CN106957906B - Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease - Google Patents
Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease Download PDFInfo
- Publication number
- CN106957906B CN106957906B CN201611204857.0A CN201611204857A CN106957906B CN 106957906 B CN106957906 B CN 106957906B CN 201611204857 A CN201611204857 A CN 201611204857A CN 106957906 B CN106957906 B CN 106957906B
- Authority
- CN
- China
- Prior art keywords
- primer
- tcr
- kit
- minimal residual
- residual disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
Abstract
The invention belongs to the field of molecular biology, and particularly relates to a primer combination and a kit for detecting T cell leukemia minimal residual disease by high-throughput sequencing, which are characterized in that: the primer combination comprises a TCR5 'Oligo joint, a TCR 3' Oligo (dT) primer, a TCR C region primer, a label upstream primer and a label downstream primer, and the kit contains the primer combination as claimed in claim 1 or 2. Full-length information of the T Cell Receptor (TCR) gene sequence was obtained by primer upstream from the linker to primer downstream from the C region.
Description
Technical Field
The invention belongs to the field of molecular biology detection, and particularly relates to a primer combination and a kit for detecting T cell leukemia minimal residual disease by high-throughput sequencing.
Background
Leukemia is a malignant clonal disease of hematopoietic stem cells. The clonal leukemia cells are proliferated and accumulated in bone marrow and other hematopoietic tissues in large quantity due to mechanisms such as uncontrolled proliferation, differentiation disorder, apoptosis blockage and the like, infiltrate other non-hematopoietic tissues and organs, and inhibit normal hematopoietic function, and the T cell leukemia belongs to malignant clonal proliferation of T cells.
With the continuous improvement of chemotherapy, specific targeted therapy, Hematopoietic Stem Cell Transplantation (HSCT) therapy and other technologies, the treatment effect of leukemia is increasingly improved, but the recurrence is still a difficult point which troubles the cure of leukemia, and the reason is mainly related to leukemia cell Minimal Residual Disease (MRD). MRD refers to the small number of leukemia cells remaining in the patient when complete remission is achieved by induction therapy.
Recent studies show that leukemia relapse is closely related to MRD, and MRD increase can predict the overall relapse of leukemia in advance. Therefore, the test method with high sensitivity, strong specificity, stability and reliability is adopted to carry out periodic MRD detection on leukemia patients, and has important clinical significance for evaluating disease states, judging curative effect, predicting relapse and guiding treatment. Patients with T cell leukemia have a recurrence rate of > 50%, and therefore MRD is routinely tested to aid in the design of personalized therapies.
The current methods for detecting MRD mainly rely on molecular immunology techniques such as flow cytometry (flowcytometry), but the sensitivity of the methods can only reach 10 at most-4The order of magnitude (0.01%), and the judgment of MRD result by the method depends on the experimental condition of each laboratory and the personal experience of operators to a great extent, the standardization degree is low, and the research shows that the immunophenotype of leukemia cells changes due to the influence of chemotherapy drugs in the chemotherapy process, namely, the phenomenon of 'immune drift', and the reliability and the accuracy of MRD result can be influenced.
The large number of V (variable region), D (variable region), J (joining region) gene segments at the T cell locus will produce a variety of recombinations in the formation of T cell receptors. This recombination of the V-D-J genes confers on each T cell its own unique T Cell Receptor (TCR), thereby enabling the sequence of each TCR to be effectively a unique biomarker for one T cell clone. Therefore, sequencing the sequence composition of T cell TCR gene can well locate each T cell, including T cells with leukemia canceration. And the sensitivity can reach up to 10-6(0.0001％)。
Since the TCR gene is mainly characterized by random recombination of V, D, J gene fragments, it is difficult to design an upstream primer for identifying the 5' end sequence of the TCR gene for unknown gene sequences, and thus PCR amplification and sequencing cannot be used.
The other method of sequencing TCR, i.e. the method of multiplex primer PCR, can only sequence part of the sequence information in the TCR gene, thus making the sequencing gene information incomplete. In addition, the primers of the multiplex primer PCR method are designed according to the known V and J genes, but the gene mutation of cancer cells is very common in cancer patients, if the TCR of leukemia cancer cells is mutated, the primers with known sequences can not identify the mutated gene, and the detection result is easy to cause false negative.
Disclosure of Invention
In order to solve the technical problems, the invention provides a primer combination and a kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease, wherein a T cell leukemia minimal residual disease TCR library is constructed through high-throughput sequencing, a constructed cDNA joint and a single pair of primers are constructed, and the full-length information of a TCR gene sequence is obtained from an upstream primer of the joint to a downstream primer of a C region.
The primer combination can effectively amplify the complete sequence of the TCR gene. The construction efficiency of the TCR next-generation sequencing library is high, the kit provides a simple and convenient use method for users, and the efficiency is stable.
The primer combination for high-throughput sequencing detection of T cell leukemia minimal residual disease, which solves the technical problems, is characterized in that: the primer combination comprises a TCR5 'Oligo joint, a TCR 3' Oligo (dT) primer, a TCR C region primer and a label upstream and downstream primer, wherein each primer sequence is as follows:
a TCR 5' Oligo linker having the base sequence: 5 'ATGCATCGGTATTCAGCATGAACTTrGrGrG 3';
TCR 3' oligo (dT) primer: 5 'TTTTTTTTTTTTTTTTTTTTGA 3';
the primer sequence of the TCR 5' end connector is as follows:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
the primer sequence of the TCR C region is as follows:
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
a label upstream primer: 5 'CAAGCAGAAGACGGCATACGAGAT [ index1] GTCTCGTGGGCTGG 3';
a label downstream primer: 5 'AATGATACGGCGACCACCGAGATCTACAC [ index2] TCGTCGCCAGCGTC 3';
wherein the index1 is ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA,
One of GATTCAGT, CTGTTCGT or TATACGGC; index2 is TAGCTACT, ATTATAGC,
One of CCCGTACT, GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT, or GTTGCTAC.
The invention relates to a kit for detecting T cell leukemia minimal residual disease by high-throughput sequencing, which is characterized by comprising the following components in parts by weight: comprising the primer combination of claim 1 or 2.
The kit in the optimization scheme of the invention further comprises PCR buffer solution, Q5High-Fidelity 2XMastermix, enucleated enzyme water, AMPure XP Beads and 70% ethanol.
In a further optimization scheme, the kit comprises:
(1) PCR buffer solution: 9.5 mu L;
(2) positive control RNA (1. mu.g/. mu.l): 10 mu L of the solution;
(3)10 μ M TCR 3' oligo (dT) primer: 1.1 μ L;
(4)10 μ M TCR 5' end linker primer and 10 μ M TCR C region primer: 1.1. mu.L each;
(5)Q5High-Fidelity 2X Master Mix：55μL；
(6)10 μ M tag upstream primer and 10 μ M tag downstream primer: 1.1. mu.L each;
(7) enucleated enzyme water: 105 mu L of the solution;
(8)AMPure XP Beads：88μL；
(9) 70% ethanol: 165. mu.L.
The PCR buffer consists of the following systems:
the preparation steps of the kit comprise purchasing raw materials and then assembling the raw materials into the kit. All reagents are commercially available and primers can provide sequences to the primer synthesis company, where they can synthesize them. And (4) loading the mixture into a test tube according to a required proportion, and packaging the mixture into a kit.
The primer and the kit of the invention are used for carrying out high-throughput sequencing detection on the T cell leukemia minimal residual disease, and the method comprises the following steps:
(1) obtaining a human blood sample of 10mL in an EDTA anticoagulant tube;
(2) peripheral Blood Mononuclear Cells (PBMC) were isolated using lymphocyte isolate Ficoll-1077 (Sigma #10771, USA);
the lymphocyte separating medium is useful for separating lymphocytes from whole blood because T cells are a kind of lymphocytes and the T cells are T cells, and RNA obtained from the separated cell population is RNA from which cells such as red blood cells and platelets are removed. Therefore, the total RNA contained T cell RNA template used for library construction has higher purity.
(3) Extracting total RNA of PBMC by Trizol method with RNAzol RT (MRC # RN 190);
the Trizol method for extracting RNA is a traditional method, and no special or patent application place exists, so I do not write out steps in detail. The method comprises the following steps:
the cells were harvested, transferred to a 1.5ml centrifuge tube, added to 1ml Trizol, mixed well and allowed to stand at room temperature for 5 min.
0.2ml of chloroform was added thereto, and the mixture was shaken for 15 seconds and allowed to stand for 2 min.
0.5ml of isopropanol was added, the liquid in the tube was gently mixed and allowed to stand at room temperature for 10 min.
Centrifugation is carried out at 4 ℃ for 12000g × 10min, and the supernatant is discarded.
1ml of 75% ethanol was added and the precipitate was washed gently. Centrifuge at 4 ℃ for 7500g × 5min, discard the supernatant.
Air-drying, adding 50ul DEPC H2O, and dissolving to obtain total RNA of lymphocyte.
(4) RNA is reversely transcribed into cDNA, and meanwhile, a joint is added at the 5 'end of the cDNA for 5' end primer combination in the following PCR amplification;
addition of the linker simultaneously during reverse transcription minimizes loss of RNA during the multi-step reaction. RNA has extremely poor stability in operation and is very easy to degrade, a small number of steps can reduce degradation to the maximum extent, and simultaneously, the preparation time of cDNA which can be used for amplification is saved.
The linker, i.e., the nucleic acid linker at the 5 'end of the cDNA, is a TCR 5' Oligo linker.
(5) PCR1, amplifying the recombinant TCR cDNA by a single primer pair;
(6) PCR2 and purification: adding an upper machine joint and a label of an Illumina high-throughput sequencer to a PCR1 product (amplified TCR sequence), and amplifying more upper machine gene quantity again; after the PCR reaction, DNA was purified using magnetic beads.
The PCR product generally contains an excess of primers, Taq DNase and dNTPs. The existence of the components directly influences the subsequent library quality detection, sequencing reaction and other processes, and the purification can remove the byproducts influencing the subsequent experiments. Meanwhile, the purification process is a process of screening the size of the fragment, the DNA fragment in the invention is about 700bp, magnetic beads with different volumes can be used for mixing with PCR products, the different volume ratios of the magnetic beads to the DNA can adsorb the fragments with different sizes, the wrong (error) fragment and primer dimer during PCR amplification can be successfully removed by using the volume of the magnetic beads, so that the sequencing on computer library only has the sequencing target DNA fragment, the sequencing result is more accurate, and the error is reduced.
As shown in FIG. 3, only one peak of the fragment was found by quality inspection of the library.
(7) High throughput sequencing was performed: sequencing the obtained cDNA library by an Illumina MiSeq platform, wherein the sequencing mode is PE300, the denaturation concentration of the library is 2nM, the loading concentration is 20pM, and analyzing a high-throughput sequencing result by bioinformatics;
according to whether the specific TCR sequence is more than 10-4(0.01%), i.e., whether or not a particular T cell is greater than 10-4(0.01%) to determine whether the minimal residual disease of the subject is positive or negative, if MRD is detected>10-4(0.01%) is positive, if MRD is present<10-4(0.01%) was negative.
In step (iv) of the present invention, each RNA sample was mixed in the following ratio:
incubate at 72 ℃ for 3 minutes, followed by 4 ℃ for 1 minute.
PCR reaction buffer was prepared in the following proportions
Mix the PCR buffer with the RNA sample and begin reverse transcription of cDNA according to the following reaction protocol
60 minutes at 42 DEG C
10 minutes at 70 DEG C
Permanent at 4 deg.C
After the reaction is completed, the total cDNA to which the linker has been added at the 5' end can be obtained (see FIG. 1).
The concrete steps in the step (V) are as follows: the reaction system was prepared according to the following proportions:
and preparing a reaction system according to the reaction system, mixing the 5 samples of reagent in a PCR test tube, uniformly mixing, centrifuging for several seconds, and centrifuging the liquid residue on the tube wall to the bottom of the tube. The tube was placed in a PCR amplification apparatus and run according to the above reaction protocol.
The PCR1 reaction procedure in the step (5) is as follows:
3 minutes at 95 ℃; 30 seconds at 95 ℃; 1 minute at 65 ℃ and 25 cycles; 1 minute at 72 ℃; permanent at 4 ℃.
The specific steps in the step (6) are as follows:
the reaction system was prepared according to the following proportions:
the total volume of the systems in PCR1 and PCR2 was 50ul, and other substances were just replenished with water if they were not added together enough.
The PCR2 reaction program in the step (6) is as follows:
3 minutes at 94 ℃; 30 seconds at 94 ℃; 30 seconds at 55 ℃ and 15 cycles; 20 minutes at 72 ℃,1 minute at 72 ℃ and permanent at 4 ℃.
The specific purification steps in step (6) are as follows:
A. add 80. mu.L of AMPure XP Beads to PCR2 reaction product and mix well.
B. Incubate at room temperature for 10 minutes.
C. Placing the magnetic bead-PCR 2 product mixture test tube on a magnetic rack, waiting for all the magnetic beads to be adsorbed on the magnetic rack,
all supernatants were pipetted off and discarded.
E. The fourth step was repeated 2 times.
F. And opening the test tube cover, waiting for 5 minutes, and allowing the magnetic beads to air dry without any ethanol remaining in the test tube.
J. The test tube was removed from the magnetic stand, 50. mu.L of the enucleated enzyme water was added thereto, and the suspended magnetic beads were blown by a pipette.
H. And (4) putting the test tube back to the magnetic frame, and transferring the supernatant into a new test tube after all the magnetic beads are adsorbed on the magnetic frame. The supernatant contained the purified cDNA of the PCR2 product.
The invention is based on high-throughput sequencing technology, and a library construction method of a TCR sequencing single pair primer, wherein after T cell RNA is obtained, a joint is added to the 5 'end of cDNA while reverse transcription from RNA to cDNA is carried out, so that a TCR amplification upstream primer is designed through the joint with a known sequence, and a downstream primer is designed by matching with a C region gene (invariant region) at the 3' end of a TCR gene, thereby achieving the purpose of amplifying the whole TCR sequence full-length gene.
The primer combination and the kit have the detection sensitivity of 10-6(0.0001%) 100 times higher than the current clinical detection method.
The invention provides a joint for constructing a leukemia minimal residual disease TCR library based on high-throughput sequencing, and the primers and the method have the beneficial effects that: 1. obtaining the human TCR complete transcriptome sequence; 2. human specific CDR1, CDR2, and CDR3 sequences were obtained; 3. obtain the productThe TCR sequence after renaturation and proliferation is used as a biomarker for detecting the minimal residual disease of leukemia and is particularly improved by less than 10-4And detection rate of low copy number T cell clones.
On the basis of a high-throughput sequencing platform, comprehensive bioinformatics analysis is carried out on the sequencing result of the human TCR gene, so that the gene preference, VDJ gene combination information, TCR clone variety information, TCR diversity information, nucleic acid sequence and amino acid sequence information of CDR1, CDR2 and CDR3, mutation information on the gene and the like of the TCR during VDJ recombination are obtained. It is these factors that create a vast and diverse repertoire of TCRs.
The primer combination and the kit are used for detection, provide detailed bioinformatics data analysis after sequencing, provide effective quality monitoring for the whole experiment, and can reduce experiment errors and errors to the greatest extent. Sequencing assessment of the TCR can help medical workers and cancer patients quickly and non-invasively predict the level of T cell leukemia Minimal Residual Disease (MRD), which means that cancer still has residual cancer cells in vivo after complete remission, which is the source of disease recurrence. In order to strive for long-term disease-free survival and recovery of patients, dynamic monitoring, real-time efficacy assessment, treatment guidance and recurrence prediction must be performed on MRD.
Drawings
FIG. 1 schematic diagram of reverse transcribed cDNA of RNA of the present invention
FIG. 2 is a schematic diagram of the amplification of TCR cDNA by two PCR and the addition of sequencing machine adaptor in the present invention
FIG. 3 shows the quality inspection results of the sequencing library of the present invention.
FIG. 4 shows the bioinformatics analysis and alignment of the sequencing results of the TCR of the invention to find out the information (part) of each sequence
FIG. 5 is a 3D forest plot of TCR sequencing results according to the invention. Displaying the diversity and clonality of the TCR of the subject, wherein each bar represents a TCR clone, the clonally proliferated TCR represents the proliferation of the leukemia cancer cells, and the proliferated TCR sequence can be used as a biomarker of the cancer cells and provides a biomarker for each future leukemia minimal residual disease detection.
Detailed Description
The invention is described in further detail below with reference to specific embodiments, and the following primers were synthesized by Invitrogen, usa:
example 1
The primer combination and the kit applied to the invention are used for detecting the T cell leukemia minimal residual disease by high-throughput sequencing, and comprise the following steps:
(1) obtaining a human blood sample of 10mL in an EDTA anticoagulant tube;
(2) peripheral Blood Mononuclear Cells (PBMC) were isolated using lymphocyte isolate Ficoll-1077 (Sigma #10771, USA);
(3) extracting total RNA of PBMC by Trizol method with RNAzol RT (MRC # RN 190);
(4) the RNA is reversely transcribed into cDNA, and a joint is added at the 5 'end of the cDNA for 5' end primer combination in the following PCR amplification,
reagents used:
TCR 3' oligo (dT) primer (10. mu.M)
5 Xreverse transcription buffer (250mM Tris-HCl (pH 8.3),375mM KCl,15mM MgCl2)
Dithiothreitol, DTT (20mM) U.S. Thermo Scientific # R0861
dNTP Mix (10mM) U.S. Invitrogen #18427088
RNAse Out (40U/. mu.L) U.S. Invitrogen #10777019
TCR 5' Oligo linker (10. mu.M)
Superscript II RT (200U/. mu.L) U.S. Invitrogen #18064022
Each RNA sample was mixed in the following ratio:
| reagent | Volume 1X (μ L) |
| |
8 |
| TCR 3' oligo (dT) primer (10. mu.M) | 1 |
Incubate at 72 ℃ for 3 minutes, followed by 4 ℃ for 1 minute.
PCR reaction buffer was prepared in the following proportions
Mix the PCR buffer with the RNA sample and begin reverse transcription of cDNA according to the following reaction protocol
60 minutes at 42 DEG C
10 minutes at 70 DEG C
Permanent at 4 deg.C
After the reaction is completed, the total cDNA to which the linker has been added at the 5' end can be obtained (see the figure)
(5) PCR 1. The recombinant TCR cDNA is amplified by a single-pair primer mode, and the specific steps are as follows:
reagents used:
q5High-Fidelity 2X Master Mix (U.S. NEB # M0492L)
TCR 5' end linker primer (upstream primer)
TCR C region primer (downstream primer)
Enucleated enzyme water (U.S. Thermo Scientific AM9914G)
The reaction system was prepared according to the following proportions:
the PCR1 reaction program is:
(6) PCR2 (tag PCR). And adding an upper machine joint and a label of an Illumina high-throughput sequencer to a PCR1 product (amplified TCR sequence), and amplifying again to increase more upper machine gene quantity. The method comprises the following specific steps:
reagents used:
q5High-Fidelity 2X Master Mix (U.S. NEB # M0492L)
Tag upstream primer
Label downstream primer
Enucleated enzyme water (U.S. Thermo Scientific AM9914G)
The reaction system was prepared in the following proportions
The PCR2 reaction program is:
and purifying PCR2 products. After the PCR reaction is finished, DNA purification is carried out by using magnetic beads, and the method specifically comprises the following steps:
reagents used:
agencourt AMPure XP Beads (U.S. Beckman # A63882)
The specific purification steps are as follows:
(1) add 80. mu.L of AMPure XP Beads to PCR2 reaction product and mix well.
(2) Incubate at room temperature for 10 minutes.
(3) Place the magnetic bead-PCR 2 product mixture tube on a magnetic rack, wait for all magnetic beads to adsorb on the magnetic rack, pipette off all supernatants, and discard.
(4) Add 150. mu.L 70% ethanol to the beads, incubate for 30 seconds, pipette off all supernatants, and discard.
(5) The fourth step was repeated 2 times.
(6) And opening the test tube cover, waiting for 5 minutes, and allowing the magnetic beads to air dry without any ethanol remaining in the test tube.
(7) The test tube was removed from the magnetic stand, 50. mu.L of the enucleated enzyme water was added thereto, and the suspended magnetic beads were blown by a pipette.
(8) And (4) putting the test tube back to the magnetic frame, and transferring the supernatant into a new test tube after all the magnetic beads are adsorbed on the magnetic frame. The supernatant contained the purified cDNA of the PCR2 product.
(7) High throughput sequencing was performed. Passing the obtained cDNA library through Illumina
Platform (U.S. Illumina public)
Department) was sequenced in PE300 mode and the high throughput sequencing results were analyzed by bioinformatics.
Description of materials and reagents
Patients with T lymphocyte-associated leukemia: the medical college of Yue Zhejiang university was affiliated with a child hospital and informed consent was given to the patients. Specifically, the reagents adopted in the invention are all commercially available products, and the databases adopted in the embodiment of the invention are all public online databases.
Specifically, the reverse transcription 5 ' end linker sequence and primer sequence of the present invention are as follows (5 ' -3 '):
reverse transcription step
TCR 3' oligo (dT) primer:
5’TTTTTTTTTTTTTTTTTTTTGA 3’
TCR 5' Oligo linker:
5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’
PCR1 step
TCR 5' end linker primer:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’
TCR C region primers:
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’
PCR2 step
A label upstream primer:
5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’
a label downstream primer:
5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’
rG ═ RNA nucleotides
In the labeled primerUnderliningThe part is an Illumina sequencing tag sequence, the internal sequence can be replaced by the following table sequence, and when the sequence is used for simultaneously detecting a plurality of samples, sequencing results of the samples are distinguished by using different index1/index2 combinations and bioinformatics algorithms.
Designing a primer: analyzing a linker sequence and a TCR C region gene added at the 5 'end of TCR during RNA reverse transcription, analyzing Primer dimer and stem-loop mismatch by adopting Oligo 7.36 and Primer Premier 6.0, setting an upstream Primer at the TCR 5' end artificial linker, designing a reverse Primer aiming at the downstream of the C gene, and amplifying a TCR full-length transcription subregion sequence, wherein the TCR full-length transcription subregion sequence comprises FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions of TCR.
Example 2
collecting 10 milliliters (mL) of fresh peripheral blood sample, and obtaining relatively pure Peripheral Blood Mononuclear Cells (PBMC) according to the instruction of Ficoll-1077 (Sigma company #10771 in the United states);
the total RNA of PBMC is extracted by Trizol using RNAzol RT (MRC # RN190), and the total RNA obtained is used
2.0Fluorometer (Thermo Fisher Scientific # Q32866, USA), in combination
RNA HS Assay Kit (Thermo Fisher Scientific # Q32852, USA) for determining RNA concentration, and then reverse transcription RNA;
example 3
The embodiment 2 of the invention provides a method for constructing a leukemia minimal residual disease TCR high-throughput sequencing library by adopting a single pair of primers of a leukemia minimal residual disease TCR library, which comprises the following steps:
cDNA to which a TCR 5' terminal linker has been added was obtained using the RNA obtained in example 1 as a template for reverse transcription using the reagents and procedures described in the fourth section of the above "second aspect". Purification of the PCR1, PCR2 and PCR2 products (libraries) was then carried out according to the reagents and procedures described in the fifth, sixth and seventh sections of the above "second aspect".
After the library purification was completed, the purity and size of the library were determined by Agilent 2100Bioanalyzer (Agilent # G2939AA), the Kit used was Agilent DNA 1000Kit (Agilent #5067-1504), the detection results are shown in FIG. 3, the library size is 686bp, the library purity is quite high, and no other non-specifically amplified sequences are observed.
By using
2.0Fluorometer (Thermo Fisher Scientific # Q32866, USA), in combination
The dsDNA HS Assay Kit (Thermo Fisher Scientific # Q32851, USA) measures DNA library concentration and sends it to the company for high throughput sequencing (using Illumina MiSeq, 2. about. 300 pair-end).
After the TCR 5' end linker, primers and library of the invention are constructed, about millions of TCR sequences are obtained by high-throughput sequencing.
Performing bioinformatics analysis on the sequencing result (the bioinformatics analysis adopts Bowtie 2aligner (Ver.2.1.0), and TCR database matching is from the international immune gene information system
www.imgt.org) The results of partial analysis are shown in FIGS. 4 and 5.
Through bioinformatics analysis, the information, the amino acid information, the number and the proportion of each TCR sequence can be accurately known. Through comparison analysis of TCR, the invention obtains the statistical analysis result of representative clone of high-throughput sequencing sequence TCR, the result is shown in figures 4 and 5, and figure 5 shows the combined use condition of recombinant gene V-J of TCR. As can be seen from FIG. 5, it can be seen that, in the millions of TCR sequences obtained by the TCR 5' end linker, PCR primers and sequencing library preparation method of the present invention, it can be determined whether the specific TCR sequence is greater than 10-4(0.01%), whether or not T cells (cancer cells) specific to the cell are greater than 10-4(0.01%) to determine whether the minimal residual disease of the subject is positive or negative (clinical reference value is MRD)>10-4(0.01%) positive, MRD<10-4(0.01%) was negative).
The results show that the primers and the kit are used for detection, so that the constructed TCR library of the leukemia minimal residual disease can cover the diversity information of TCR genes, and the detection rate of low-copy-number T cell clone is improved.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
SEQUENCE LISTING
<110> extra large
<120> primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease
<160>20
<170>PatentIn version 3.3
<210>1
<211>32
<212>DNA
<213> Artificial Synthesis
<220>
<223> TCR 5' Oligo linker
<400>1
atgcatcggatcttcagcatgaacttrgrgrg 32
<210>2
<211>22
<212>DNA
<213> Artificial Synthesis
<220>
<223> TCR 3' oligo (dT) primer
<400>2
<210>3
<211>57
<212>DNA
<213> Artificial Synthesis
<220>
<223> TCR 5' end connector
<400>3
gtctcgtgggctgggcgatgtgtatgagagacagcatgcatcggatcttcagcatga 57
<210>4
<211>62
<212>DNA
<213> Artificial Synthesis
<220>
<223> TCR C region primer
<400>4
tcgtcgccagcgtcggaagtgtataagagacagtcgcagcgtcagatgtgtataagagacag 62
<210>5
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>5
caagcagaagacggcatacgagatatctatcggtctcgtgggctgg 46
<210>6
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>6
caagcagaagacggcatacgagattcaggtgagtctcgtgggctgg 46
<210>7
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>7
caagcagaagacggcatacgagatcactagttgtctcgtgggctgg 46
<210>8
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>8
caagcagaagacggcatacgagatgaattgccgtctcgtgggctgg 46
<210>9
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>9
caagcagaagacggcatacgagatatgtacaagtctcgtgggctgg 46
<210>10
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>10
caagcagaagacggcatacgagatgattcagtgtctcgtgggctgg 46
<210>11
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>11
Caagcagaagacggcatacgagatctgttcgtgtctcgtgggctgg 46
<210>12
<211>46
<212>DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400>12
caagcagaagacggcatacgagattatacggcgtctcgtgggctgg 46
<210>13
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>13
aatgatacggcgaccaccgagatctacactagctacttcgtcgccagcgtc 51
<210>14
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>14
aatgatacggcgaccaccgagatctacacattatagctcgtcgccagcgtc 51
<210>15
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>15
aatgatacggcgaccaccgagatctacaccccgtacttcgtcgccagcgtc 51
<210>16
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>16
aatgatacggcgaccaccgagatctacacgggtataatcgtcgccagcgtc 51
<210>17
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>17
aatgatacggcgaccaccgagatctacacagcaggtgtcgtcgccagcgtc 51
<210>18
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>18
aatgatacggcgaccaccgagatctacactatacgtatcgtcgccagcgtc 51
<210>19
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>19
aatgatacggcgaccaccgagatctacaccacctagttcgtcgccagcgtc 51
<210>20
<211>51
<212>DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400>20
aatgatacggcgaccaccgagatctacacgttgctactcgtcgccagcgtc 51
Claims (6)
1. A primer combination applied to high-throughput sequencing detection of T cell leukemia minimal residual disease is characterized in that: the primer combination comprises a TCR5 'Oligo joint, a TCR 3' Oligo (dT) primer, a TCR C region primer and a label upstream and downstream primer, wherein each primer sequence is as follows:
a TCR 5' Oligo linker having the base sequence: 5 'ATGCATCGGTATTCAGCATGAACTTrGrGrG 3';
TCR 3' oligo (dT) primer: 5 'TTTTTTTTTTTTTTTTTTTTGA 3';
the primer sequence of the TCR 5' end connector is as follows:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
the primer sequence of the TCR C region is as follows:
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
a label upstream primer: 5 'CAAGCAGAAGACGGCATACGAGAT [ index1] GTCTCGTGGGCTGG 3';
a label downstream primer: 5 'AATGATACGGCGACCACCGAGATCTACAC [ index2] TCGTCGCCAGCGTC 3'.
2. The primer combination for detecting T-cell leukemia minimal residual disease by high-throughput sequencing according to claim 1, wherein: the index1 is one of ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA, GATTCAGT, CTGTTCGT or TATACGGC; index2 is one of TAGCTACT, ATTATAGC, CCCGTACT, GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT, or GTTGCTAC.
3. A kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease is characterized in that: the kit contains the primer combination according to claim 1 or 2.
4. The kit for detecting T cell leukemia minimal residual disease by high-throughput sequencing according to claim 3, wherein: the kit also comprises PCR buffer solution, Q5High-Fidelity 2X Master Mix, enucleated enzyme water, AMPure XP Beads and 70% ethanol.
5. The kit for detecting T-cell leukemia minimal residual disease by high-throughput sequencing according to claim 4, wherein: the kit comprises:
(1) PCR buffer solution: 9.5 mu L;
(2) positive control RNA (1. mu.g/. mu.l): 10 mu L of the solution;
(3)10 μ M TCR 3' oligo (dT) primer: 1.1 μ L;
(4)10 μ M TCR 5' end linker primer and 10 μ M TCR C region primer: 1.1. mu.L each;
(5)Q5 High-Fidelity 2X Master Mix：55μL；
(6)10 μ M tag upstream primer and 10 μ M tag downstream primer: 1.1. mu.L each;
(7) enucleated enzyme water: 105 mu L of the solution;
(8)AMPure XP Beads：88μL；
(9) 70% ethanol: 165. mu.L.
6. The kit for high-throughput detection of T-cell leukemia minimal residual disease according to claim 4 or 5, which is characterized in that: the PCR buffer consists of the following systems:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204857.0A CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204857.0A CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106957906A CN106957906A (en) | 2017-07-18 |
| CN106957906B true CN106957906B (en) | 2020-04-28 |
Family
ID=59481586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611204857.0A Active CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106957906B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949909A (en) * | 2018-07-17 | 2018-12-07 | 厦门生命互联科技有限公司 | A kind of blood platelet nucleic acid library construction method and kit for genetic test |
| CN109680062B (en) * | 2018-12-18 | 2022-12-02 | 杭州艾沐蒽生物科技有限公司 | Method for detecting minimal residual disease MRD |
| CN111363783B (en) * | 2018-12-26 | 2024-01-02 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on specific recognition sequence |
| WO2021037971A1 (en) * | 2019-08-27 | 2021-03-04 | Fundación Para La Investigación Biomédica Del Hospital Universitario 12 De Octubre | Method for determining the presence or absence of minimal residual disease (mrd) in a subject who has been treated for a disease |
| CN111261226B (en) * | 2020-03-12 | 2020-10-27 | 江苏先声医学诊断有限公司 | NGS-based automatic sequencing analysis method and device for minimal residual lesions |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063032A (en) * | 2015-08-14 | 2015-11-18 | 深圳市瀚海基因生物科技有限公司 | Multiple PCR primers and method for constructing leukemia minimal residual disease BCR library based on high-flux sequencing |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
-
2016
- 2016-12-23 CN CN201611204857.0A patent/CN106957906B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063032A (en) * | 2015-08-14 | 2015-11-18 | 深圳市瀚海基因生物科技有限公司 | Multiple PCR primers and method for constructing leukemia minimal residual disease BCR library based on high-flux sequencing |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
Non-Patent Citations (3)
| Title |
|---|
| Next generation sequencing for TCR repertoire profiling: Platform-specific features and correction algorithms;Dmitry A. Bolotin等;《Eur. J. Immunol》;20121130;3073-3083 * |
| Quantitative T cell repertoire analysis by deep cDNA sequencing of T cell receptor α and β chains using next-generation sequencing (NGS);Hua Fang等;《OncoImmunology》;20141126;e968467 * |
| Ｔ细胞TCR CDR３受体库的高通量测序分析概况;王鹏等;《现代免疫学》;20111130;512-516 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106957906A (en) | 2017-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957906B (en) | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease | |
| CN106755410B (en) | Method for simultaneously detecting T cell and B cell immune repertoire based on high-throughput sequencing | |
| Turchaninova et al. | High-quality full-length immunoglobulin profiling with unique molecular barcoding | |
| Wang et al. | Single cell sequencing: a distinct new field | |
| CN105087789B (en) | A method of BCR and TCR immune groups library in detection blood plasma cfDNA | |
| US20200248175A1 (en) | Calling genetic variation from single-cell transcriptomes | |
| US20170204460A1 (en) | System and Methods for Massively Parallel Analysis of Nucleic Acids in Single Cells | |
| Mori et al. | Next generation sequencing: new tools in immunology and hematology | |
| JP2018514205A (en) | Prediction method of rejection of organ transplantation using next-generation nucleotide sequence analysis technique | |
| US20220119881A1 (en) | Systems and methods for sample preparation, sample sequencing, and sequencing data bias correction and quality control | |
| CA2824854A1 (en) | Immunodiversity assessment method and its use | |
| WO2013192570A1 (en) | System and methods for genetic analysis of mixed cell populations | |
| CN112852936A (en) | Method for analyzing sample lymphocyte or plasma cell by using immune repertoire sequencing method, application and kit thereof | |
| JP2021526791A (en) | Methods and systems for determining the cellular origin of cell-free nucleic acids | |
| CN112567081A (en) | Compositions and methods for assessing genomic alterations | |
| CN109593758B (en) | Multiplex primer set and method for constructing human B cell immune repertoire based on high-throughput sequencing by using same | |
| Osman et al. | Importance of extended blood group genotyping in multiply transfused patients | |
| WO2020110127A1 (en) | Methods of activating dysfunctional immune cells and treatment of cancer | |
| CN107058484B (en) | Primer combination and kit applied to high-throughput sequencing and simultaneous detection of T cell and B cell immune repertoire | |
| CN106957905B (en) | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect | |
| WO2021248034A2 (en) | Methods of detecting mitochondrial diseases | |
| CN106282361B (en) | Gene capturing kit for capturing genes related to blood diseases | |
| KR20220118295A (en) | High Throughput Single Cell Libraries, and Methods of Making and Using the Same | |
| WO2019183582A1 (en) | Immune repertoire monitoring | |
| CN106978479A (en) | A kind of method that T cell Minimal Residual Disease of Leukemia is detected based on high-flux sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200810 Address after: Room 103-8, building 7, Chuangzhi Green Valley Development Center, 788 HONGPU Road, Jianggan District, Hangzhou City, Zhejiang Province Patentee after: HANGZHOU IMMUQUAD BIOTECHNOLOGIES, LLC Address before: 610072 No. 1, unit 2, building 91, Daqing Road, Qingyang District, Sichuan, Chengdu, 10 Patentee before: Sun Tao |