CN105274098A - Method for simultaneously detecting multiple trace sample TCR (T cell receptor) repertoires - Google Patents
Method for simultaneously detecting multiple trace sample TCR (T cell receptor) repertoires Download PDFInfo
- Publication number
- CN105274098A CN105274098A CN201510689156.XA CN201510689156A CN105274098A CN 105274098 A CN105274098 A CN 105274098A CN 201510689156 A CN201510689156 A CN 201510689156A CN 105274098 A CN105274098 A CN 105274098A
- Authority
- CN
- China
- Prior art keywords
- primer
- chain
- sample
- tcr
- inner primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for simultaneously detecting multiple trace sample TCR (T cell receptor) repertoires. The method includes: taking a sample RNA (ribonucleic acid) as a template to synthesize a first-strand cDNA (complementary deoxyribonucleic acid), performing 5'-terminal RACE PCR, designing specific 5' RACE nested PCR primers and TCR alpha-beta gene specific primers, performing RT-PCR amplification to obtain alpha-beta gene amplification products of each sample TCR, mixing the multiple sample PCR products for sequencing, distinguishing different samples according to joining regions of the specific primers, and analyzing frequency distribution of V and J gene segments in each sample. The method for simultaneously detecting the multiple trace sample TCR repertoires has the advantages that on the premise that distinguishing of different samples is guaranteed, sequencing cost of the TCR repertoires is greatly reduced, and authenticity in frequency distribution of each family is guaranteed; establishment of disease entity RCR repertoires requiring a great quantity of samples is promoted.
Description
Technical field
The invention belongs to biotechnology and art of clinical immunology, be specifically related to a kind of method detecting multiple trace sample φt cell receptor storehouse (Tcellreceptor, TCR).
Background technology
T cell is lymphocytic main ingredient, it has various biological function, as direct killing target cell, auxiliary or suppression B cell produces antibody, to specific antigens and the former responsing reaction of mitogenesis and produce cytokine etc., be resist in health to infect and swollen neoplastic brave fighter.T cell is by its surface receptor (Tcellreceptor, TCR) because of tumour antigen that transgenation produces in the pathogenic agent in molecular recognition external environment and toxin thereof and environment, but antigen in environment is ever-changing, do they how identify the Protean antigen of occurring in nature? classical clonal selection theory (clonalselectiontheory) thinks to there is numerous lymphocyte clones (10 in body
12above), each clone carries a kind of antigen receptor, a kind of antigen of specific recognition, thus composition one contains extremely multifarious TCR storehouse (TCRrepertoire).
TCR storehouse diversity is in ontogenetic process, produces by determining the germline gene of TCR structure to reset (rearrangement).TCR is made up of heterology dimer α, β or γ, δ two polypeptide chains.In human peripheral, about 95%T cell TCR molecule is made up of α, β chain.β chain gene is by variable region (variableregion, V), various district (diversityregion, D), land (joiningregion, and constant region (constantregion J), C) gene fragment composition, α chain gene is then by V, J, C gene fragment forms, each gene fragment grows early stage discontinuous distribution in T cell, T cell tcr gene in thymus development process is reset, make V, (D), J, C gene fragment is connected becomes the α of meritorious energy, β gene, regrouping process is with the random shearing of the N number of Nucleotide in gene fragment junction or insertion, this junctional diversity about reaches 2 × 10
11, α, β chain can random pair, produces about 6 × 10
2individual multifarious combination, amounts to junctional diversity and about can produce 10 with combination diversity
15individual different TCR.
The method in traditional research TCR storehouse, it is the homology based on V district gene order, TCRV α gene is divided into 34 families, V β gene is divided into 24 families, a upstream primer (i.e. 34 V α 1 ~ V α, 34,24 V β 1 ~ V β 24 upstream primers) is designed for each V α, V 'beta ' family V region sequence, constant-region sequences again for α, β gene designs a general C α, C β downstream primer, α, β gene of all T cell in T cell storehouse can be amplified by RT-PCR, identify the frequency distribution of each TCRV α, V β gene family.In theory, in healthy human body, T cell is cloned many and distributes relatively uniform, shows the diversity T cell storehouse with the anti-broad spectrum of pathogens of merit can completely.And under morbid state, antigen continues stimulation will cause specific TCR V α, V 'beta ' family T cell advantage pcr, there is skew in clone's distribution, show the restricted T cell storehouse with functional defect, and restricted degree is relevant to the state of an illness, disease is heavier, and restricted degree is higher.Therefore, analysis TCR storehouse diversity and the frequency distribution of V α, V 'beta ' family can understand animal economy T cell immunologic function situation.
