CN111164210A

CN111164210A - PCR primer for amplifying TCR full-length sequence and application thereof

Info

Publication number: CN111164210A
Application number: CN201780095498.6A
Authority: CN
Inventors: 王飞; 周清; 王磊; 吴靓; 赵正琦; 杨乃波; 李贵波; 侯勇; 李波
Original assignee: BGI Shenzhen Co Ltd
Current assignee: BGI Shenzhen Co Ltd
Priority date: 2017-09-28
Filing date: 2017-09-28
Publication date: 2020-05-15
Also published as: WO2019061197A1

Abstract

The invention discloses a PCR primer pair for amplifying a TCR full-length sequence and a preparation method and application thereof, wherein the PCR primer pair comprises an upstream primer and a downstream primer: the upstream primer is designed according to a joint sequence, and the joint sequence is introduced into the 3' end of the first strand cDNA through a joint primer TSO; the downstream primer is designed according to the C region of the TCR.

Description

PCR primer for amplifying TCR full-length sequence and application thereof

Technical Field

The invention belongs to the field of molecular biology, and relates to a PCR primer for amplifying a TCR full-length sequence and application thereof, in particular to a PCR primer for amplifying a TCR full-length sequence, a method for amplifying the TCR full-length sequence and application thereof.

Background

T cell types are complex and diverse and are associated with TCR rearrangement, and in the thymus, TRB (TCR β) genes undergo D-J, V-D-J, V-D-J-C region rearrangement, ultimately producing about 10⁸The TRA (TCR α) gene undergoes V-J, V-J-C region rearrangement to finally yield about 10⁴Different TRA rearranged genes. In human peripheral blood, TCR diversity is up to 10 due to TRB, TRA rearrangement¹⁸It is decided how the human immune system adapts to environmental changes.

Currently, one of the major methods for TCR identification is sequencing of chains α and β in traditional immunological studies, it is difficult to characterize cellular heterogeneity and different cell subsets based on data obtained from population cell sequencing.

(1) The technology adopts multiple PCR primers designed in a TCR V region, such as T cell reporteire primers Vp1-Vp9 covering all functional TRB rearrangement gene V regions and T cell reporteire primers Vp1-Vp24 covering all functional TRAB rearrangement gene V regions, combines TCR constant region C region primers to carry out multiple PCR amplification, can generally carry out TCR reporteire sequence amplification of a population sample and capture diversified TCR sequences, and then analyzes T cell diversity by combining a high-throughput sequencing technology, but among different T cell subtypes, the M mu Ltiplex PCR has certain amplification preference, can not accurately obtain TCR α/β pairing sequence information, further develops a single cell PCR pairing system, and can not easily realize a single cell PCR pairing system, namely a single cell RT-3526 single cell pairing system is a single cell PCR system, and the single cell RT-3526 single cell pairing system is a single cell PCR system which is relatively complex and can not easily be developed in a single cell pairing system at the current, and is a single cell RT-355635 single cell pairing system which is relatively simple in comparison;

(2) RACE (Rapid-amplification of cDNA ends) is combined with a high-throughput sequencing technology, a primer is designed through a constant known sequence in a TCR sequence, a TCR gene sequence is amplified in a colony, and the high-throughput sequencing technology reads TRA and TRB sequences of each subtype; based on PCR technology, gene specific primers (GSP1 and GSP2) for 5 'and 3' RACE reaction are designed based on a known cDNA sequence, and complete 3 'and 5' ends are obtained by extending and amplifying the two ends. The PCR product is specific due to the presence of the two primers. The technology is applied to T cell TCR amplification, a TRA or TRB rearrangement gene constant region C region primer is generally designed, a TCR gene 5 'end sequence is amplified through 5' RACE, and a TCR sequence is read through a high-throughput sequencing technology. The technology is generally used for T cell diversity analysis of population samples, the initial sample size is high, and the T cell subpopulation with low abundance is difficult to capture.

(3) In the high-throughput sequencing process, specific DNA barcodes are combined with amplification products, TCR sequence information and DNA barcode information are read at the same time, and a hole source corresponding to the TCR is determined through the DNA barcode information.

(4) TraCer is an open type analysis tool (Michael J.T.Stubbington et al, (2016) Nature Methods, DOI: 10.1038/NMETH.3800), is used for analyzing T cell single cell whole transcriptome sequence, reconstructs full-length TCR α/β pairing sequence through computer technology, reveals T cell function specificity.

However, there is no effective technique for sequencing TCR α/β pairs at the single cell level and covering all known TRA and TRB subtypes.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a PCR primer for amplifying a TCR full-length sequence and application thereof, so as to realize the full-length amplification of the TCR sequence and obtain the pairing information of α/β subunits in the TCR, solve the defects of high initial sample amount, incomplete TCR subtype coverage, preferential amplification, incomplete TCR sequence amplification and the like of other existing methods, and really realize the full-length amplification of the TCR sequence at the level of a single human T cell.

In a first aspect, the invention provides a PCR primer pair for amplifying a TCR full-length sequence, comprising an upstream primer and a downstream primer;

the upstream primer is designed according to a section of linker sequence, and the linker sequence is introduced into the 3' end of the first strand cDNA; the downstream primer is designed according to the C region of the TCR.

In the present invention, the antigen binding site of the TCR is very diverse, and the mechanism for generating this diversity is mainly derived from V (D) J recombination of immunoglobulin genes, and the gene site encoding immunoglobulins is composed of many gene segments including variable segment (V), connecting segment (J) and the diverse segment (D) that may exist between them, α subunit is generated by VJ recombination, β subunit is generated by VDJ recombination, wherein J is connected with constant region (C), and the homology of C region sequence is good although the TCR has variety, so the downstream primer is designed according to C region, and can be designed at any position from 5 ' end to 3 ' end of C region, and then a linker sequence is added to 3 ' end of TCR, and the upstream primer is designed according to it, and the complete V (D) J sequence can be obtained by such upstream and downstream primers, thereby obtaining the full length of TCR.

In the present invention, the designed primer follows the general primer design principle, such as GC content 40-60%, no secondary hairpin structure, no primer dimer, etc., and the primer design should be designed as far as possible at the position without base polymorphism.

According to the present invention, the length of the upstream primer is 18-28nt, such as 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt or 28nt, preferably 23 nt.

According to the invention, the adaptor sequence is introduced by a template switching method by using an adaptor primer, the upstream primer is designed according to the adaptor sequence, wherein the adaptor primer can be a sequence with any fixed length, and the upstream primer can be designed by a person skilled in the art according to needs, the nucleotide sequence of the adaptor primer is shown as SEQ ID NO.1, and the nucleotide sequence shown as SEQ ID NO.1 is as follows:

the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence shown as SEQ ID NO.2 is as follows:

according to the invention, the downstream primer is designed according to the 5 ' end or the 3 ' end of the C region of the TCR, and as the platform for later-stage sequencing is mainly Miseq sequencing platform or Sanger sequencing platform, aiming at the Miseq sequencing platform, the maximum read length can only be 600bp, and the V (D) J sequence is almost as long, the 5 ' end of the C region primer is designed with a primer, and the full length of V (D) J is obtained by amplification; in the case of Sanger sequencing platform, primers can be designed at the 3' end, so that the full length of V (D) JC can be directly obtained by sequencing.

According to the present invention, since the TCR assay of the present invention is performed after single cell lysis, and the concentration of the starting sample is relatively low, the downstream primer of the present invention is preferably a nested primer, and the downstream primer is any one or a combination of at least two of an external primer, an intermediate primer or an internal primer, and the combination may be, for example, a combination of an external primer and an intermediate primer, a combination of an intermediate primer and an internal primer, or a combination of an external primer, an intermediate primer and an internal primer, and is preferably a combination of an external primer, an intermediate primer or an internal primer.

In the invention, three nested primers are selected, and the inventor finds that the amplification result is very accurate for samples with small initial amount in the single cell of the application and for TCR with such a complicated mechanism.

According to the invention, the TCR total length consists of the TCR α gene total length and the TCR β gene total length or of the TCR γ gene total length and the TCR δ gene total length, 95% of the TCRs consist of the two subunits α and β, and 5% of the TCRs consist of the two subunits γ and δ.

According to the invention, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5;

the nucleotide sequence of the primer is as follows:

outer primer (SEQ ID NO. 3): GCAGACAGACTTGTCACTGG, respectively;

intermediate primer (SEQ ID NO. 4): TGGATTTAGAGTCTCTCAGCTGGTACACG, respectively;

inner primer (SEQ ID NO. 5): GGTACACGGCAGGGTCAGGGTTC, respectively;

according to the invention, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8;

the nucleotide sequence of the primer is as follows:

outer primer (SEQ ID NO. 6): GAGCAGATTAAACCCGGCCACTT, respectively;

intermediate primer (SEQ ID NO. 7): GGATTCGGAACCCAATCAC, respectively;

inner primer (SEQ ID NO. 8): TCGACCAGCTTGACATCACAGGAACT, respectively;

according to the invention, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR β gene are respectively shown as SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO. 11;

the nucleotide sequence of the primer is as follows:

outer primer (SEQ ID NO. 9): TGGTCGGGGAAGAAGCCTGTG, respectively;

intermediate primer (SEQ ID NO. 10): TCTGCTTCTGATGGCTCAAACACAGC, respectively;

inner primer (SEQ ID NO. 11): TTCTGATGGCTCAAACACAGCGA, respectively;

according to the invention, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR β gene are respectively shown as SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO. 14;

the nucleotide sequence of the primer is as follows:

outer primer (SEQ ID NO. 12): GCCTCTGGAATCCTTTCTCTTGACC, respectively;

intermediate primer (SEQ ID NO. 13): ACCAGCACRGCATACADGG, respectively;

inner primer (SEQ ID NO. 14): TCTCATAGAGGATGGTGGCAGACAGG are provided.

In the invention, the outer primer SEQ ID NO.3, the middle primer SEQ ID NO.4, the inner primer SEQ ID NO.5 and the outer primer SEQ ID NO.9, the middle primer SEQ ID NO.10 and the inner primer SEQ ID NO.11 for amplifying the whole length of the TCR α gene are designed for a Miseq sequencing platform according to the position of 20-30bp near the 5 'end of the C region because the maximum read length is only 600bp, the sequence of UTR at the 5' end of the TCR is plus V + D + J region is just within 600bp, the outer primer SEQ ID NO.6, the middle primer SEQ ID NO.7, the inner primer SEQ ID NO.8 and the outer primer SEQ ID NO.12, the middle primer SEQ ID NO.13 and the inner primer SEQ ID NO.14 for amplifying the whole length of the TCR β gene are designed for a Sanger sequencing platform according to the position of 100bp near the C region because the maximum read length is 800bp, the TCR sequence is about 800bp, and the downstream primer is designed for a region near the whole length of the C3 bp.

In a second aspect, the invention also provides a method of amplifying the full length sequence of a TCR comprising the steps of:

(1) lysing the cells;

(2) carrying out reverse transcription on the obtained mRNA to obtain first chain cDNA;

(3) performing PCR amplification by using the first strand cDNA obtained in the step (2) as a template and using the upstream primer and the downstream primer of the first aspect;

(4) and (5) sequencing and verifying to obtain the full-length sequence of the TCR.

According to the invention, the cells in step (1) are single cells, and the single cells are derived from peripheral blood mononuclear cells of peripheral blood.

Preferably, the single cell isolation in step (1) is a conventional technique in the art, and is not particularly limited herein, and the method of the present invention comprises the following specific steps: after staining peripheral blood mononuclear cells with antibodies, sorting out CD8+ T cells by using a flow cytometer, picking out single cells by using a micromanipulator, adding the single cells into a lysis solution, quickly centrifuging to ensure that the cells enter the lysis solution, immediately putting the lysis solution on dry ice, and storing a sample at-80 ℃ or in liquid nitrogen before amplification.

Preferably, the lysate formulation is as shown in the following table:

in order to ensure that the mRNAs are all released from the single cell, the lysing of the single cell is preferably as follows: the PCR tube containing the single cell was placed in a PCR instrument with the hot lid set at 75 ℃. Incubating the single cells at 72 deg.C for 3-5min, and immediately placing on ice for 1min after lysis; centrifugation was carried out at 10000rpm for 30s at 4 ℃ and immediately followed by ice transfer.

According to the present invention, the system for reverse transcription of mRNA described in step (2) comprises a linker primer (TSO).

According to the invention, the adapter primer is present in a final concentration of 0.5-2. mu.M, which may be, for example, 0.5. mu.M, 0.6. mu.M, 0.7. mu.M, 0.8. mu.M, 0.9. mu.M, 1. mu.M, 1.2. mu.M, 1.3. mu.M, 1.5. mu.M, 1.6. mu.M, 1.8. mu.M or 2. mu.M, preferably 1. mu.M.

Preferably, the reverse transcription system of step (2) is as shown in the following table:

according to the invention, the reverse transcription conditions of mRNA are as follows: circulating at 42 ℃ for 90min 1; 2min at 50 ℃ and 2min at 42 ℃ for 10 cycles; circulating at 70 deg.C for 15min 1; stored at 4 ℃.

According to the invention, when the downstream primer in step (3) is a nested primer, the PCR amplification is nested PCR, and the number of times of the nested PCR is 2-3, preferably 3.

According to the invention, the nested PCR specifically comprises:

(1') carrying out a first round of nested PCR by taking the upstream primer and the external primer as primers and taking first strand cDNA as a template to obtain a first round of amplification products;

(2 ') carrying out second round nested PCR by taking the upstream primer and the intermediate primer as primers and the first round amplification product obtained in the step (1') as a template to obtain a second round amplification product;

(3 ') performing third nested PCR by using the upstream primer and the inner primer as primers and the second round amplification product obtained in the step (2') as a template to obtain a third round amplification product.

Preferably, the first round of nested PCR conditions of step (1') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

preferably, the second round of nested PCR conditions of step (2') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

preferably, the third nested PCR conditions of step (3') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 35 cycles; 5min at 72 ℃ and 1 cycle; stored at 4 ℃.

According to the invention, the sequencing in the step (4) is sanger sequencing and/or Miseq sequencing.

As a preferred technical scheme, the method for amplifying the full-length sequence of the TCR comprises the following steps:

(1) lysing the cells;

(3) performing PCR amplification by using the first strand cDNA obtained in the step (2) as a template and the upstream primer and the nested primer of claim 1 as downstream primers, specifically comprising:

the first round of nested PCR conditions in the step (1') are as follows: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

the second round of nested PCR conditions in step (2') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

(3 ') performing a third round of nested PCR by using the upstream primer and the inner primer as primers and the second round of amplification product obtained in the step (2') as a template to obtain a third round of amplification product;

the third nested PCR conditions in step (3') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 35 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

(4) and sequencing and verifying the sanger and/or Miseq to obtain the full-length sequence of the TCR.

In a third aspect, the invention provides a kit for amplifying a TCR full-length sequence, the kit comprising a PCR primer pair for amplifying the TCR full-length sequence according to the first aspect.

In a fourth aspect, the invention provides a PCR primer pair for amplifying a TCR full-length sequence according to the first aspect, a method for amplifying a TCR full-length sequence according to the second aspect, or a use of a kit according to the third aspect for TCR library construction.

In a fifth aspect, the present invention provides the use of a PCR primer pair for amplifying the TCR full-length sequence according to the first aspect or a kit according to the third aspect for the manufacture of a medicament for the immunological diagnostic treatment and/or prognostic monitoring of a disease.

The invention provides a PCR primer pair for amplifying the full-length sequence of the TCR and/or a method for amplifying the full-length sequence of the TCR, which realizes the full-length amplification of the TCR sequence and obtains the pairing information of α/β and/or gamma/delta subunits in the TCR.

Compared with the prior art, the invention has the following beneficial effects:

(1) the primer and the method are effective for different types of TCRs, a specific upstream primer is not required to be designed for a single TCR, a joint sequence is introduced into the 3' end of the cDNA of the first chain of the TCR transcript by adopting the joint primer through a SMART template switching technology in the reverse transcription process, and the full length of the TCR is successfully amplified by the subsequent PCR through the upstream primer designed according to the joint sequence and the downstream primer matched with the conserved region of the TCR C region;

(2) the invention adopts three nested PCR to amplify the whole length of the TCR, is suitable for samples with a template of total RNA as low as 10pg, and can simultaneously obtain the whole length sequence of the TCR of a certain single cell, thereby obtaining α/β pairing information or gamma/delta pairing information of different TCR, and having high sensitivity to the amplification of T cell TCR stimulated by different antigens, complete subtype coverage and relatively low cost;

(3) the method is suitable for grouping cell heterogeneity and T cell subtypes, explores a new immunological mechanism, constructs a large-scale full-length TCR immune repertoire, facilitates disease diagnosis and health management, develops neo TCR-T tumor immune cell therapy by combining a new tumor antigen, performs tumor immunotherapy, cancer or autoimmune disease prognosis monitoring, and is beneficial to guiding medicine application of doctors, scientific research and the like.

Drawings

FIG. 1 shows the principle of PCR primer design for amplification of the full-length TCR sequence;

FIG. 2 is a diagram showing the results of electrophoresis in example 2 of the present invention, wherein marker is 100bp marker, and 100bp, 200bp, 300bp, 400bp, 500bp (brightest band), 600bp, 700bp, 800bp, 900bp, 1000bp and 1500bp from bottom to top;

FIG. 3 is a diagram showing the results of electrophoresis in example 3 of the present invention, in which marker is 100bp marker, and 100bp, 200bp, 300bp, 400bp, 500bp (brightest band), 600bp, 700bp, 800bp, 900bp, 1000bp and 1500bp from bottom to top.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention. It should be further noted that, for the convenience of description, only some of the structures related to the present invention are shown in the drawings, not all of the structures.

Example 1 TCR primer design

The principle of primer design is shown in figure 1, an adapter sequence is introduced into the 3' end of a first strand of cDNA by using an adapter primer through a template conversion method, the adapter primer is shown as SEQ ID NO.1, and the nucleotide sequence shown as SEQ ID NO.1 is as follows:

designing an upstream primer according to an adaptor sequence, wherein the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence shown as SEQ ID NO.2 is as follows:

the downstream primer is designed according to the C region of the TCR gene, and the complete sequences of the C regions of the α and β chains of the T cells are as follows:

TCRA C region:

TCRB C region:

due to the difference between the Miseq sequencing platform and the Sanger sequencing platform, the primers of the Miseq sequencing platform and the Sanger sequencing platform were designed separately.

(1) Miseq sequencing

Because the longest read length of Miseq at present is 300bp/reads, a PE300 sequencing strategy is adopted, the length of a library Insert is required to be not more than 600bp, and a sequence of UTR (untranslated regions) at the 5 'end of a TCR αβ chain + V + D + J is well within 600bp, so that a downstream primer is arranged at a position which is 20-30bp close to the 5' end of a C region, as shown in the following:

TABLE 1 half-Length primer sequence information for human T-cell C-region

(2) Sanger sequencing

TABLE 2 half-Length primer sequence information for human T-cell C-region

Example 2 sequencing of TCR on Miseq sequencing platform

The method for amplifying the full-length sequence of the TCR comprises the following steps:

(1) first strand cDNA synthesis:

a) preparing a lysate, wherein the formula of the lysate is shown in the following table:

at the time of preparation, the amount of the sample was 110% (in the case of 10 cell samples, 11 tubes were prepared). Blowing and uniformly mixing the prepared lysate, subpackaging the lysate into a clean 0.2ml centrifuge tube, centrifuging at 14000rpm and 4 ℃ for 30s (centrifuging liquid drops to the bottom of the tube and removing bubbles); placing the ice box, and adding cells subsequently;

b) single cell isolation

After staining peripheral blood mononuclear cells with an antibody, sorting out CD8+ T cells by using a flow cytometer, picking out single cells by using a micromanipulator, adding the single cells into a lysis solution, quickly centrifuging to ensure that the cells enter the lysis solution, immediately putting the lysis solution on dry ice, and storing a sample at-80 ℃ or in liquid nitrogen before amplification;

c) cell lysis

Placing 0.2ml PCR tube in PCR instrument, incubating at 72 deg.C for 3min (cell mix sample is increased to 5min), heating to 75 deg.C, and immediately placing on ice for 1min after lysis; centrifuging at 10000rpm and 4 ℃ for 30s, and immediately turning to ice; after this step, all mRNAs were released from the single cell and Oligo-dT primers had also bound to the mRNAs;

d) reverse transcription of mRNA

The reverse transcription system is prepared as follows:

in the preparation, the number of samples was +0.5 (9 tubes in the case of 9 cell samples). After the prepared Mix is fully and uniformly mixed, the Mix is sequentially added into a centrifugal tube in the previous step;

after blowing, beating, mixing and instantaneous centrifugation, reverse transcription reaction is carried out according to the following conditions (75 ℃ hot cover):

the first strand cDNA of all mRNAs is synthesized;

(2) nested PCR

With the primers of example 1, the primers of the present invention were used,

the upstream primer is SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 is as follows:

the downstream primers were as follows:

a) first round PCR

Taking the upstream primer and the external primer as primers and taking the first strand cDNA as a template to perform a first round of nested PCR to obtain a first round of amplification product;

the PCR system was prepared as follows:

in the preparation, the amount of the sample was adjusted to +0.5 (9 tubes in the case of 9 cell samples). After the prepared Mix is fully and uniformly mixed, sequentially adding 15 mu L of Mix into the centrifugal tube in the previous step;

blowing, beating, mixing uniformly, centrifuging instantaneously, and pre-amplifying according to the following conditions:

b) second round PCR

Performing a second round of nested PCR by taking the upstream primer and the intermediate primer as primers and the first round of amplification product obtained in the step (1') as a template to obtain a second round of amplification product;

the PCR system was prepared as follows:

in the preparation, the amount of the sample was adjusted to +0.5 (9 tubes in the case of 9 cell samples). After the prepared Mix is fully and uniformly mixed, sequentially adding 24 mu L of Mix into the centrifugal tube in the previous step;

c) third round of PCR

Performing third round of nested PCR by taking the upstream primer and the inner primer as primers and the second round of amplification product obtained in the step (2') as a template to obtain a third round of amplification product;

the PCR system was prepared as follows:

(3) electrophoretic detection

And (3) carrying out electrophoresis detection after the nested PCR is finished, adopting 2% agarose gel, taking 15 mu L of product, adding 3 mu L of Loading buffer, uniformly mixing, carrying out 130V electrophoresis for 45min, cutting a target strip into gel and recycling, wherein the result is shown in figure 2, and obtaining an αβ chain of the complete TCR.

(4) And (3) performing TA cloning and sequencing on the added products, wherein the sequencing result is as follows:

α Strand sequence

α1：V12+J21

α2：V5+J36

β chain sequence (V27+ J2)

The results are collated as shown in Table 3 below:

TABLE 3

As can be seen from table 3, α and β types of sample a are:

α V12J21 and V5J36

β：V27J2。

Thus, by adopting the Miseq sequencing platform, the full length of V (D) J can be directly obtained by sequencing.

Example 3 sequencing of TCR on Sanger sequencing platform

Compared to example 2, the conditions and methods were the same as in example 2 except for the nested primers as follows:

with the primers of example 1, the primers of the present invention were used,

the downstream primers were as follows:

electrophoretic detection

And (3) carrying out electrophoresis detection after the nested PCR is finished, adopting 2% agarose gel, taking 15 mu L of product, adding 3 mu L of Loading buffer, uniformly mixing, carrying out 130V electrophoresis for 45min, cutting a target strip into gel and recycling, wherein the result is shown in figure 3, and obtaining an αβ chain of the complete TCR.

Sent to the company to complete TA cloning and sequencing, and the sequencing results are as follows:

α Strand sequence

α1：V12-2+J21

β：V27+J2-7

The results are collated as shown in Table 4 below:

TABLE 4

TCR sample	V	J	αβ chain
B	V12-2	J21	α

V27

J2-7

β

As can be seen from table 4, α and β types of sample B were:

α：V12-2J21，β：V27J2-7。

it can be seen that the full length of V (D) JC can be directly obtained by sequencing by adopting a Sanger sequencing platform.

In conclusion, the primers and the method are effective for different kinds of TCRs, a specific upstream primer is not required to be designed for a single TCR, a joint sequence is introduced into the 3' end of the cDNA of the first chain of the transcript of the TCR by adopting a SMART template conversion technology in the reverse transcription process, the primer designed according to the joint sequence is used as the upstream primer in the subsequent PCR, and meanwhile, the primer is matched with the downstream primer of a conserved region of a TCR C region to successfully amplify the whole TCR length.

The foregoing is considered as illustrative of the preferred embodiments of the invention and the technical principles employed. It will be understood by those skilled in the art that the present invention is not limited to the particular embodiments described herein, but is capable of various obvious changes, rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention. Therefore, although the present invention has been described in greater detail by the above embodiments, the present invention is not limited to the above embodiments, and may include other equivalent embodiments without departing from the spirit of the present invention, and the scope of the present invention is determined by the scope of the appended claims.

Claims

A PCR primer pair for amplifying a TCR full-length sequence, comprising an upstream primer and a downstream primer;

the upstream primer is designed according to a section of linker sequence, and the linker sequence is introduced into the 3' end of the first strand cDNA;

the downstream primer is designed according to the C region of the TCR.
The pair of PCR primers according to claim 1, wherein the linker sequence is introduced by template switching using a linker primer.
The pair of PCR primers according to claim 1 or 2, wherein the linker sequence is 18-35nt in length.
The pair of PCR primers according to claim 3, wherein the linker sequence is 28nt in length.
The PCR primer pair of any one of claims 1 to 4, wherein the nucleotide sequence of the linker sequence is shown as SEQ ID No. 1;

preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;

preferably, the downstream primer is designed based on the 5 'end or 3' end of the C region of the TCR;

preferably, the downstream primer is a nested primer;

preferably, the downstream primer comprises any one of an outer primer, an intermediate primer or an inner primer or a combination of at least two of them, preferably a combination of an outer primer, an intermediate primer or an inner primer.
The PCR primer pair of any one of claims 1 to 5, wherein the TCR full length consists of the TCR α gene full length and the TCR β gene full length or the TCR γ gene full length and the TCR δ gene full length;

preferably, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5;

preferably, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8;

preferably, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR β gene are respectively shown as SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO. 11;

preferably, the nucleotide sequences of the outer primer, the middle primer and the inner primer of the downstream primer for amplifying the full length of the TCR β gene are shown as SEQ ID No.12, SEQ ID No.13 and SEQ ID No.14, respectively.
A method of amplifying the full length sequence of a TCR using the PCR primer pair of claim 1, comprising the steps of:

(1) lysing the cells;

(2) carrying out reverse transcription on the obtained mRNA to obtain first chain cDNA;

(3) performing PCR amplification by using the first strand cDNA obtained in the step (2) as a template and using the upstream primer and the downstream primer in the PCR primer pair of claim 1;

(4) and (5) sequencing and verifying to obtain the full-length sequence of the TCR.
The method of claim 7, wherein the mRNA reverse transcription system of step (2) comprises a linker sequence.
The method according to claim 8, wherein the linker sequence is present at a final concentration of 0.5-2 μ M, preferably 1 μ M;

preferably, the reverse transcription of mRNA in the step (2) is performed under the following conditions: circulating at 42 ℃ for 90min 1; 2min at 50 ℃ and 2min at 42 ℃ for 10 cycles; circulating at 70 deg.C for 15min 1; stored at 4 ℃.
The method according to any one of claims 7 to 9, wherein the downstream primer of step (3) is a nested primer and the PCR amplification is nested PCR;

preferably, the number of nested PCR is 2-3, preferably 3;

preferably, the nested PCR specifically comprises:

(1') performing a first round of nested PCR (polymerase chain reaction) by using the upstream primer and the external primer as primers and using first strand cDNA as a template to obtain a first round of amplification products;

(2 ') performing nested second-round PCR (polymerase chain reaction) by using the upstream primer and the intermediate primer as primers and the first-round amplification product obtained in the step (1') as a template to obtain a second-round amplification product;

(3 ') performing a third round of nested PCR (polymerase chain reaction) by using the upstream primer and the inner primer as primers and using the second round of amplification products obtained in the step (2') as a template to obtain a third round of amplification products;

the nested PCR conditions of the first wheel of step (1') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

preferably, the nested PCR conditions of the second round of PCR conditions of step (2') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 25 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

preferably, the third nested PCR conditions of step (3') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 60 ℃ and 2min at 72 ℃ for 35 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;

preferably, the sequencing in step (4) is sanger sequencing and/or Miseq sequencing.
A method of constructing a TCR library according to claim 8 or 9 which comprises the steps of:

(1) lysing the cells;

(2) carrying out reverse transcription on the obtained mRNA to obtain first chain cDNA;

(3) performing PCR amplification by using the first strand cDNA obtained in the step (2) as a template and the upstream primer and the nested primer of claim 1 as downstream primers, specifically comprising:

(1') performing a first round of nested PCR (polymerase chain reaction) by using the upstream primer and the external primer as primers and using first strand cDNA as a template to obtain a first round of amplification products;

(2 ') performing nested second-round PCR (polymerase chain reaction) by using the upstream primer and the intermediate primer as primers and the first-round amplification product obtained in the step (1') as a template to obtain a second-round amplification product;

(3 ') performing a third round of nested PCR (polymerase chain reaction) by using the upstream primer and the inner primer as primers and using the second round of amplification products obtained in the step (2') as a template to obtain a third round of amplification products;

(4) and sequencing and verifying the sanger and/or Miseq to obtain the full-length sequence of the TCR.
The method according to any one of claims 7 to 11, wherein the cells of step (1) are single cells;

preferably, said single cells of step (1) are derived from peripheral blood mononuclear cells of peripheral blood.
A kit for amplifying a full length sequence of a TCR, which comprises a PCR primer pair for amplifying a full length sequence of a TCR according to any one of claims 1 to 6.
Use of a PCR primer pair for amplifying a TCR full-length sequence according to any one of claims 1 to 6, a method for amplifying a TCR full-length sequence according to any one of claims 7 to 12, or a kit according to claim 13 for the pooling of TCRs.
Use of a PCR primer pair for amplifying the TCR full-length sequence according to any one of claims 1-6 or a kit according to claim 13 for the manufacture of a medicament for the immunological diagnostic treatment and/or prognostic monitoring of a disease.