CN112143730B

CN112143730B - Soybean GmEF1B gene mutant plant and preparation method and application thereof

Info

Publication number: CN112143730B
Application number: CN201910582526.8A
Authority: CN
Inventors: 邹佳男
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2019-06-28
Filing date: 2019-06-28
Publication date: 2022-09-30
Anticipated expiration: 2039-06-28
Also published as: CN112143730A

Abstract

A soybean GmEF1B gene mutant plant and a preparation method and application thereof belong to the technical field of plant biology. In order to determine the disease resistance function of soybean sclerotinia resistance related genes and accelerate the breeding process of soybean sclerotinia resistance varieties, the invention provides a soybean GmEF1B gene mutant plant, wherein the mutant plant contains a mutant soybean GmEF1B gene, and the mutation means that a 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in a coding region of a GmEF1B gene is subjected to base substitution or deletion so that the coded amino acid sequence is changed. The mutant plant is prepared by a CRISPR/Cas9 gene editing method. The invention can be used for breeding the soybean sclerotinia rot resistant variety.

Description

Soybean GmEF1B gene mutant plant and preparation method and application thereof

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to a soybean GmEF1B gene mutant plant and a preparation method and application thereof.

Background

Soybean sclerotiniose is a fungal disease caused by Sclerotinia sclerotiorum (Lib.) de bark, is a worldwide disease seriously harmful to soybean, directly affects the quality and yield of soybean, and has a disease rate of 50-90% when the disease is serious, even is out of production. Due to the limitation of the traditional breeding method, the screening and identification of effective disease-resistant genes by using a molecular means are particularly important for breeding disease-resistant varieties, but the gene resources for breeding the current disease-resistant varieties are rare, so that the efficiency and the accuracy of breeding new varieties are restricted.

Disclosure of Invention

In order to determine the disease resistance function of soybean sclerotinia sclerotiorum resistant related genes and accelerate the breeding process of soybean sclerotinia sclerotiorum resistant varieties, the invention provides a soybean GmEF1B gene mutant plant, wherein the mutant plant contains a mutant soybean GmEF1B gene, and the mutation refers to the base substitution or deletion of a 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in a GmEF1B gene coding region so as to change the coded amino acid sequence; the nucleotide sequence of the soybean GmEF1B gene is shown as SEQ ID NO: 1 is shown.

Further limited, the nucleotide sequence of the mutated soybean GmEF1B gene is shown as SEQ ID NO: shown at 10.

The invention also provides a preparation method of the soybean GmEF1B gene mutant plant, which comprises the following steps:

1) designing a gRNA single-target primer according to a soybean GmEF1B gene;

2) preparing a gRNA single-target primer dimer;

3) inserting the primer dimer into a Cas9/gRNA vector to construct a soybean GmEF1B gene knockout vector;

4) and (4) transforming the GmEF1B gene knockout vector constructed in the step 3) into soybeans, and screening to obtain soybean GmEF1B gene mutant plants.

Further limited, the forward primer of the soybean GmEF1B gRNA single-target primer in the step 1) is GmEF1B-1-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO: 2, the reverse primer is GmEF1B-1-A, and the nucleotide sequence is shown as SEQ ID NO. 3.

Further limited, the preparation of gRNA single-target primer dimer in step 2) means that 5. mu.L of forward primer, 5. mu.L of forward primer and H are added in each 20uL synthesis system ₂ O15 mu L, reaction condition is 95 ℃ for 3min, and the mixture is cooled and then stands.

Further limiting, the step 3) of constructing the GmEF1B gene knockout vector means that in every 10uL reaction system, 1-7 uL primer dimer, 1 uL Cas9/gRNA vector, 1 uL Solution 11 uL Solution 21 uL, H ₂ O0-6 μ L, reacting at 16 deg.C for 5-10 h.

Further defined, the soybean of step 4) is a soybean variety Maple Arrow; the agrobacterium is agrobacterium EHA 105.

Further defined, the forward primer used in the screening of step 4) is mutV-S, the nucleotide sequence of which is shown in SEQ ID NO: 4, the reverse primer is mutV-A, and the nucleotide sequence is shown as SEQ ID NO: 5, used for screening positive mutant plants.

Further limited, the forward primer used in the screening in the step 4) is GmEF1B-target1-S, and the nucleotide sequence of the forward primer is shown as SEQ ID NO: 6, the reverse primer sequence is GmEF1B-target1-A, and the nucleotide sequence is shown as SEQ ID NO: 7, the two primers are used as single-target point mutation detection primers for detecting soybean GmEF1B gene mutant plants constructed by using primers GmEF1B-1-S and GmEF 1B-1-A.

The soybean GmEF1B gene mutant plant can be used for functional research of the GmEF1B gene or breeding of soybean sclerotinia resistant varieties.

Nouns and abbreviations: kanamycin: kan; streptomycin: str; rifampicin: and Rif.

Advantageous effects

The soybean GmEF1B gene coding region is subjected to targeted mutation by using a CRISPR/Cas9 technology to obtain a soybean mutant plant, and the comparison with wild type phenotype identification and GmEF1B gene expression analysis shows that after the GmEF1B gene is mutated, the resistance of the soybean sclerotiniose is weakened, and the GmEF1B can participate in the resistance reaction of soybean sclerotiniose resistance.

Drawings

FIG. 1 shows the PCR identification result of the colony after Escherichia coli is transformed by GmEF1B gene knockout vector, M: DL2000 marker; 1-5: 5 positive colonies;

FIG. 2T ₁ And (3) PCR detection results of the GmEF1B gene mutant plants, wherein M: DL2000 marker; 1: positive control, 2: negative control, 3: blank control (water), 4-6: t is ₁ Generating a PCR product of a mutant plant;

FIG. 3T ₁ Sequencing the PCR product of the GmEF1B gene mutant plant;

FIG. 4T ₁ The GmEF1B gene mutant and the wild plant leaf are expressed after being inoculated with sclerotinia sclerotiorum, CK: maple Arrow leaf blade; 1-7: mutant plant leaves.

Detailed Description

Soybean variety Maple Arrow, described in lugchun, zhao snow, et al, soybean variety Maple Arrow, biochemical mechanism of resistance to sclerotinia disease [ J ]. proceedings of chinese oil crops 2014,36(5):630.

Sclerotinia sclerotiorum is described in Luchunmi, Zhao Yue, Zhao Xue, et al, Soybean variety Maple Arrow, Biochemical mechanism of resistance to sclerotinia sclerotiorum [ J ]. proceedings of oil crops in China, 2014,36(5):630.

The CRISPR/Cas9 kit used was purchased from beijing has shangrid biotechnology limited, cat # VK 005-15.

The preparation method of the LB culture medium comprises the following steps: per liter of medium was prepared, adding to 950ml of deionized water: tryptone 10g, yeast extract 5g, NaCl 10g, shaking the container until the solutes are dissolved. The pH value is adjusted to 7.0 by using 5mol/L NaOH, and the volume is adjusted to 1L by using deionized water. Steam sterilizing at 121 deg.C under 15psi for 21 min.

YEP liquid medium: per liter of medium was prepared, adding to 950ml of deionized water: tryptone 10g, yeast extract 5g, NaCl 5g, shaking the container until the solutes are dissolved. The pH value is adjusted to 7.0 by using 5mol/L NaOH, and the volume is adjusted to 1L by using deionized water. Steam sterilizing at 121 deg.C under 15psi for 21 min.

MS ₀ Culture medium: weighing 4.43g of MS powder and 30g of sucrose, adding 600-800ml of distilled water for dissolving, adjusting the pH value to 5.8 after fully stirring and dissolving by a glass rod, fixing the volume to 1L, adding 6g of agar powder, and performing steam sterilization at the temperature of 121 ℃ and under the high pressure of 15psi for 21 min.

Unless otherwise specified, all reagents, instruments, and devices used in the art are commercially available.

The molecular biological experiments such as reverse transcription, PCR amplification, gel recovery and the like, which are referred to in the following embodiments, are performed according to the corresponding product specifications or according to standard molecular cloning techniques, unless otherwise specified.

Example 1 soybean GmEF1B gene mutant plants.

The soybean GmEF1B gene mutant plant of the embodiment contains a mutant soybean GmEF1B gene, and the mutation refers to base substitution or deletion of a 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in a GmEF1B gene coding region, so that the coded amino acid sequence is changed; the nucleotide sequence of the soybean GmEF1B gene is shown as SEQ ID NO: 1 is shown.

Example 2 preparation of soybean GmEF1B gene mutant plant.

The following examples describe the preparation method of soybean GmEF1B gene mutant plants of the invention:

in the mutant plant of this embodiment, the mutated GmEF1B gene refers to nucleotide substitution or deletion of 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in coding region of GmEF1B gene, so that the coded amino acid sequence is changed; namely, the target nucleotide sequence is: 5 'GCTTCCCCGGCAATGCTCAA 3' is located at bases 203 to 222 of the coding region of GmEF 1B. The preparation steps are as follows:

1) a gRNA single-target primer is designed according to the soybean GmEF1B gene.

Firstly, amplifying to obtain soybean GmEF1B gene, taking soybean variety Maple Arrow as a material, taking the material when a first group of three compound leaves grow out, extracting total RNA and carrying out reverse transcription to synthesize a cDNA first chain. According to the sequence of the GmEF1B gene on the Phytozome, a Primer 5 software is used for designing a gene cloning Primer, and the nucleotide sequence is as follows:

primers 1-S: 5'-ATGGCCGTTACCTTCTCAAAT-3' (SEQ ID NO: 8);

primer 1-A: 5'-TTAGATTTTGTTGAATGCAAC-3' (shown in SEQ ID NO: 9).

Performing RT-PCR reaction by using cDNA as a template, wherein the reaction system comprises the following reaction procedures: 5min at 94 ℃; 38 cycles: 30s at 94 ℃, 30s at 60 ℃ and 30s at 72 ℃; preserving at 72 deg.C for 10min and 4 deg.C. And after the reaction, taking the PCR product, carrying out 1% agarose gel electrophoresis detection, and carrying out gel recovery and purification on the target fragment. The RT-PCR reaction system is as follows:

according to the steps of a PGM-T cloning kit of TIANGEN company, the obtained gel recovery product is connected with a cloning vector to obtain a cloning plasmid pGM-T-GmEF1B with a target gene, a Top10 large intestine competent cell is transformed, and a single clone is selected and subjected to PCR and sequencing verification. Finally obtaining the GmEF1B gene of which the target fragment size is 675bp, as shown in SEQ ID NO: 1 is shown.

According to the obtained GmEF1B gene sequence, a gRNA single-target primer is designed. The forward primer is GmEF1B-1-S, 5'-ttgGCTTCCCCGGCAATGCTCAA-3' (shown in SEQ ID NO: 2), the reverse primer is GmEF1B-1-A, 5'-aacTTGAGCATTGCCGGGGAAGC-3' (shown in SEQ ID NO: 3), and the primers are synthesized by a primer synthesis company.

2) Preparation of gRNA single target primer dimer.

Mixing the forward primers and the reverse primers according to the following proportion to form a dimer: GmEF1B-1-S/A (10. mu.M) each 5. mu.L, H ₂ After mixing O15. mu.L, the following treatments were carried out: 3min at 95 ℃; slowly cooling at 95-25 deg.C; 5min at 16 ℃.

3) And inserting the primer dimer into a Cas9/gRNA vector in a CRISPR/Cas9 kit to construct a GmEF1B gene knockout vector.

The reaction system was as follows (10. mu.l system): the reaction was carried out at 16 ℃ overnight.

4) Transforming agrobacterium to the GmEF1B gene knockout vector constructed in the step 3), infecting soybeans, and obtaining soybean GmEF1B gene mutant plants through identification.

a, converting: adding 10 μ l of the product into 50 μ l of TOP10 competent solution which is just thawed, flicking and mixing uniformly, ice-cooling for 30min, thermally shocking for 90s at 42 ℃, standing for 2min on ice, adding 500 μ l of non-resistant LB culture medium, placing in a constant temperature shaking table at 37 ℃, rotating for 170 r, recovering for 1h, coating a Kana resistant solid plate, culturing overnight at 37 ℃, picking 3-5 single-spot shaking bacteria, and carrying out bacteria liquid PCR and sequencing, as shown in figure 1. The PCR detection primers of the bacterial liquid are as follows:

mutV-S: 5'-AAAAGTCCCACATCGCTTAG-3' (shown in SEQ ID NO: 4)

mutV-A: 5'-TGTGCAAGGTAAGAAGATGG-3' (shown in SEQ ID NO: 5), the target fragment is 435bp, the sequencing result is compared with the vector sequence, and the positive bacterial liquid is stored at-80 ℃ for later use.

b. Transforming soybean stem tip by agrobacterium tumefaciens mediated method.

The GmEF1B gene knockout vector is transferred into agrobacterium EHA105, and the plasmid preserved in the experiment is adopted, and the method for transforming agrobacterium by a freeze-thaw method can refer to the following steps: the agrobacterium transformation method is described in the paper of doctor academic thesis, northeast agriculture university 2016.

The method is characterized in that a gGmEF1B-cas9 gene knockout vector is transformed into a disease-resistant soybean variety Maple Arrow by an agrobacterium-mediated method, and the specific method is as follows:

(1) preparing bacterial liquid: streaking prepared bacterial liquid on YEP solid plates (50mg/mL Str, 50mg/mL Kan, 25mg/mL Rif, the final concentration of each antibiotic in the culture medium, the same below) respectively at 28 ℃, culturing a single colony in YEP liquid culture medium (50mg/mL Str, 50mg/mL Kan, 25mg/mL Rif), performing shake culture at 28 ℃ and 200rpm for 1-2 days, inoculating 1-2mL bacterial liquid in 50mL fresh YEP liquid culture medium, and performing shake culture until OD is reached ₆₀₀ Is 0.6-0.8.

(2) Seed sterilization: the method comprises the steps of selecting full and sterile spot seeds in a culture dish, placing the seeds in a dryer in a ventilation kitchen by adopting a chlorine sterilization method, pouring 96mL of sodium hypochlorite into a triangular flask of the dryer, quickly adding 6mL of concentrated hydrochloric acid, and quickly covering and sealing the cover. Sterilizing for 16h, blowing off residual chlorine gas in a clean bench for about 30min, and sealing for later use.

(3) Seed germination: inoculating the sterilized seed to MS via umbilicus ₀ In the culture medium, 10 grains were inoculated in each flask, and the germination was carried out for 5-6 days at 23 ℃ under 16h light/8 h dark conditions.

(4) Preparing a stem tip explant: when the seed germinates to the point that the cotyledon breaks through the seed coat, the seed coat is removed by using a pair of tweezers and a scalpel, half of the two halves of the seed coat is cut off, axillary buds between the cotyledon and a growing point are slightly scraped by using the scalpel, 3-5 wounds are slightly scratched at the cotyledon node, and the rest part is used as an explant for infection.

(5) Infection and co-culture: and putting the prepared explant into the invasion dye liquor for vacuumizing for 10min under the condition of 0.6 pa. The explants after vacuum infection are washed by sterilized distilled waterThirdly, sucking the infection liquid on the surface of the explant by using sterile paper, and inserting the explant into MS ₀ Co-culturing for 3 days in a culture medium, observing the revival condition, determining the transplanting time according to the condition of the green turning of the explant, transplanting the explant into soil, and culturing in an incubator at 25 ℃ under 16h of illumination/8 h of darkness.

c. And (3) identifying mutant plants: taking T1 generation leaves of soybean plants with GmEF1B gene knocked out and control (MapleArrow) leaves, extracting DNA of the T1 generation leaves and the control (MapleArrow) leaves, and carrying out PCR identification by using primers:

mutV-S: 5'-AAAAGTCCCACATCGCTTAG-3' (SEQ ID NO: 4);

mutV-A: 5'-TGTGCAAGGTAAGAAGATGG-3' (shown in SEQ ID NO: 5), and the target fragment is 435bp, thereby identifying a transgenic plant transferring the GmEF1B gene knockout vector. Collecting soybean seeds identified as transgenic plants in the T1 generation, sowing the soybean seeds, extracting leaf DNA, and carrying out PCR detection by using a single-target point mutation detection primer, wherein the forward primer is as follows: GmEF1B-target1-S:5'-TTTTCCCAATGCTGCCAAGT-3' (SEQ ID NO: 6); reverse primer: GmEF1B-target1-A:5'-GCCCTGTAACCATAGGTCACATC-3' (SEQ ID NO: 7). Amplifying a target fragment 641bp (figure 2) and sequencing the product, wherein as shown in figure 3, the sequencing result shows that 1 positive plant has mutation at a target point, and has 1 base deletion compared with the wild type, and the mutated GmEF1B gene sequence is shown as SEQ ID NO: shown at 10. Soybean seeds identified as transgenic plants in the T1 generation were harvested and planted, and leaves were completely spread out in the first three compound leaves to inoculate sclerotinia sclerotiorum, which was observed one day after inoculation (fig. 4): the leaf surface of the soybean leaf is developed into dark green water stain-shaped stripes in the initial stage by comparison with the Maple Arrow, then the soybean leaf is expanded into irregular scabs, the center of the scabs is dark brown, the color of the periphery of the scabs is light brown, the leaf is yellowed in the later stage of treatment, and the scabs are expanded and stopped; the soybean leaf blade of the GmEF1B mutant plant generates large dark green water stain-like speckles on the early leaf surface, the later-stage scab expansion speed is accelerated, and finally the whole leaf blade is almost covered. The resistance of the disease-resistant variety Maple Arrow plant with the GmEF1B gene knocked out to soybean sclerotinia sclerotiorum is proved to be weakened, which shows that the GmEF1B gene generates the above-mentioned base deletion in the target region (nucleotide sequence is 5'-GCTTCCCCGGCAATGCTCAA-3') to change functional amino acid, thereby weakening the resistance of the disease-resistant variety Maple Arrow to sclerotinia sclerotiorum.

Nucleotide sequence listing

<110> northeast university of agriculture

<120> soybean GmEF1B gene mutant plant and preparation method and application thereof

<130>

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 675

<212> DNA

<213> Soybean GmEF1B Gene

<400> 1

atggccgtta ccttctcaaa tctccacaca gaatcaggtc tcaagtccct cgacgacttc 60

ctctctggga aggtctacgt ttctggggat cagttcacaa aggacgacat caaagtgtat 120

ggtgctgttt tggagaagcc aggtgactct tttcccaatg ctgccaagtg gtacgaggtt 180

gtctcatctc agcttgctgc aagcttcccc ggcaatgctc aaggggtgag attcagtggc 240

aaagcttctg ctccagcgga ggctgctcct gcgaaaccgg atgcttctgc tgctgaagat 300

gatgatgacc ttgatctctt tggcgatgag actgaggaag acaaaaaggc agcagaggaa 360

agggaggctg ctaagaagtc taccaagaag aaagagagtg gcaaatcttc tgttctgctt 420

gacgttaagc cttgggatga tgaaacagac atgaagaagc tggaagaggc tgttcgcagt 480

gttgagatgc ctggtctatt gtggggagca tccaaactgg ttcctgttgg ttatgggatc 540

aagaagttgc agatcatgtt aactattgtc gatgaccttg tatctgtgga cacccttgtt 600

gaggagactc tcacagttga gcccatcaat gagtatgtcc aaagctgtga cattgttgca 660

ttcaacaaaa tctaa 675

<210> 2

<211> 23

<212> DNA

<213> Forward primer GmEF1B-1-S

<400> 2

ttgcgacgac ttcctctctg gga 23

<210> 3

<211> 23

<212> DNA

<213> reverse primer GmEF1B-1-A

<400> 3

aactcccaga gaggaagtcg tcg 23

<210> 4

<211> 20

<212> DNA

<213> Forward primer mutV-S

<400> 4

aaaagtccca catcgcttag 20

<210> 5

<211> 20

<212> DNA

<213> reverse primer mutV-A

<400> 5

tgtgcaaggt aagaagatgg 20

<210> 6

<211> 20

<212> DNA

<213> Forward primer GmEF1B-target1-S

<400> 6

ttttcccaat gctgccaagt 20

<210> 7

<211> 23

<212> DNA

<213> reverse primer sequence GmEF1B-target1-A

<400> 7

gccctgtaac cataggtcac atc 23

<210> 8

<211> 21

<212> DNA

<213> primer 1-S

<400> 8

atggccgttaccttctcaaat 21

<210> 9

<211> 21

<212> DNA

<213> primer 1-A

<400> 9

ttagattttgttgaatgcaac 21

<210> 10

<211> 674

<212> DNA

<213> mutated soybean GmEF1B gene

<400> 10

atggccgtta ccttctcaaa tctccacaca gaatcaggtc tcaagtccct cgacgacttc 60

ctctctggga ggtctacgtt tctggggatc agttcacaaa ggacgacatc aaagtgtatg 120

gtgctgtttt ggagaagcca ggtgactctt ttcccaatgc tgccaagtgg tacgaggttg 180

tctcatctca gcttgctgca agcttccccg gcaatgctca aggggtgaga ttcagtggca 240

aagcttctgc tccagcggag gctgctcctg cgaaaccgga tgcttctgct gctgaagatg 300

atgatgacct tgatctcttt ggcgatgaga ctgaggaaga caaaaaggca gcagaggaaa 360

gggaggctgc taagaagtct accaagaaga aagagagtgg caaatcttct gttctgcttg 420

acgttaagcc ttgggatgat gaaacagaca tgaagaagct ggaagaggct gttcgcagtg 480

ttgagatgcc tggtctattg tggggagcat ccaaactggt tcctgttggt tatgggatca 540

agaagttgca gatcatgtta actattgtcg atgaccttgt atctgtggac acccttgttg 600

aggagactct cacagttgag cccatcaatg agtatgtcca aagctgtgac attgttgcat 660

tcaacaaaat ctaa 674

Claims

1. SoybeanGmEF1BThe application of the gene mutant plant in the breeding of the soybean sclerotinia sclerotiorum resistant variety is characterized in that the mutant plant contains the mutant soybeanGmEF1BGene, said soybeanGmEF1BThe nucleotide sequence of the gene is shown as SEQ ID NO: 1 is shown.

2. According to claimThe use of claim 1, wherein said mutated soybeanGmEF1BThe nucleotide sequence of the gene is shown as SEQ ID NO: shown at 10.