The limitation of traditional method is: 1. analyzable TCR is only limitted to known TCRV α, V 'beta ' family.In fact, still have a lot of V gene fragment to be not yet find and divide family, only according to the data upgraded at present in ncbi database, just divide in order to 41 families by TCRV α gene, V β gene is divided into 30 families, and more early stage research has had more 13 families.2. carry out RT-PCR amplification owing to designing different primers for each family, the difference itself of each TCRV α, V β gene family amplification efficiency all can cause the deviation of frequency distribution, cannot objectively respond the frequency distribution situation of each family.3. respectively RT-PCR amplification is carried out to 58 families, need more cDNA template, sample size demand comparatively large (usually at least needing about 10ml blood sample), and operating process is loaded down with trivial details, time and effort consuming, easily occurs misoperation.
Summary of the invention
In order to solve above-mentioned Problems existing, the present invention establishes a kind of method wanting simultaneously can to detect multiple trace sample TCR storehouse efficiently, and effectively can distinguish different sample.Meanwhile, the primer that the present invention uses eliminates the possibility using family's primer to cause specific amplification, the frequency distribution situation of each family of more objective reaction.The present invention's operation is more convenient, detects more accurate, can promote the development that all kinds of TCR storehouse is studied greatly.
The object of the present invention is to provide a kind of method simultaneously detecting multiple trace sample TCR storehouse.
The technical solution used in the present invention is:
Detect the primer in sample TCR storehouse, described primer is:
α chain Outside primer:
P1：5’-GACAGACTTGTCACTGGATTTA-3’（SEQIDNO:1）；
β chain Outside primer:
P2：5’-AGATCTCTGCTTCTGATGGCT-3’（SEQIDNO:2）；
α chain inner primer:
P3：5’-TAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:3）；
β chain inner primer:
P4：5’-TGGCTCAAACACAGCGACCT-3’（SEQIDNO:4）。
Further, the joint that above-mentioned α chain inner primer and β chain inner primer are required in primer 5 ' termination as required.
Detect the test kit in sample TCR storehouse, containing primer described above in this test kit.
Detect the method in sample TCR storehouse, comprise the following steps:
1) sample total serum IgE is extracted;
2) RNA extracted is carried out to the synthesis of the first chain cDNA, for 5 '-RACE;
3) the first chain cDNA is as template, carries out 5 '-RACEPCR; Wherein upstream primer is universal primer, and downstream primer is α chain Outside primer described above or β chain Outside primer;
4) with 5 '-RACEPCR product for template, carry out nest-type PRC, wherein upstream primer is universal primer, and downstream primer is α chain inner primer described above or β chain inner primer;
5) product of nest-type PRC is carried out checking order and analyzing, the distribution situation in TCR storehouse can be obtained.
Further, step 2) described first chain cDNA synthesis adopt SMARTer
tMrACEcDNA test kit synthesizes.
Further, described in step 3), the reaction system of 5 '-RACEPCR is:
In every 25 μ l reaction systems, containing following composition:
PCR-GradeWater17.25μl
10×Advantage2PCRBuffer2.5μl
10mMdNTPMix0.5μl
cDNA1.25μl
Upstream universal primer 2.5 μ l
α chain Outside primer or β chain Outside primer 0.5 μ l
50×Advantage2PolymeraseMix0.5μl。
Further, the reaction conditions of 5 '-RACEPCR described in step 3) is 94 DEG C, 3min; 94 DEG C, 30s, 50 DEG C, 30s, 72 DEG C, 90s, 35 circulations; 72 DEG C, 10min.
Further, the reaction system of nest-type PRC described in step 4) is:
In every 25 μ l reaction systems, containing following composition:
Sterilizing distilled water 19.3 μ l
10×PCRBuffer2.5μl
dNTPMix0.5μl
5 '-RACEPCR product 1.0 μ l
MgSO
40.5μl
Upstream universal primer 0.5 μ l
α chain inner primer or β chain inner primer 0.5 μ l
Pfx high-fidelity enzyme 0.2 μ l.
