) * 2018-11-30 2020-06-09 东北农业大学 Soybean GmST1 gene mutant plant and preparation method thereof
CN112280799A (en) * 2020-10-22 2021-01-29 中国热带农业科学院橡胶研究所 Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system
CN112280799B (en) * 2020-10-22 2023-02-17 中国热带农业科学院橡胶研究所 Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system

Also Published As

Publication number Publication date
CN108165573B (en) 2022-01-14
WO2018103686A1 (en) 2018-06-14

Similar Documents

Publication Publication Date Title
CN108165573A (en) Chloroplast gene edit methods
CA2883800C (en) Fluorescence activated cell sorting (facs) enrichment to generate plants
US11584936B2 (en) Targeted viral-mediated plant genome editing using CRISPR /Cas9
US20160264982A1 (en) Method for plant genome site-directed modification
AU2016309392A1 (en) Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution
Pathak et al. Recombinase‐mediated integration of a multigene cassette in rice leads to stable expression and inheritance of the stacked locus
Yuan et al. Efficient base editing in tomato using a highly expressed transient system
KR20160111450A (en) Zea mays regulatory elements and uses thereof
WO2019238772A1 (en) Polynucleotide constructs and methods of gene editing using cpf1
Tian et al. Green fluorescent protein as a tool for monitoring transgene expression in forest tree species
JP4603882B2 (en) Transgenic plants with controlled trait distribution to offspring
JP4863602B2 (en) Plant system for comprehensive gene function analysis using full-length cDNA
KR20160065952A (en) Zea mays metallothionein-like regulatory elements and uses thereof
WO2009072676A1 (en) Transformed plant with promoted growth
US20210348177A1 (en) Generation of heritably gene-edited plants without tissue culture
CN110129357A (en) A kind of no label is used for the reagent combination and its application of gene editing
US20230272408A1 (en) Plastid transformation by complementation of plastid mutations
WO2020171192A1 (en) Nucleic acid for editing genome of plant cell and use thereof
JP4595631B2 (en) Method for producing transgenic cell, tissue or plant in which influence of selection marker gene is excluded
CA2517856A1 (en) Removal of plastid sequences by transiently expressed site-specific recombinases
JP2008173011A (en) Method for preparation of transgenic plant, and utilization thereof
CN107188938A (en) Paddy rice resists leaf senile albumen RLS3 and its encoding gene and application
WO2022219175A1 (en) Mobile endonucleases for heritable mutations
CN117106820A (en) Method for creating few lateral branches of tomatoes through genome editing and application of method
WO2004090130A1 (en) Novel vector and method of constructing transformant plant using the vector

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20200508

Address after: 200031 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai

Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences

Address before: 200031 Yueyang Road, Shanghai, No. 319, No.

Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant