CN112175049B - Jujube witches broom phytoplasma effector gene Zaofeng8 and application - Google Patents

Abstract

The invention discloses a jujube witches broom phytoplasma effector gene Zaofeng8 and application, wherein the nucleotide sequence of the jujube witches broom phytoplasma effector gene Zaofeng8 is shown in SEQ ID NO.1, the gene has the functions of dwarfing plants, enabling the plants to form a rosette phenotype and enabling the plants to generate lobular symptoms, the Zaofeng8 is obtained by cloning through a PCR technology, and the gene is transferred into Columbia arabidopsis thaliana for functional verification by utilizing an agrobacterium-mediated method, so that the invention is beneficial to clarifying an infection mechanism of the host by the phytoplasma in the occurrence process of the jujube witches broom symptoms from a molecular mechanism, and has a positive guiding effect on further realizing the prevention and treatment of the jujube witches broom.

Description

Jujube witches broom phytoplasma effector gene Zaofeng8 and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a jujube witches broom phytoplasma effector gene Zaofeng8 and application thereof.

Background

When plant pathogenic bacteria infect host plants, the defense reaction of the plants can be activated, so that the infection of the pathogenic bacteria is inhibited; however, pathogenic bacteria can secrete effector factors to inhibit the defense reaction of hosts so as to ensure that the pathogenic bacteria can better invade plants to obtain nutrition. The aim of successful pathogen infection by destroying the defense response of plants through cooperative mode of effector factors needs to be continuously explored. On the molecular level, the research on pathogenic targets of pathogenic bacteria provides a theoretical basis for breeding of disease-resistant varieties and research and development of ecological pesticides, and effectively solves the problems of the traditional chemical control of diseases, such as the enhancement of the drug resistance of pathogenic bacteria and the food safety caused by the residue of phytotoxicity. With the continuous development of sequencing technology, the whole genome sequencing work of important pathogenic bacteria is gradually completed, more and more effect factors can be found in bacteria, oomycetes, fungi and nematodes, the interaction between the pathogenic substance and the host can be known more thoroughly, and a new way for effectively preventing and treating plant diseases is opened up.

Jujube (Ziziphus jujuba Mill.) is an important economic forest tree species in China. Jujube witches' broom, JWB is one of serious diseases affecting the development of Jujube industry, and has brought a great hit to the Jujube industry in China in recent years. Once the jujube tree is infected with jujube witches broom, the small tree can die in 1-2 years, and the big tree can die in 3-4 years. The jujube trees infected with the jujube witches broom show abnormal development phenotypes such as multiple branches, lobular fasciculation, plant dwarfing, floral organ malformation and floral leaf change, etc., and are infected by the pathogenic jujube witches broom phytoplasma (Candidatus phytoplasia ziphi), the special bacteria are parasitized on the sieve tube cells of the phloem of the plants, the growth conditions are harsh, the isolated culture cannot be carried out, and great difficulty is brought to the prevention and treatment of the jujube witches broom.

The elucidation of the pathogenesis of the jujube witches broom phytoplasma is an important link for effectively preventing and treating jujube witches broom. As more and more phytoplasma genomes are sequenced and analyzed, effector factors are found to be the core element of phytoplasma in causing host plant disorders to occur. Research shows that phytoplasma regulates plant morphogenesis and defense systems through secreting effector factors, so that host metabolism is abnormal, and various diseases appear, wherein lobule, arbuscular and dwarf phenotypes are the most typical. Therefore, the identification of the jujube witches broom phytoplasma effector is the key to analyze the occurrence mechanism of the jujube witches broom, formulate a prevention and control technology and cultivate a disease-resistant variety. In 2018, the sequencing of the jujube witches broom phytoplasma genome provides a good basis for identifying the effector. The identification of the jujube witches broom phytoplasma effect factors, the determination of the pathogenic mechanism of the jujube witches broom phytoplasma and the important significance for preventing and treating the jujube witches broom.