Further, the reaction conditions of nest-type PRC described in step 4): 94 DEG C, 3min; 94 DEG C, 15s, 50 DEG C, 30s, 68 DEG C, 90s, 40 circulations; 68 DEG C, 10min.
Further, when sample to be tested is multiple sample, identical joint is added to the α chain inner primer in same sample and β chain inner primer, with 5 ' end of β chain inner primer, different joints is added to the α chain in different sample; Can realize in the sequencing procedure of step 5), the nested PCR product of multiple sample be mixed and checks order.
Further, the TCR storehouse distribution situation that the method obtains, comprises the expression and distribution situation of all V districts, J district gene in TCR α chain and β chain in sample, comprising the expression and distribution situation of V, J gene being not yet found or dividing family.
The invention has the beneficial effects as follows:
1) the present invention uses 5 ' RACE joint nest-type PRC primer and specific TCR α, β gene-specific primer RT-PCR to increase and obtains TCR α, β gene product, 1. can obtain V, J gene order being not yet found or dividing family; 2. avoiding traditional method uses each V α, V 'beta ' family primer to cause the different frequency distribution deviation caused of pcr amplification efficiency; 3. in a PCR reaction, amplify whole TCR, considerably reduce sample requirement amount.
2) the present invention's Auele Specific Primer (inner primer) in each sample adds given joint, can distinguish each sample more easily after order-checking, therefore achieves multiple sample PCR primer to mix and check order, and greatly reduces order-checking cost.
3) primer that the present invention uses eliminates the possibility using family's primer to cause specific amplification, the frequency distribution situation of each family of more objective reaction.The present invention's operation is more convenient, detects more accurate, can promote the development that all kinds of TCR storehouse is studied greatly.
Accompanying drawing explanation
Fig. 1 is technological line schematic diagram of the present invention;
Fig. 2 is the distribution situation in TCR storehouse in sample 1, and wherein A, B, C, D are respectively the expression and distribution situation of the T cell surface receptor containing α chain V district, α chain J district, β chain V district, β chain J district known in sample 1;
Fig. 3 is the distribution situation in TCR storehouse in sample 1, and wherein A, B, C, D are respectively the expression and distribution situation of the T cell surface receptor containing α chain V district, α chain J district, β chain V district, β chain J district known in sample 1;
Fig. 4 is the distribution situation in TCR storehouse in sample 1, and wherein A, B, C, D are respectively the expression and distribution situation of the T cell surface receptor containing α chain V district, α chain J district, β chain V district, β chain J district known in sample 1.
Embodiment
Detect the primer in sample TCR storehouse, described primer is:
α chain Outside primer:
P1：5’-GACAGACTTGTCACTGGATTTA-3’（SEQIDNO:1）；
β chain Outside primer:
P2：5’-AGATCTCTGCTTCTGATGGCT-3’（SEQIDNO:2）；
α chain inner primer:
P3：5’-TAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:3）；
β chain inner primer:
P4：5’-TGGCTCAAACACAGCGACCT-3’（SEQIDNO:4）。
Preferably, the joint that above-mentioned α chain inner primer and β chain inner primer are required in primer 5 ' termination as required.
Detect the test kit in sample TCR storehouse, containing primer described above in this test kit.
Detect the method in sample TCR storehouse, comprise the following steps:
1) sample total serum IgE is extracted;
2) RNA extracted is carried out to the synthesis of the first chain cDNA, for 5 '-RACE;
3) the first chain cDNA is as template, carries out 5 '-RACEPCR; Wherein upstream primer is universal primer, and downstream primer is α chain Outside primer described above or β chain Outside primer;
4) with 5 '-RACEPCR product for template, carry out nest-type PRC, wherein upstream primer is universal primer, and downstream primer is α chain inner primer described above or β chain inner primer;
5) product of nest-type PRC is carried out checking order and analyzing, the distribution situation in TCR storehouse can be obtained.
Preferably, step 2) described first chain cDNA synthesis adopt SMARTer
tMrACEcDNA test kit synthesizes.
Preferably, described in step 3), the reaction system of 5 '-RACEPCR is:
In every 25 μ l reaction systems, containing following composition:
PCR-GradeWater17.25μl
10×Advantage2PCRBuffer2.5μl
10mMdNTPMix0.5μl
cDNA1.25μl
Upstream universal primer 2.5 μ l
α chain Outside primer or β chain Outside primer 0.5 μ l
50×Advantage2PolymeraseMix0.5μl。
Preferably, the reaction conditions of 5 '-RACEPCR described in step 3) is 94 DEG C, 3min; 94 DEG C, 30s, 50 DEG C, 30s, 72 DEG C, 90s, 35 circulations; 72 DEG C, 10min.
Preferably, the reaction system of nest-type PRC described in step 4) is:
In every 25 μ l reaction systems, containing following composition:
Sterilizing distilled water 19.3 μ l
10×PCRBuffer2.5μl
dNTPMix0.5μl
5 '-RACEPCR product 1.0 μ l
MgSO
40.5μl
Upstream universal primer 0.5 μ l
α chain inner primer or β chain inner primer 0.5 μ l
Pfx high-fidelity enzyme 0.2 μ l.
Preferably, the reaction conditions of nest-type PRC described in step 4): 94 DEG C, 3min; 94 DEG C, 15s, 50 DEG C, 30s, 68 DEG C, 90s, 40 circulations; 68 DEG C, 10min.
Preferably, when sample to be tested is multiple sample, identical joint is added to the α chain inner primer in same sample and β chain inner primer, with 5 ' end of β chain inner primer, different joints is added to the α chain in different sample; Can realize in the sequencing procedure of step 5), the nested PCR product of multiple sample be mixed and checks order.
Preferably, the TCR storehouse distribution situation that the method obtains, comprises the expression and distribution situation of all V districts, J district gene in TCR α chain and β chain in sample, comprising the expression and distribution situation of V, J gene being not yet found or dividing family.
As shown in Figure 1, below in conjunction with specific embodiment, the present invention is further illustrated, but be not limited thereto for technological line schematic diagram of the present invention.
The experimental technique of unreceipted actual conditions in following examples, conveniently conditional operation, " Molecular Cloning: A Laboratory guide " (third edition) (SambrookJ that such as Sambrook etc. write, RussellDW, JanssenK, ArgentineJ. Huang training hall etc. is translated, and 2002, Beijing: Science Press) described in condition, or according to the condition that manufacturer advises.
embodiment 1:
3 samples that the present embodiment adopts are respectively:
Sample 1: Healthy People PBMC cell;
Sample 2: tubercular PBMC cell;
Sample 3:Jurket cell strain.
Wherein, the separation of PBMC cell adopts density gradient method, and concrete steps are as follows:
1) in 15ml scale sterile centrifugation tube, appropriate Ficoll lymphocyte separation medium is added;
2) taking heparin anti-freezing peripheric venous blood and equivalent RPMI-1640 fully mix dilution, and the anticoagulation drawing 2 times of volumes is slowly superimposed on lymphocyte separation medium along tube wall, note keeping interface complete;
3) 18 ~ 20 DEG C, 1800 ~ 2000rpm/min horizontal centrifugal, 20 ~ 30min;
4) centrifugal rear liquid in pipe is divided into four layers, and upper strata is blood plasma and diluent, is mainly red corpuscle and GCL at the bottom of pipe.Middle level is lymphocyte separation medium, has a canescence cloud and mist layer based on mononuclearcell in upper, interface, middle level;
5) suction pipe is inserted into buffy coat, draws mononuclearcell, be placed in another centrifuge tube;
6) 5 times are added with the RPMI1640 of upper volume, 18 ~ 20 DEG C, the centrifugal 10min of 1500rpm/min;
7) washed cell is PBMC after removing the thrombocyte that major part mixes for twice.
one, cell total rna is extracted
Use total RNA extraction reagent box (OmegaBiotechCompany, Doraville, GA, USA), by specification method extracts the total serum IgE of cell in sample 1 ~ 3 respectively.
two, RT-PCR amplifying target genes(comprising 5 '-RACE first chain cDNA to synthesize, RACE-PCR and nest-type PRC);
1) 5 '-RACE first chain cDNA synthesizes
With the RNA extracted for template, use SMARTer
tMrACEcDNA amplification kit (Clontech, CatNos.634923 & 634924), operation steps reference reagent box specification sheets, obtains the first chain cDNA of each sample.
2）5’-RACEPCR
Respectively using the first chain cDNA of each sample as template, carry out 5 '-RACEPCR, its reaction system is:
In every 25 μ l reaction systems, containing following reagent:
Upstream primer described in upper table is universal primer 5 '-AAGCAGTGGTATCAACGCAGAGT-3 ' (SEQIDNO:11), and downstream primer is the Outside primer of the α chain gene of T cell surface receptor (TCR) or the Outside primer of β chain gene, and its sequence is respectively:
α chain Outside primer is:
P1：5’-GACAGACTTGTCACTGGATTTA-3’（SEQIDNO:1）；
β chain Outside primer:
P2：5’-AGATCTCTGCTTCTGATGGCT-3’（SEQIDNO:2）。
The reaction conditions of 5 '-RACEPCR is: 94 DEG C, 3min; 94 DEG C, 30s, 50 DEG C, 30s, 72 DEG C, 90s, 35 circulations; 72 DEG C, 10min.
3) nested PCR amplification goal gene
Respectively with 5 '-RACEPCR product of each sample for template, utilize inner primer to carry out nested PCR amplification respectively, its reaction system is:
In every 25 μ l reaction systems, containing following reagent:
Upstream primer described in upper table is universal primer 5 '-AAGCAGTGGTATCAACGCAGAGT-3 ' (SEQIDNO:11), and downstream primer is the inner primer of the α chain gene of T cell surface receptor (TCR) or the inner primer of β chain gene, and its sequence is respectively:
α chain inner primer:
P3：5’-TAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:3）；
β chain inner primer:
P4：5’-TGGCTCAAACACAGCGACCT-3’（SEQIDNO:4）。
In order to realize detecting in storehouse TCR in multiple sample simultaneously, can add different joints to 5 ' end of inner primer in different sample, the α chain inner primer in same sample and β chain inner primer add identical joint; Each sample can be distinguished more easily after order-checking, thus realize the nested PCR product of multiple sample to mix to check order.In the present embodiment, the inner primer interpolation joint situation of 3 samples is as follows, and wherein all underscore parts are joint.
sample 1:
α chain inner primer+adaptor1:
P5：5’-
CGTGATTAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:5）；
β chain inner primer+adaptor1:
P6：5’-
CGTGATTGGCTCAAACACAGCGACCT-3’（SEQIDNO:6）；
sample 2:
α chain inner primer+adaptor2:
P7：5’-
ACATCGTAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:7）；
β chain inner primer+adaptor2(sample 2):
P8：5’-
ACATCGTGGCTCAAACACAGCGACCT-3’（SEQIDNO:8）；
sample 3:
α chain inner primer+adaptor3:
P9：5’-
ATTGGCTAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:9）；
β chain inner primer+adaptor3:
P10：5’-
ATTGGCTGGCTCAAACACAGCGACCT-3’（SEQIDNO:10）；
The reaction conditions of nested PCR amplification: 94 DEG C, 3min; 94 DEG C, 15s, 50 DEG C, 30s, 68 DEG C, 90s, 40 circulations; 68 DEG C, 10min.
three, check order
Reclaim the product of the nest-type PRC of each sample of purifying, mixing, sample presentation carries out two generations order-checking (Bai Hao bio tech ltd, Shanghai).
four, sequencing result is analyzed, draws the V(variable region of each sample, variableregion), J(land, joiningregion) the expression amount distribution situation of gene fragment.
By to sequencing result and existing known TCR(T cell surface receptor) compare, obtain α chain in 3 samples, β chain gene variable region (variableregion respectively, V), land (joiningregion, J) expression and distribution situation, Fig. 2 ~ 4 are respectively the distribution situation of TCR known in sample 1 ~ 3; And in the sequence measured at us, found do not have comparison to arrive the sequence in V district, J district in a large number, wherein contain the new family of TCR α chain and β Lian Zhong V district, J district gene.Illustrate that the inventive method can reduce the distribution situation of TCR in sample and overall looks more realistically, avoid the frequency distribution deviation that traditional method uses each V α, V 'beta ' family primer to cause pcr amplification efficiency difference to cause; More be conducive to analyzing the relation between various disease and TCR storehouse distribution situation, promote the using value of TCR storehouse distribution situation in clinical diagnosis, treatment and prognosis.
In sum, the present invention, by adding different joint to each sample constant region primers, utilizes joint sequence after order-checking, can by the TCR sequence area of each sample separately, the object in high throughput testing multiple sample TCR storehouse while of to reach.After sample area separates, utilize TCR α and β chain constant region specific primers, α, β chain-ordering can be distinguished, and then analyze frequency of utilization and the characteristic distributions of V, J gene fragment and combination thereof on every bar chain, and CDR3 region sequence characteristic sum frequency, thus represent the overall looks (the expression and distribution situation in three sample TCR α and β chain V, J gene fragment is opened up in Fig. 2 ~ 4) in each sample TCR storehouse.By contrasting the TCR storehouse Biodiversity Characteristics between different group sample, analyzing the relation between itself and disease, TCR storehouse can be excavated and analyze the using value in clinical diagnosis, treatment and prognosis.
<110> First People's Hospital of Foshan City
<120> mono-kind detects the method in multiple trace sample TCR storehouse simultaneously
<130>
<160>11
<170>PatentInversion3.5
<210>1
<211>22
<212>DNA
The artificial primer of <213>
<400>1
gacagacttgtcactggattta22
<210>2
<211>21
<212>DNA
The artificial primer of <213>
<400>2
agatctctgcttctgatggct21
<210>3
<211>21
<212>DNA
The artificial primer of <213>
<400>3
tagagtctctcagctggtaca21
<210>4
<211>20
<212>DNA
The artificial primer of <213>
<400>4
tggctcaaacacagcgacct20
<210>5
<211>27
<212>DNA
The artificial primer of <213>
<400>5
cgtgattagagtctctcagctggtaca27
<210>6
<211>26
<212>DNA
The artificial primer of <213>
<400>6
cgtgattggctcaaacacagcgacct26
<210>7
<211>27
<212>DNA
The artificial primer of <213>
<400>7
acatcgtagagtctctcagctggtaca27
<210>8
<211>26
<212>DNA
The artificial primer of <213>
<400>8
acatcgtggctcaaacacagcgacct26
<210>9
<211>27
<212>DNA
The artificial primer of <213>
<400>9
attggctagagtctctcagctggtaca27
<210>10
<211>26
<212>DNA
The artificial primer of <213>
<400>10
attggctggctcaaacacagcgacct26
<210>11
<211>23
<212>DNA
The artificial primer of <213>
<400>11
aagcagtggtatcaacgcagagt23
Claims (10)
1. detect the primer in sample TCR storehouse, it is characterized in that: described primer is:
α chain Outside primer:
P1：5’-GACAGACTTGTCACTGGATTTA-3’（SEQIDNO:1）；
β chain Outside primer:
P2：5’-AGATCTCTGCTTCTGATGGCT-3’（SEQIDNO:2）；
α chain inner primer:
P3：5’-TAGAGTCTCTCAGCTGGTACA-3’（SEQIDNO:3）；
β chain inner primer:
P4：5’-TGGCTCAAACACAGCGACCT-3’（SEQIDNO:4）。
2. primer according to claim 1, is characterized in that: the joint that described α chain inner primer and β chain inner primer are required in primer 5 ' termination as required.
3. detect the test kit in sample TCR storehouse, it is characterized in that: containing the arbitrary described primer of claim 1 ~ 2 in this test kit.
4. detect the method in sample TCR storehouse, it is characterized in that: comprise the following steps:
1) sample total serum IgE is extracted;
2) RNA extracted is carried out to the synthesis of the first chain cDNA, for 5 '-RACE;
3) the first chain cDNA is as template, carries out 5 '-RACEPCR; Wherein upstream primer is universal primer, and downstream primer is the α chain Outside primer described in claim 1 or β chain Outside primer;
4) with 5 '-RACEPCR product for template, carry out nest-type PRC, wherein upstream primer is universal primer, downstream primer for claim 1 ~ 2 arbitrary described in α chain inner primer or β chain inner primer;
5) product of nest-type PRC is carried out checking order and analyzing, the distribution situation in TCR storehouse can be obtained.
5. method according to claim 4, is characterized in that: step 2) synthesis of described first chain cDNA adopts SMARTer
tMrACEcDNA test kit synthesizes.
6. method according to claim 4, is characterized in that: described in step 3), the reaction system of 5 '-RACEPCR is:
In every 25 μ l reaction systems, containing following composition:
PCR-GradeWater17.25μl
10×Advantage2PCRBuffer2.5μl
10mMdNTPMix0.5μl
cDNA1.25μl
Upstream universal primer 2.5 μ l
α chain Outside primer or β chain Outside primer 0.5 μ l
50×Advantage2PolymeraseMix0.5μl。
7. method according to claim 4, is characterized in that: the reaction conditions of 5 '-RACEPCR described in step 3) is 94 DEG C, 3min; 94 DEG C, 30s, 50 DEG C, 30s, 72 DEG C, 90s, 35 circulations; 72 DEG C, 10min.
8. method according to claim 4, is characterized in that: the reaction system of nest-type PRC described in step 4) is:
In every 25 μ l reaction systems, containing following composition:
Sterilizing distilled water 19.3 μ l
10×PCRBuffer2.5μl
dNTPMix0.5μl
5 '-RACEPCR product 1.0 μ l
MgSO
40.5μl
Upstream universal primer 0.5 μ l
α chain inner primer or β chain inner primer 0.5 μ l
Pfx high-fidelity enzyme 0.2 μ l.
9. method according to claim 4, is characterized in that: the reaction conditions of nest-type PRC described in step 4): 94 DEG C, 3min; 94 DEG C, 15s, 50 DEG C, 30s, 68 DEG C, 90s, 40 circulations; 68 DEG C, 10min.
10. method according to claim 4, it is characterized in that: when sample to be tested is multiple sample, identical joint is added to the α chain inner primer in same sample and β chain inner primer, with 5 ' end of β chain inner primer, different joints is added to the α chain in different sample; Can realize in the sequencing procedure of step 5), the nested PCR product of multiple sample be mixed and checks order.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510689156.XA CN105274098B (en) | 2015-10-21 | 2015-10-21 | Method that is a kind of while detecting the libraries multiple trace sample TCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510689156.XA CN105274098B (en) | 2015-10-21 | 2015-10-21 | Method that is a kind of while detecting the libraries multiple trace sample TCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105274098A true CN105274098A (en) | 2016-01-27 |
| CN105274098B CN105274098B (en) | 2018-07-17 |
Family
ID=55143932
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510689156.XA Active CN105274098B (en) | 2015-10-21 | 2015-10-21 | Method that is a kind of while detecting the libraries multiple trace sample TCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274098B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106283201A (en) * | 2016-09-20 | 2017-01-04 | 中国医学科学院肿瘤医院 | TCR multiformity based on high-flux sequence detection and library construction |
| CN107893068A (en) * | 2017-10-20 | 2018-04-10 | 重庆天科雅生物科技有限公司 | A kind of method for building people TCRbetaCDR3 areas library |
| WO2019061196A1 (en) * | 2017-09-28 | 2019-04-04 | 深圳华大生命科学研究院 | Pcr primers for detection and use thereof |
| CN111164210A (en) * | 2017-09-28 | 2020-05-15 | 深圳华大生命科学研究院 | PCR primer for amplifying TCR full-length sequence and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014008448A1 (en) * | 2012-07-03 | 2014-01-09 | Sloan Kettering Institute For Cancer Research | Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation |
| CN103865998A (en) * | 2013-12-16 | 2014-06-18 | 周菊华 | Gene detection method for tumor immunotherapy effect |
| CN104212911A (en) * | 2014-03-06 | 2014-12-17 | 北京大学人民医院 | Primers and kit for detecting chronic hepatitis B and liver cancer T cell receptor repertoire |
-
2015
- 2015-10-21 CN CN201510689156.XA patent/CN105274098B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014008448A1 (en) * | 2012-07-03 | 2014-01-09 | Sloan Kettering Institute For Cancer Research | Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation |
| CN103865998A (en) * | 2013-12-16 | 2014-06-18 | 周菊华 | Gene detection method for tumor immunotherapy effect |
| CN104212911A (en) * | 2014-03-06 | 2014-12-17 | 北京大学人民医院 | Primers and kit for detecting chronic hepatitis B and liver cancer T cell receptor repertoire |
Non-Patent Citations (4)
| Title |
|---|
| JENNIFER BENICHOU等: "Rep-Seq: uncovering the immunological repertoire through next-generation sequencing", 《IMMUNOLOGY》 * |
| RENE L. WARREN等: "Exhaustive T-cell repertoire sequencing of human peripheral blood samples reveals signatures of antigen selection and a directly measured repertoire size of at least 1 million clonotypes", 《GENOME RESEARCH》 * |