In the process of research, the inventor has found a gene Zaofeng6 related to the jujube witches broom phytoplasma effector, and with the progress of the research, more than one gene related to the jujube witches broom phytoplasma effector is found, which lays a foundation for further and comprehensively understanding the pathogenesis of the jujube witches broom.

Disclosure of Invention

The invention aims to provide a novel jujube witches broom phytoplasma effector gene Zaofeng8 and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

the nucleotide sequence of the jujube witches broom phytoplasma effector gene Zaofeng8 is shown in SEQ ID NO.1 or the nucleotide sequence which can be hybridized with the DNA sequence shown in SEQ ID NO.1 in the sequence table.

The protein coded by the jujube witches broom phytoplasma effector gene Zaofeng8 is selected from,

(1) the amino acid sequence is shown as SEQ ID NO. 2;

(2) a protein derived from (1) having the protein function of (1) and formed by substituting, deleting or adding one or more ((e.g., 1 to 30; preferably 1 to 20; more preferably 1 to 10; e.g., 5, 3)) amino acid residues to the amino acid sequence of SEQ ID NO: 2; or

(3) A protein derived from (1) having homology of 80% ((preferably 90% or more, such as 95%, 98%, 99% or more)) or more with the protein sequence defined in (1) and having the protein function of (1).

That is, the functions of the gene protected by the present invention include not only the above mentioned jujube witches disease phytoplasma effector gene Zaofeng8, but also homologous gene with high homology (e.g. homology higher than 40%, preferably higher than 50%, preferably higher than 60%, more preferably higher than 70%, more preferably higher than 80%, more preferably higher than 90%, more preferably higher than 95%, more preferably higher than 98%) with SEQ ID NO. 1.

Wherein, SEQ ID NO.1 in the sequence consists of 249 bases, the 1 st base from the 5' end is a transcription starting site, the 247-.

And expression vectors and recombinant vectors containing the above genes also fall within the scope of the present invention.

The term "recombinant expression vector" in the present invention refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus or other vectors well known in the art. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein. Wherein, the host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Representative examples are: escherichia coli, Streptomyces, Agrobacterium; fungal cells such as yeast; plant cells, and the like.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. The transformed plant may be transformed by methods such as Agrobacterium transformation or biolistic transformation, for example, dipping, leaf disc transformation, rice immature embryo transformation, etc. The transformed plant cells, tissues or organs can be regenerated into plants by conventional methods.

The invention mainly aims to identify the jujube witches broom phytoplasma effect factors on the molecular level, thereby providing a theoretical basis for analyzing the occurrence mechanism of jujube witches broom, formulating prevention and control technology, cultivating disease-resistant varieties and developing ecological pesticides.

The invention also discloses the application of the jujube witches broom phytoplasma effector gene Zaofeng8 in the following aspects:

(1) dwarfing the plant;

(2) allowing the plant to develop an arbuscular phenotype;

(3) the plants are rendered lobular phenotype.

The application obtains the plants with dwarf, arbuscular and/or lobular symptoms by a transgenic mode.

Wherein, the dwarfing expression comprises the reduction of the average bolting height, the arbuscular expression comprises the increase of the number of branches, and the lobular symptoms comprise the reduction of the length and the width of rosette leaves and leaves on the bolts.

In one embodiment of the present invention, the polynucleotide is cloned into an appropriate vector by a conventional method, and the recombinant vector with the foreign gene is introduced into a plant cell expressing the Zaofeng8 protein, so that the plant cell expresses the Zaofeng8 protein. Plants overexpressing Zaofeng8 protein can be obtained by regenerating the plant cells into plants. Preferably, the gene encoding Zaofeng8 protein is transferred into plants by Agrobacterium transformation.

In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous, or gymnosperm.

As a preferred mode, the "plant" includes but is not limited to: rhamnaceae family. For example, the term "plant" includes, but is not limited to: tobacco of the solanaceae family; arabidopsis thaliana of the Brassicaceae family; jujube tree of Rhamnaceae family, etc.

Is especially suitable for the plants needing dwarfing, such as fruit trees and ornamental plants, including apples, pears, sweet cherries, oranges, Chinese flowering crabapples and the like.

The invention has the following advantages:

(1) after the jujube witches broom effect factor gene Zaofeng6 is screened out in the early stage, more than one jujube witches broom effect factor gene is found, and on the basis of the early stage research, further intensive research is carried out, and a new jujube witches broom phytoplasma effect factor gene Zaofeng8 is screened out.

(2) The inventor utilizes the agrobacterium-mediated method to transfer the gene into Columbia arabidopsis to verify the function of a target gene, is favorable for explaining the function of Zaofeng8 in regulating and controlling jujube morphogenesis from a molecular mechanism, has positive guiding function on further explaining a jujube witches broom pathogenic mechanism, improving jujube quality and character, cultivating new disease-resistant varieties, and provides a theoretical basis for the research and development of ecological pesticides.

(3) Compared with other effector factors causing local change of plant phenotype, such as leaf morphology, axillary bud branching or plant height unilateral change, the Zaofeng8 gene can simultaneously induce the abnormal development of each organ of the whole arabidopsis thaliana, and symptoms such as lobule, arbuscular and dwarfing appear. This also represents the key role played by Zaofeng8 in the process of jujube witches disease phytoplasma infecting jujube.

(4) For some plants needing dwarfing, such as fruit trees and ornamental plants (unnecessary nutrient consumption is reduced so as to fully utilize light energy and soil fertility, fruit early, improve yield or increase ornamental effect), the coding gene of the Zaofeng8 protein can be transferred into the plants in a transgenic way, so that a new way is provided for plant dwarfing breeding.

Drawings

FIG. 1 is a PCR amplification electrophoretogram of the jujube witches broom phytoplasma effector Zaofeng 8;

in the figure, the sample of lanes 1-6 is Zaofeng8 PCR amplification product, M of the left band in the figure is DL2000 marker, and the size of the gene Zaofeng8 gene fragment is 249 bp;

FIG. 2 is a PCR amplification electrophoretogram of pSAK277-Zaofeng8 recombinant plasmid;

in the figure, the sample of lanes 1-3 is the PCR amplification product of pSAK277-Zaofeng8 recombinant plasmid; the sample of the M lane of the left band in the figure is DL2000 marker, and the amplified fragment size of pSAK277-Zaofeng8 is about 249 bp;

FIG. 3 is a PCR-gel electrophoresis test chart of Zaofeng 8-transgenic positive Arabidopsis thaliana;

in the figure, 1-9 respectively represent different ZaOFeng 8-transformed Arabidopsis strains, and EV represents pSAK 277-transformed unloaded Arabidopsis strains;

FIG. 4 is a diagram showing phenotype observations at the seedling stage of a wild type Arabidopsis line (WT), an over-expressed pSAK277 No-load Arabidopsis line (EV) and an over-expressed Zaofeng8 Arabidopsis line (Zaofeng 8);

FIG. 5 is a fertility index survey of wild type Arabidopsis line (WT), over-expressed pSAK277 empty Arabidopsis line (EV) and over-expressed Zaofeng8 Arabidopsis line (Zaofeng 8).

Detailed Description

The present invention will be described in detail below with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials used are commercially available, unless otherwise specified.

The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

The diseased jujube variety used for Zaofeng8 gene amplification and infected with jujube witches broom in the invention is a gray jujube, and is provided by a fruit tree focus laboratory of gardening academy of agriculture university in Henan province. Variety details can be found in Chen et al, 2019.

The inventor obtains the jujube witches broom phytoplasma effector Zaofeng8 by screening on the basis of the jujube witches broom phytoplasma genome through a bioinformatics technology. The invention is connected with a plant overexpression vector and then introduced into wild arabidopsis thaliana for pathogenicity identification.

Example isolation and functional characterization of the Effector Zaofeng8 Gene of jujube witches broom phytoplasma

Test method

1. Isolation of Gene Zaofeng8

The total DNA of the wild jujube leaf is extracted by using an Ezup column type plant genome DNA extraction kit (Biotechnology engineering Co., Ltd., Shanghai), the full-length sequence of the gene Zaofeng8 is obtained by PCR with the DNA as a template and the following sequence as a primer, and the PCR amplification electrophoresis chart is shown in figure 1. The full-length sequence of the gene Zaofeng8 is shown as SEQ ID NO.1 in the sequence table and total 249bp, and the amino acid sequence of the codified protein is shown as SEQ ID NO. 2 in the sequence table and total 82.

The primer sequence is as follows:

Zaofeng8-F：5′--3′；TCCAAAGAATTCCCCGGTACCATGGAAAACAACAAAGGA

Zaofeng8-R：5′--3′。ATGATCTTTGTAATCCTCGAGTTAGTTTTCTTCTGGAATTG

the annealing temperature for PCR was 52 ℃.

2. Zaofeng8 gene functional identification test

In order to research whether the Zaofeng8 gene regulates the morphogenesis of jujube in the process of jujube witches broom symptom, the function of the Zaofeng8 gene is identified by transgenic arabidopsis thaliana.

2.1 construction of recombinant vectors

The target fragment obtained by PCR was ligated to the pSAK277 plant overexpression vector using SE seamless cloning kit (Hill Biotechnology Co., Ltd.), transformed into E.coli, shaken overnight at 37 ℃ and then extracted into a plasmid. The plasmid was tested using the universal primers for the pSAK277 plant expression vector (fig. 2), as follows:

pSAK277-F：5′-CATCGAAAGGACAGTAGAAAAGG-3′；

pSAK277-R：5′-CATTAGAATGAACCGAAACCG-3′。

2.2 screening of transgenic Arabidopsis Positive strains

In view of the long construction period and the imperfect technology of the jujube genetic transformation system, the model plant Columbia type arabidopsis is adopted for the functional verification of the Zaofeng8 gene. Extracting plasmid of the sequenced pSAK277-Zaofeng8 vector, and transferring the plasmid into agrobacterium GV3101 by a liquid nitrogen freeze-thaw method. Adjusting the concentration OD of the Agrobacterium liquid to 0.8-1.0, adopting a dipping method to dip-dye and transform Columbia arabidopsis, after the infected arabidopsis is seeded, fixing the harvested seeds in MS containing kanamycin (50mg/L)Screening was performed on the body medium. The screening process is as follows: sterilizing the surface with 6.25% sodium hypochlorite solution for 5min, rinsing with sterile water for 5 times, and air drying on filter paper. Seeds were sown in MS medium with pH 5.8 containing 0.7% agar. Purifying at 4 deg.C for 48h, transferring to 14h/10h light dark at 25 deg.C, 80% relative humidity, 250 μmol m^-2s^-1Culturing in a light-intensity tissue culture room. And (4) after green plantlets grow on the culture medium to be screened for 4d, transferring the plantlets to a plug tray for culture under the conditions. Extracting DNA after bolting, and identifying positive plants by conventional PCR. After harvesting seeds of T0 generations, positive plants were further screened on MS medium containing kanamycin. Differences from the wild type were observed after transplanting to the plug. The insertion of the fragment was confirmed using the pSAK277 universal primer, which indicated that 9 candidate positive lines transformed with Zaofeng8 were obtained by co-screening of resistant cultures, and 4 of them were positive lines by PCR (FIG. 3).

2.3 phenotypic observation and growth index determination of Zaofeng8 transgenic Arabidopsis lines

FIG. 4 is a diagram showing phenotypic observations of a wild-type Arabidopsis strain, a pSAK277 null Arabidopsis strain and a Zaofeng8 Arabidopsis strain. In summary, compared to wild-type and empty-loaded controls, Zaofeng 8-transgenic Arabidopsis plants showed lobular, rosette (increased number of branches) and dwarf phenotypes, in addition to which Zaofeng8 had a significant inhibitory effect on the development of Arabidopsis floral organs (FIG. 4). Further investigating growth indexes of the Arabidopsis thaliana strain of Zaofeng8, in the aspect of influencing the growth of rosette leaves, Zaofeng8 obviously inhibits the size of the rosette leaves, which is shown in that compared with wild type and unloaded Arabidopsis thaliana strain, the length and width of the rosette leaves of the Zaofeng 8-transformed Arabidopsis thaliana strain are obviously smaller than those of the wild type and the unloaded control, so that the lobular phenotype of the rosette leaves is caused; but the number of leaves increases;

after bolting, the bolting number of the Zaofeng 8-transferred Arabidopsis strain is obviously less than that of the wild type and the no-load control, and the average bolting height of the Zaofeng 8-transferred Arabidopsis strain is obviously less than that of the wild type and the no-load control, so that a dwarfing phenotype is formed; zaofeng8 significantly inhibited the growth of the leaves on the bolting, with significantly reduced leaf length and width compared to the wild type and unloaded control (FIG. 5).

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are merely illustrative and not restrictive, and it should be understood that other embodiments may be easily made by those skilled in the art by replacing or changing the technical contents disclosed in the specification, and therefore, all changes and modifications that are made on the principle of the present invention should be included in the scope of the claims of the present invention.

Sequence listing

<110> Henan university of agriculture

<120> jujube witches broom phytoplasma effector gene Zaofeng8 and application

<130> 2010

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 249

<212> DNA

<213> Ziziphus jujuba Mill.

<400> 1

atggaaaaca acaaaggaaa acaaatttta aatgatgaac cgagcgatca agaaattaat 60

aattttttta aattagtaaa aaaaagtcaa gaaaatatca aacaactaaa acaaaaatac 120

cctcatttaa aaaatgcttc cataaaagaa atagaaaatt tcttatcttt taacataaac 180

caacaacaaa caaataataa caataaaaaa cgaaaattag atttaaatac aattccagaa 240

gaaaactaa 249

<210> 2

<211> 82

<212> PRT

<213> Ziziphus jujuba Mill.

<400> 2

Met Glu Asn Asn Lys Gly Lys Gln Ile Leu Asn Asp Glu Pro Ser Asp

1 5 10 15

Gln Glu Ile Asn Asn Phe Phe Lys Leu Val Lys Lys Ser Gln Glu Asn

20 25 30

Ile Lys Gln Leu Lys Gln Lys Tyr Pro His Leu Lys Asn Ala Ser Ile

35 40 45

Lys Glu Ile Glu Asn Phe Leu Ser Phe Asn Ile Asn Gln Gln Gln Thr

50 55 60

Asn Asn Asn Asn Lys Lys Arg Lys Leu Asp Leu Asn Thr Ile Pro Glu

65 70 75 80

Glu Asn

Claims (4)

1. Jujube witches broom phytoplasma effector geneZaofeng8The use of (A), wherein the geneZaofeng8The nucleotide sequence of (A) is shown as SEQ ID NO.1, and the application is as follows: dwarfing the plant; and/or allowing the plant to develop an arbuscular phenotype; and/or conferring a lobular phenotype to a plant, said plant being Arabidopsis thaliana.

2. The use according to claim 1, wherein dwarfing is manifested as a decrease in the height of averagely bolting shoots.

3. The use of claim 1, wherein the plurality of branches is present in an increased number of branches.

4. The use of claim 1, wherein the lobular phenotype is a reduction in both the length and width of rosette leaves and lamina on the shoots.

Images