| TATSUHIKO OZAWA等: "Amplification and analysis of cDNA generated from a single cell by 5′-RACE: application to isolation of antibody heavy and light chain variable gene sequences from single B cells", 《BIOTECHNIQUES》 * |
| TATSUHIKO OZAWA等: "comprehensive analysis of the functional TCR repertoire at the single-cell level", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106283201A (en) * | 2016-09-20 | 2017-01-04 | 中国医学科学院肿瘤医院 | TCR multiformity based on high-flux sequence detection and library construction |
| CN106283201B (en) * | 2016-09-20 | 2019-08-06 | 中国医学科学院肿瘤医院 | The detection of TCR diversity and library construction based on high-flux sequence |
| WO2019061196A1 (en) * | 2017-09-28 | 2019-04-04 | 深圳华大生命科学研究院 | Pcr primers for detection and use thereof |
| CN111148836A (en) * | 2017-09-28 | 2020-05-12 | 深圳华大生命科学研究院 | PCR primer for detection and application thereof |
| CN111164210A (en) * | 2017-09-28 | 2020-05-15 | 深圳华大生命科学研究院 | PCR primer for amplifying TCR full-length sequence and application thereof |
| CN107893068A (en) * | 2017-10-20 | 2018-04-10 | 重庆天科雅生物科技有限公司 | A kind of method for building people TCRbetaCDR3 areas library |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105274098B (en) | 2018-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087789B (en) | A method of BCR and TCR immune groups library in detection blood plasma cfDNA | |
| CN103710454B (en) | Method for TCR or BCR high-throughput sequencing and method for correcting multiple PCR primer deviation by using tag sequence | |
| AU2015240749B2 (en) | Determining antigen-specific T-cells and B-cells | |
| CN105063209B (en) | A kind of excretion body miRNA quantitative detecting method | |
| CN105274098A (en) | Method for simultaneously detecting multiple trace sample TCR (T cell receptor) repertoires | |
| CN107475375A (en) | A kind of DNA probe storehouse, detection method and kit hybridized for microsatellite locus related to microsatellite instability | |
| CN107955835A (en) | A kind of primer pond of detection BRCA1/2 gene mutations and detection method | |
| WO2018095108A1 (en) | Primer composition, use thereof, and methods for constructing library and for determining nucleic acid sequence | |
| CN107475403A (en) | The analysis method of the method for detection Circulating tumor DNA, kit and its sequencing result from peripheral blood dissociative DNA | |
| CN106957906B (en) | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease | |
| Vahed et al. | A microRNA isolation method from clinical samples | |
| CN102443624B (en) | Method for simultaneously sequencing multi-sample CDR3 (complementary determining region 3) receptor library with high flux | |
| CN104293914A (en) | MiRNA marker combination for detecting primary hepatocellular carcinoma serum and application thereof | |
| Frørup et al. | Plasma exosome-enriched extracellular vesicles from lactating mothers with type 1 diabetes contain aberrant levels of miRNAs during the postpartum period | |
| CN109112217A (en) | A kind of and pig body length and the significantly associated genetic marker of number of nipples and application | |
| Segawa et al. | HLA genotyping by next-generation sequencing of complementary DNA | |
| CN106480017A (en) | Extract the test kit of circulating tumor cell DNA and tumor dissociative DNA simultaneously | |
| CN106498079A (en) | Based on quality control method and kit that high-flux sequence detects people's KRAS genetic mutations | |
| Babalola et al. | Shotgun metagenomic sequencing data of sunflower rhizosphere microbial community in South Africa | |
| CN107557461A (en) | A kind of mass spectrographic detection method of nucleic acid early sieved for liver cancer susceptibility | |
| Gonçalves et al. | Host transcriptome and microbiota signatures prior to immunization profile vaccine humoral responsiveness | |
| CN106497916A (en) | A kind of construction method in the NK cell polygenic variations library for high-flux sequence detection and its application | |
| Sharma et al. | Usage of conventional PCR technology for the detection of HLA-B27 allele: a significant molecular marker of ankylosing spondylitis | |
| CN103882095A (en) | Application of small molecule RNA as tuberculosis marker | |
| CN108315321A (en) | The detection of K-ras gene mutation sites in urine ctDNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |