CN106957905B - Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect - Google Patents
Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect Download PDFInfo
- Publication number
- CN106957905B CN106957905B CN201611202309.4A CN201611202309A CN106957905B CN 106957905 B CN106957905 B CN 106957905B CN 201611202309 A CN201611202309 A CN 201611202309A CN 106957905 B CN106957905 B CN 106957905B
- Authority
- CN
- China
- Prior art keywords
- tcr
- primer
- cells
- rna
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70521—CD28, CD152
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Abstract
The invention belongs to the field of molecular biology detection, and particularly relates to a molecular detection method, a primer composition and a kit for evaluating tumor immunotherapy effect, wherein 10mL of a human blood sample is obtained in an EDTA anticoagulant tube, separation of peripheral blood mononuclear cells is performed by using lymphocyte separation liquid Ficoll-1077, the expression quantity of CD8+ T cell PD-1 molecules is detected by using a flow cytometer, CD8+ T cells are separated by using the flow cytometer, total RNA of the CD8+ T cells is extracted by using a Trizol method, the used reagent is RNAzol RT, reverse transcription of RNA is converted into cDNA, and meanwhile, a joint is added at the 5' end of the cDNA; PCR1, PCR2 and purification and high throughput sequencing steps, by RNA 5' end joint upstream primer to T cell receptor gene (TCR) C region downstream primer, get TCR gene sequence full-length information.
Description
Technical Field
The invention belongs to the field of molecular biological detection, and particularly relates to a molecular detection method, a primer composition and a kit for evaluating the tumor immunotherapy effect.
Background
Cancer immunotherapy is another cancer treatment method with definite effect on treating cancer after surgery, radiotherapy and chemotherapy, and it is a direction for future cancer treatment development by activating the human body's own immune system to resist and kill tumor cells.
Different patients will show different information using different immunotherapies, which requires specific immune system assessments of cancer immunotherapy patients to monitor the effectiveness of cancer immunotherapy.
Such as PD-1 antibody, is a tumor therapy which is currently attracting attention and is widely concerned, and is also tumor immunityThe major forces in epidemic therapy. The action mechanism of PD-1 immunotherapy is to design specific protein antibodies against PD-1 or PD-L1, prevent the recognition process of PD-1 and PD-L1, and partially recover cytotoxic T cells with antigen specificity (CD 8)+T-cell) so that it can kill tumor cells. Flow Cytometry (FC), a widely used instrument that rapidly performs multiparameter assays on homogenized cell samples, allows the assay of CD8 by FC+Expression level of PD1 in T cells. By comparing the expression of PD-1 on T cells before and after treatment, we can determine whether the PD-1 antibody drug has an effect on the patient.
The large number of V (variable region), D (variable region), J (joining region) gene segments at the T cell locus will produce a variety of recombinations in the formation of T cell receptors. This recombination of the V-D-J genes confers on each T cell its own unique T Cell Receptor (TCR), thereby enabling the sequence of each TCR to be effectively a unique biomarker for one T cell clone. Therefore, sequencing the sequence composition of T cell TCR gene can well locate each T cell. Detection of CD8 by TCR sequencing, a molecular detection method+Diversity status and clonality of T cells. Low diversity means that a person has less immune diversity of T cells, and this immune state generally has a higher infection rate and a high mortality rate, and reflects a lower ability to resist various diseases and to be cured, and also has a higher T cell clonal proliferation. Conversely, if the T cell diversity is higher, it indicates that the immune system is more competent to fight the foreign disease, since high T cell polymorphisms may prevent "antigen escape". And by comparing the T cell polymorphism and clonality before and after treatment, it is judged whether the immune system of the patient is activated by immunotherapy.
Cancer immunotherapy efficacy monitoring can provide a rapid, non-invasive assessment of the immune system for a patient. And can help medical workers and cancer patients to predict the effect of cancer immunotherapy in early stage, so that patients can select a treatment means more effectively in the fight against cancer, and the waste of time and money for treating cancer patients is avoided.
Disclosure of Invention
To solve the above technical problem, a molecular assay for evaluating the effect of tumor immunotherapy is carried out by targeting active CD8+Detecting PD-1 molecules of T cells and carrying out high-throughput sequencing to construct a TCR library of the T cells, a constructed cDNA joint and a single pair of primers, and a library preparation method, wherein polymorphism and clonality of the TCR are obtained from an upstream primer of the joint to a downstream primer of a C region.
The invention for solving the technical problems is a molecular detection method for evaluating the tumor immunotherapy effect, which is characterized in that: the method comprises the following steps:
firstly, obtaining 10mL of human blood sample in an EDTA anticoagulant tube;
(II) separating Peripheral Blood Mononuclear Cells (PBMC) by using lymphocyte separating medium Ficoll-1077 (Sigma company #10771 in the United states);
the lymphocyte separating medium is useful for separating lymphocytes from whole blood because T cells are the subject of our assay, T cells are a kind of lymphocytes, and RNA obtained from the separated cell population is RNA from which cells such as red blood cells and platelets are removed. Therefore, the total RNA contained T cell RNA template used for library construction has higher purity.
(III) detection of CD8 by flow cytometry+Expression level of a T cell PD-1 molecule; the antibodies used were: anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB (Biolegend, USA, anti-CD8 FITC, # 300906; anti-CD3 APC, # 300312; PD-1, # 329906; 4-1BB, #309820.)
An ice-on-ice operation step:
resuspend the cell pellet with 80. mu.L of stabilizing buffer (10)6A cell).
Control tubes (5 1.5mL tubes) were prepared simultaneously:
1) a blank tube was filled with 95. mu.L of stabilizing buffer (PBS + 5% FBS, Gibco # 26140079, USA) as an unstained isotype control, and the remaining control tubes were filled with 90. mu.L of stabilizing buffer as a single stain control, and 5. mu.L of cell suspension was added to each tube.
2) 5uL of anti-CD3, anti-CD8, anti-PD1, and anti-4-1BB antibody (Bioleged, USA, anti-CD8 FITC, # 300906; anti-CD3 APC, # 300312; PD-1, # 329906; 4-1BB, # 309820.).
As in table 1 below:
TABLE 1
Sample staining:
an antibody cocktail (5. mu.L each of anti-CD3, anti-CD8, anti-PD1, and anti-4-1BB in a single sample) was prepared, and the antibody cocktail (20. mu.L) was added to the sample and gently mixed.
As in table 2 below:
TABLE 2
| Sample1 | Sample2 | Sample3 | Sample4 | |
| Cell suspension (μ L) | 80 | 80 | 80 | 80 |
| CD3+CD8+PD1+4-1BB(μL) | 20 | 20 | 20 | 20 |
| Total volume (μ L) | 100 | 100 | 100 | 100 |
Ice-bath for 25min in the dark.
Wash with 200. mu.L stationary buffer and centrifuge at 1500rpm for 10 min.
Discard the supernatant and add 200. mu.L of stabilizing buffer to wash again.
Cells were resuspended with 300. mu.L of stabilizing buffer and transferred to FACS tubes. Placing on ice and protecting from light, and sending to sample machine for FACS detection of CD3+CD8+4-1BB+PD-1 expression level of the cells.
(IV) separation of CD8 Using flow cytometry+A T cell;
(V) CD8 is extracted by using Trizol method+Total RNA of T cells using RNAzol RT (MRC # RN190, usa);
the Trizol method comprises the following specific steps:
the cells were harvested, transferred to a 1.5ml centrifuge tube, added to 1ml Trizol, mixed well and allowed to stand at room temperature for 5 min.
0.2ml of chloroform was added thereto, and the mixture was shaken for 15 seconds and allowed to stand for 2 min.
0.5ml of isopropanol was added, the liquid in the tube was gently mixed and allowed to stand at room temperature for 10 min.
Centrifugation is carried out at 4 ℃ for 12000g × 10min, and the supernatant is discarded.
1ml of 75% ethanol was added and the precipitate was washed gently. Centrifuge at 4 ℃ for 7500g × 5min, discard the supernatant.
Air-drying, adding 50ul DEPC H2O, and dissolving to obtain total RNA of lymphocyte.
(VI) reverse transcribing the RNA into cDNA, and simultaneously adding a joint at the 5 'end of the cDNA for 5' end primer combination in the subsequent PCR amplification;
addition of the linker simultaneously during reverse transcription minimizes loss of RNA during the multi-step reaction. RNA has extremely poor stability in operation and is very easy to degrade, a small number of steps can reduce degradation to the maximum extent, and simultaneously, the preparation time of cDNA which can be used for amplification is saved.
The linker is the nucleic acid linker at the 5 'end of the cDNA, referred to below as "TCR 5' Oligo linker".
(VII) PCR1, namely amplifying the recombinant TCR cDNA by a single primer pair mode;
(eight) PCR2 and purification: adding an upper machine joint and a label of an Illumina high-throughput sequencer to a PCR1 product (amplified TCR sequence), and amplifying more upper machine gene quantity again; after the PCR reaction, DNA was purified using magnetic beads.
The PCR product generally contains an excess of primers, Taq DNase and dNTPs. The existence of the components directly influences the subsequent library quality detection, sequencing reaction and other processes, and the purification can remove the byproducts influencing the subsequent experiments. Meanwhile, the purification process is a process of screening the size of the fragment, the DNA fragment in the invention is about 700bp, magnetic beads with different volumes can be used for mixing with PCR products, the different volume ratios of the magnetic beads to the DNA can adsorb the fragments with different sizes, the wrong (error) fragment and primer dimer during PCR amplification can be successfully removed by using the volume of the magnetic beads, so that the sequencing on computer library only has the sequencing target DNA fragment, the sequencing result is more accurate, and the error is reduced.
As shown in FIG. 3, only one peak of the fragment was found by quality inspection of the library.
(nine) carrying out high-throughput sequencing: sequencing the obtained cDNA library by an IlluminaMiSeq platform, wherein the sequencing mode is PE300, and analyzing a high-throughput sequencing result by bioinformatics; the sequencing mode PE300 was chosen, the library denaturation concentration was 2nM, and the loading concentration was 20 pM.
Clonal changes in clonal populations of greater than 10% before and after treatment of the control patient. To see if the same clonal population of T cells proliferated more clonally after immunotherapy. If any, it indicates that immunotherapy plays a role in its immune system.
In the step (VI), the concrete steps are as follows:
each RNA sample was mixed in the following ratio:
the reagent volume was 1X (μ L),
TCR 3' oligo (dT) primer (10. mu.M) 1,
incubate at 72 ℃ for 3 minutes, followed by 4 ℃ for 1 minute; a PCR reaction buffer was prepared.
The mixed PCR reaction buffer with RNA sample, initiates cDNA reverse transcription according to the following reaction procedure:
60 minutes at 42 ℃; 10 minutes at 70 ℃; permanent at 4 ℃.
The PCR reaction buffer solution:
in the step (VII), preparing a reaction system according to the following proportion:
the PCR1 reaction program is:
3 minutes at 95 ℃; 30 seconds at 95 ℃; 1 minute at 65 ℃ and 25 cycles; 1 minute at 72 ℃; permanent at 4 ℃. In the step (eight), a reaction system is prepared according to the following proportion:
the PCR2 reaction program is:
3 minutes at 94 ℃; 30 seconds at 94 ℃; 30 seconds at 55 ℃ and 15 cycles; 20 minutes at 72 ℃,1 minute at 72 ℃ and permanent at 4 ℃.
In the step (eight), the specific purification steps are as follows:
adding 80 mu LAMPure XP Beads into a PCR2 reaction product, and uniformly mixing;
(II) incubating for 10 minutes at room temperature;
thirdly, placing the magnetic bead-PCR 2 product mixture test tube on a magnetic rack, sucking all supernatant by a liquid-moving machine after all the magnetic beads are adsorbed on the magnetic rack, and discarding;
(IV) adding 150. mu.L of 70% ethanol on the magnetic beads, incubating for 30 seconds, sucking all supernatant by using a pipette, and discarding;
(V) repeating the fourth step for 2 times;
sixthly, opening a test tube cover, waiting for 5 minutes, and air-drying the magnetic beads until no ethanol is left in the test tube;
seventhly, taking the test tube down from the magnetic frame, adding 50 mu L of enucleated enzyme water, and blowing and beating the suspended magnetic beads by using a pipette;
(eight) the tube is returned to the magnetic rack, and after all the magnetic beads are adsorbed to the magnetic rack, the supernatant is transferred to a new tube, and the purified PCR2 product is contained in the supernatant.
The invention relates to a molecular detection primer composition for evaluating the tumor immunotherapy effect, which is characterized by comprising the following components in percentage by weight: the primer composition comprises a TCR 3 'Oligo (dT) primer, a TCR 5' Oligo joint, a TCR C region primer and a label upstream and downstream primer;
wherein the sequence of each primer is as follows:
TCR 3' oligo (dT) primer: 5 'TTTTTTTTTTTTTTTTTTTTGA 3';
TCR 5' Oligo linker: 5 'ATGCATCGGTATTCAGCATGAACTTrGrGrG 3';
TCR 5' end linker primer:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C region primers:
5’ TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
a label upstream primer: 5'CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’；
A label downstream primer: 5'AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’。
Wherein the index1 is one of ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA, GATTCAGT, CTGTTCGT or TATACGGC; index2 is one of TAGCTACT, ATTATAGC, CCCGTACT, GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT, or GTTGCTAC.
The invention relates to a molecular detection kit for evaluating the tumor immunotherapy effect, which is characterized in that: the kit contains the primer combination.
The kit also comprises PCR buffer solution, Q5High-Fidelity 2X Master Mix, enucleated enzyme water, AMPure XP Beads and 70% ethanol.
The primer combination of the invention can effectively amplify the complete sequence of the TCR gene. The construction efficiency of the TCR next-generation sequencing library is high, the kit provides a simple and convenient use method for users, and the efficiency is stable.
The invention is based on a flow cytometry technology and a high-throughput sequencing technology, and a library construction method of TCR sequencing single-pair primers is used for obtaining CD8+After T cell RNA, a joint is added to the 5 'end of cDNA while reverse transcription from RNA to cDNA is carried out, so that a TCR amplification upstream primer is designed through the joint with a known sequence, and a downstream primer is designed by matching with a C region gene (invariant region) at the 3' end of a TCR gene, thereby achieving the purpose of amplifying the whole TCR sequence full-length gene.
The CD8 is detected in the invention+Expression level of PD-1 molecule and CD8 in T cells+The polymorphism and clonality of T cells are used to judge the immunotherapy effect of tumor patients. There are no other methods available to evaluate the effectiveness of tumor immunotherapy.
The present invention provides a method as defined in the first aspectThe cDNA linker and the single pair of PCR primers for constructing the TCR library based on the high-throughput sequencing or the construction method for constructing the TCR library based on the high-throughput sequencing of the second aspect is used for detecting CD8+Use of T cell polymorphisms and clonality.
The invention provides a joint for constructing a TCR library based on high-throughput sequencing, and the primers and the method have the beneficial effects that: obtaining a human TCR whole transcriptome sequence; 2. human specific CDR1, CDR2, and CDR3 sequences were obtained; the polymorphism and clonality of human T cells were obtained as a basis for evaluating the efficacy of tumor immunotherapy.
On the basis of a high-throughput sequencing platform, comprehensive bioinformatics analysis is carried out on the sequencing result of the human TCR gene, so that the gene preference, VDJ gene combination information, TCR clone variety information, TCR diversity information, nucleic acid sequence and amino acid sequence information of CDR1, CDR2 and CDR3, mutation information on the gene and the like of the TCR during VDJ recombination are obtained. It is these factors that create a vast and diverse repertoire of TCRs.
Provides detailed bioinformatics data analysis after sequencing, provides effective quality monitoring for the whole experiment, and can reduce experiment errors and mistakes to the greatest extent. By sequencing and evaluating the TCR, the early prediction of the cancer immunotherapy effect of medical workers and cancer patients can be rapidly and non-invasively assisted, so that the patients can more effectively select a therapy means in the fight against the cancer, and the waste of time and money for treating the cancer patients is avoided.
By simply taking a blood sample, CD8 was measured on the subject using a flow cytometer+Molecular analysis of T cell surface protein (PD-1), secondary sequencing of T cell receptor gene and clinical analysis of bioinformatics to obtain PD-1 expression level and CD8+T cell polymorphism and clonality, thereby providing a stress condition of the current immune system to tumor immunotherapy and evaluating the effect of the immunotherapy.
Drawings
FIG. 1 schematic diagram of reverse transcribed cDNA of RNA of the present invention
FIG. 2 is a schematic diagram of the amplification of TCR cDNA by two PCR and the addition of sequencing machine adaptor in the present invention
FIG. 3 shows the quality inspection results of the sequencing library of the present invention.
FIG. 4 shows the bioinformatics analysis and alignment of the sequencing results of the TCR of the invention to find out the information (part) of each sequence
FIG. 5 is a 3D forest plot of TCR sequencing results according to the invention. Displaying the diversity and clonality of the subject's TCR, each bar representing a TCR clone, the clonally proliferated TCR representing the proliferation of leukemia cancer cells, the proliferated TCR sequence serving as a biomarker for the immunotherapy effect, and comparing the uniform clones after treatment to see if there is more clonality proliferation.
FIG. 6 shows the change of PD-1 of T cells before and after immunotherapy with PD-1 antibody drug for tumor patients in accordance with the present invention.
FIG. 7 is a graph showing the change in T cell clonality before and after immunotherapy with PD-1 antibody drug in tumor patients in accordance with the present invention. (X-axis: V Gene; Y-axis: J Gene; Z-axis: TcR clone number)
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, and the following primers were synthesized by Invitrogen, usa:
example 1
The primer composition and the kit are applied to molecular detection for evaluating the tumor immunotherapy effect based on high-throughput sequencing, and the method comprises the following steps:
firstly, obtaining 10mL of human blood sample in an EDTA anticoagulant tube;
(II) separating Peripheral Blood Mononuclear Cells (PBMC) by using lymphocyte separating medium Ficoll-1077 (Sigma company #10771 in the United states);
(III) separation of CD8 Using flow cytometry+A T cell; the antibodies used were: anti-CD3, anti-CD8 and anti-4-1BB (Biolegend, Inc., anti-CD8 FITC, # 300906; anti-CD3 APC, # 300312; PD-1, # 329906; 4-1BB, #309820.)
(IV) CD8 is extracted by using Trizol method+Total RNA of T cells using RNAzol RT (America)National MRC company # RN 190);
(V) reverse transcription of RNA into cDNA, and adding a joint at the 5 'end of the cDNA for 5' end primer combination in the following PCR amplification, wherein the specific steps are as follows, and the reagents are used:
TCR 3' oligo (dT) primer (10. mu.M)
5 Xreverse transcription buffer (250mM Tris-HCl (pH 8.3),375mM KCl,15mM MgCl2)
Dithiothreitol, DTT (20mM) U.S. Thermo Scientific # R0861
dNTP Mix (10mM) U.S. Invitrogen #18427088
RNAse Out (40U/. mu.L) U.S. Invitrogen #10777019
TCR 5' Oligo linker (10. mu.M)
Superscript II RT (200U/. mu.L) U.S. Invitrogen #18064022
Each RNA sample was mixed in the following ratio:
| reagent | Volume 1X (μ L) |
| |
8 |
| TCR 3' oligo (dT) primer (10. mu.M) | 1 |
Incubate at 72 ℃ for 3 minutes, followed by 4 ℃ for 1 minute.
PCR reaction buffer was prepared in the following proportions
| Reagent | Volume 1X (μ L) |
| 5X reverse transcription buffer solution | 3.5 |
| DTT(20mM) | 1 |
| dNTP(10mM) | 1 |
| RNAse Out | 1 |
| TCR 5' Oligo linker (10. mu.M) | 1 |
| |
1 |
Mix the PCR buffer with the RNA sample and begin reverse transcription of cDNA according to the following reaction protocol
60 minutes at 42 DEG C
10 minutes at 70 DEG C
Permanent at 4 deg.C
After the reaction is completed, the total cDNA to which the linker has been added at the 5' end can be obtained (see the figure)
(VI) PCR 1. The recombinant TCR cDNA is amplified by a single-pair primer mode, and the specific steps are as follows:
reagents used:
q5High-Fidelity 2X Master Mix (U.S. NEB # M0492L)
TCR 5' end linker primer (upstream primer)
TCR C region primer (downstream primer)
Enucleated enzyme water (U.S. Thermo Scientific AM9914G)
The reaction system was prepared according to the following proportions:
the PCR1 reaction program is:
(VII) PCR2 (tag PCR). And adding an upper machine joint and a label of an Illumina high-throughput sequencer to a PCR1 product (amplified TCR sequence), and amplifying again to increase more upper machine gene quantity. The method comprises the following specific steps:
reagents used:
q5High-Fidelity 2X Master Mix (U.S. NEB # M0492L)
Tag upstream primer
Label downstream primer
Enucleated enzyme water (U.S. Thermo Scientific AM9914G)
The reaction system was prepared according to the following proportions:
the PCR2 reaction program is:
(eight) PCR2 product purification. After the PCR reaction is finished, DNA purification is carried out by using magnetic beads, and the method specifically comprises the following steps:
reagents used:
AgencourtAmpure XP Beads (U.S. Beckman # A63882)
The specific purification steps are as follows:
1. 80 mu of LAMPure XP Beads are added into a PCR2 reaction product and mixed evenly.
2. Incubate at room temperature for 10 minutes.
3. Place the magnetic bead-PCR 2 product mixture tube on a magnetic rack, wait for all magnetic beads to adsorb on the magnetic rack, pipette off all supernatants, and discard.
4. Add 150. mu.L 70% ethanol to the beads, incubate for 30 seconds, pipette off all supernatants, and discard.
5. The fourth step was repeated 2 times.
6. And opening the test tube cover, waiting for 5 minutes, and allowing the magnetic beads to air dry without any ethanol remaining in the test tube.
7. The test tube was removed from the magnetic stand, 50. mu.L of the enucleated enzyme water was added thereto, and the suspended magnetic beads were blown by a pipette.
8. And (4) putting the test tube back to the magnetic frame, and transferring the supernatant into a new test tube after all the magnetic beads are adsorbed on the magnetic frame. The supernatant contained the purified PCR2 product.
(nine) high throughput sequencing was performed. Passing the obtained cDNA library through
The platform (Illumina, USA) performs sequencing in a PE300 sequencing mode, and analyzes high-throughput sequencing results through bioinformatics.
Description of materials and reagents
Squamous cell lung carcinoma patients: the source Henan province people hospital; tumor immunotherapy drugs: keytruda, an American Shadong PD-1 inhibitor; the patients gave informed consent. Specifically, the reagents adopted in the invention are all commercially available products, and the databases adopted in the embodiment of the invention are all public online databases.
Specifically, the reverse transcription 5 ' end linker sequence and primer sequence of the present invention are as follows (5 ' -3 '):
reverse transcription step
TCR 3' oligo (dT) primer:
5’TTTTTTTTTTTTTTTTTTTTGA 3’
TCR 5' Oligo linker:
5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG3’
PCR1 step
TCR 5' end linker primer:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’
TCR C region primers:
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’
PCR2 step
A label upstream primer:
5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’
a label downstream primer:
5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’
rG ═ RNA nucleotides
In the labeled primerUnderliningThe part is an Illumina sequencing tag sequence, the internal sequence can be replaced by the following table sequence, and when the sequence is used for simultaneously detecting a plurality of samples, sequencing results of the samples are distinguished by using different index1/index2 combinations and bioinformatics algorithms.
Designing a primer: analyzing a joint sequence and a TCR C region gene added at the 5 'end of TCR during RNA reverse transcription, analyzing Primer dimer and stem-loop mismatch by adopting Oligo 7.36 and Primer Premier 6.0, setting an upstream Primer at the 5' end of TCR in an artificial joint, designing a reverse Primer aiming at the downstream of C gene, and amplifying a TCR full-length transcription region sequence, wherein the sequences comprise FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions of TCR.
Example 2
collecting 10 milliliters (mL) of fresh peripheral blood sample, and obtaining relatively pure Peripheral Blood Mononuclear Cells (PBMC) according to the instruction of Ficoll-1077 (Sigma company #10771 in the United states);
total RNA of CD8+ T cells was extracted by Trizol using RNAzol RT (MRC # RN190, USA), and the obtained total RNA was used
2.0Fluorometer (Thermo Fisher Scientific # Q32866, USA), in combination
RNA HS Assay Kit (Thermo Fisher Scientific # Q32852, USA) for determining RNA concentration, and then reverse transcription RNA;
example 3
The embodiment 2 of the invention provides a molecular detection method for evaluating the tumor immunotherapy effect, which comprises the following steps:
detection of CD8 using flow cytometry+Expression level of a T cell PD-1 molecule; the antibodies used were: anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB (Biolegend, USA, anti-CD8 FITC, # 300906; anti-CD3 APC, # 300312; PD-1, # 329906; 4-1BB, #309820.)
The method comprises the following specific steps:
and (3) performing operation on ice:
resuspend the cell pellet with 80. mu.L of stabilizing buffer (10)6A cell).
Control tubes (5 1.5mL tubes) were prepared simultaneously:
1) in a blank tube, 95. mu.L of stabilizing buffer was added as an isotype control without staining, and in the remaining control tubes, 90. mu.L of stabilizing buffer was added as a single staining control, and 5. mu.L of cell suspension was added to each tube.
2) 5uL of anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB antibody were added to the single-stain control tubes, respectively.
As in table 3 below:
TABLE 3
Sample staining:
an antibody cocktail (5. mu.L each of anti-CD3, anti-CD8, anti-PD1, and anti-4-1BB in a single sample) was prepared, and the antibody cocktail (20. mu.L) was added to the sample and gently mixed.
As in table 4 below:
TABLE 4
| Sample1 | Sample2 | Sample3 | Sample4 | |
| Cell suspension (μ L) | 80 | 80 | 80 | 80 |
| CD3+CD8+PD1+4-1BB(μL) | 20 | 20 | 20 | 20 |
| Total volume (μL) | 100 | 100 | 100 | 100 |
Ice-bath for 25min in the dark.
Wash with 200. mu.L stationary buffer and centrifuge at 1500rpm for 10 min.
Discard the supernatant and add 200. mu.L of stabilizing buffer to wash again.
Cells were resuspended with 300. mu.L of stabilizing buffer and transferred to FACS tubes. Placing on ice and protecting from light, and sending to sample machine for FACS detection of CD3+CD8+4-1BB+PD1 expression level of the cell.
CD3 before and after comparative treatment+CD8+4-1BB+Change in PD1 expression levels in cells, as shown in fig. 6: after treatment, peripheral blood CD3+The number of T cells increased 5-fold relative to pre-treatment. CD8+The percentage of T cells (cytotoxic T cells) to total T cells also increased, and the percentage to total lymphocytes increased from 3.26% to 18.11% before treatment. Toxic T cells expressing PD1 also decreased from 99.9% to 43.3% before treatment. Thus, the PD-1 antibody drug immunotherapy method plays a certain role in inhibiting T cell apoptosis.
Using the RNA obtained in example 1 as a template for reverse transcription, cDNA to which a TCR 5' terminal linker was added was obtained according to the reagents and procedures described in the sixth section of the above "second aspect". The PCR1, PCR2 (tag PCR) and PCR2 products (library) were purified according to the reagents and procedures described in the seventh and eighth sections of the above "second aspect".
After the library purification was completed, the purity and size of the library were determined by Agilent 2100Bioanalyzer (Agilent # G2939AA), the Kit used was Agilent DNA 1000Kit (Agilent #5067-1504), and the results are shown in FIG. 3, where the library size was about 738bp, the purity of the library was quite high, and no other non-specifically amplified sequences were observed.
By using
2.0Fluorometer (Thermo Fisher Scientific # Q32866, USA), in combination
The dsDNA HS Assay Kit (Thermo Fisher Scientific # Q32851, USA) measures DNA library concentration and sends it to the company for high throughput sequencing (using IlluminaMiSeq, 2. about. 300 pair-end).
After the TCR 5' end linker, primers and library of the invention are constructed, about millions of TCR sequences are obtained by high-throughput sequencing.
Sequencing results bioinformatics analysis (the bioinformatics analysis adopts Bowtie 2aligner (Ver. 2.1.0), and TCR database matching is from the international immune gene information system
www.imgt.org), partial analysis alignment results are shown in FIGS. 4 and 5.
Through bioinformatics analysis, the information, the amino acid information, the number and the proportion of each TCR sequence can be accurately known. Through TCR comparative analysis, the invention obtains the statistical analysis result of the representative clone of the high-throughput sequencing sequence TCR, the result is shown in figures 4 and 5, and figure 5 is a visual diagram of the recombinant gene V-J combination use condition, T cell polymorphism and clonality of the TCR. As can be seen from FIG. 7, the CD8 of the subjects can be suggested from the millions of TCR sequences obtained by the TCR 5' linker, PCR primers and sequencing library preparation method of the present invention+The T cells still exist after the treatment with the T cell population with clonal proliferation appeared before the treatment, wherein the largest and the second largest clonal proliferation T cell populations respectively grow from 16.02% to 28.01% and 10.65% to 13.74% before the treatment, which indicates that the PD-1 antibody drug inhibits the apoptosis of CD8+ T cells capable of recognizing tumor cells and provides help for the immune system to effectively eliminate the tumor cells.
The results show that the method for constructing the TCR library can cover the diversity information of TCR genes, improve the detection rate of low copy number T cell clone, and can be used for evaluating the effect of tumor immunotherapy by using the detection result of PD-1 expression quantity of a flow cytometer and the clonality result of T cells.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
SEQUENCE LISTING
<110> extra large
<120> molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 32
<212> DNA
<213> Artificial Synthesis
<220>
<223> TCR 5' Oligo linker
<400> 1
atgcatcggatcttcagcatgaacttrgrgrg 32
<210> 2
<211> 22
<212> DNA
<213> Artificial Synthesis
<220>
<223> TCR 3' oligo (dT) primer
<400> 2
ttttttttttttttttttttga 22
<210> 3
<211> 57
<212> DNA
<213> Artificial Synthesis
<220>
<223> TCR 5' end connector
<400> 3
<210> 4
<211> 62
<212> DNA
<213> Artificial Synthesis
<220>
<223> TCR C region primer
<400> 4
tcgtcgccagcgtcggaagtgtataagagacagtcgcagcgtcagatgtgtataagagacag 62
<210> 5
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 5
caagcagaagacggcatacgagatatctatcggtctcgtgggctgg 46
<210> 6
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 6
caagcagaagacggcatacgagattcaggtgagtctcgtgggctgg 46
<210> 7
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 7
caagcagaagacggcatacgagatcactagttgtctcgtgggctgg 46
<210> 8
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 8
caagcagaagacggcatacgagatgaattgccgtctcgtgggctgg 46
<210> 9
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 9
caagcagaagacggcatacgagatatgtacaagtctcgtgggctgg 46
<210> 10
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 10
caagcagaagacggcatacgagatgattcagtgtctcgtgggctgg 46
<210> 11
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 11
Caagcagaagacggcatacgagatctgttcgtgtctcgtgggctgg 46
<210> 12
<211> 46
<212> DNA
<213> Artificial Synthesis
<220>
<223> upstream primer of tag
<400> 12
caagcagaagacggcatacgagattatacggcgtctcgtgggctgg 46
<210> 13
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 13
<210> 14
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 14
<210> 15
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 15
<210> 16
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 16
<210> 17
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 17
<210> 18
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 18
<210> 19
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 19
<210> 20
<211> 51
<212> DNA
<213> Artificial Synthesis
<220>
<223> downstream primer of tag
<400> 20
Claims (2)
1. The application of a primer composition in preparing a molecular detection kit for evaluating the tumor immunotherapy effect is characterized in that: the primer composition comprises a TCR 3 'Oligo (dT) primer, a TCR 5' Oligo joint, a TCR C region primer and a label upstream and downstream primer;
wherein the sequence of each primer is as follows:
TCR 3' oligo (dT) primer: 5 'TTTTTTTTTTTTTTTTTTTTGA 3';
TCR 5' Oligo linker: 5 'ATGCATCGGTATTCAGCATGAACTTrGrGrG 3';
TCR 5' end linker primer:
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C region primers:
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG3’；
a label upstream primer: 5 'CAAGCAGAAGACGGCATACGAGAT [ index1] GTCTCGTGGGCTGG 3'; a label downstream primer: 5 'AATGATACGGCGACCACCGAGATCTACAC [ index2] TCGTCGCCAGCGTC 3'; the index1 is one of ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA, GATTCAGT, CTGTTCGT or TATACGGC; index2 is one of TAGCTACT, ATTATAGC, CCCGTACT, GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT, or GTTGCTAC.
2. Use of a primer composition according to claim 1 for the preparation of a molecular assay kit for the assessment of the efficacy of tumor immunotherapy, characterized in that: the kit also comprises PCR buffer solution, Q5High-Fidelity 2X Master Mix, enucleated enzyme water, AMPure XP Beads and 70% ethanol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611202309.4A CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611202309.4A CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106957905A CN106957905A (en) | 2017-07-18 |
| CN106957905B true CN106957905B (en) | 2020-12-04 |
Family
ID=59480859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611202309.4A Active CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106957905B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2902448C (en) | 2013-03-01 | 2023-04-18 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods of producing enriched populations of tumor reactive t cells from peripheral blood |
| CN109251961A (en) * | 2018-06-28 | 2019-01-22 | 广西医科大学 | A kind of method of unicellular sequencing detection activating T cell |
| CN111363783B (en) * | 2018-12-26 | 2024-01-02 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on specific recognition sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087789A (en) * | 2015-08-10 | 2015-11-25 | 北京吉因加科技有限公司 | Method for detecting BCR and TCR immune repertoire in blood plasma cfDNA |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012531202A (en) * | 2009-06-25 | 2012-12-10 | フレッド ハチンソン キャンサー リサーチ センター | How to measure adaptive immunity |
-
2016
- 2016-12-23 CN CN201611202309.4A patent/CN106957905B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087789A (en) * | 2015-08-10 | 2015-11-25 | 北京吉因加科技有限公司 | Method for detecting BCR and TCR immune repertoire in blood plasma cfDNA |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Detection and Tracking of NY-ESO-1-Specific CD8+ T Cells by High-Throughput T Cell Receptor β (TCRB) Gene Rearrangements Sequencing in a Peptide-Vaccinated Patient;Manami Miyai et al.;《PLOS ONE》;20150820;第10卷(第8期);第1-15页 * |
| High-throughput sequencing of B- and T-lymphocyte antigen receptors in hematology;Warren EH et al.;《BLOOD》;20130508;第122卷(第1期);第19-22页 * |
| T细胞TCR CDR3受体库的高通量测序分析概况;王鹏等;《现代免疫学》;20111231;第31卷(第6期);第512-516页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106957905A (en) | 2017-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11061030B2 (en) | Affinity-oligonucleotide conjugates and uses thereof | |
| US11209440B2 (en) | T cell balance gene expression, compositions of matters and methods of use thereof | |
| JP7341661B2 (en) | High-throughput process for T cell receptor target identification of natively paired T cell receptor sequences | |
| CN106755410B (en) | Method for simultaneously detecting T cell and B cell immune repertoire based on high-throughput sequencing | |
| CN106957906B (en) | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease | |
| JP6929354B2 (en) | Affinity-oligonucleotide conjugates and their use | |
| US20220119881A1 (en) | Systems and methods for sample preparation, sample sequencing, and sequencing data bias correction and quality control | |
| EP2663864A1 (en) | Immunodiversity assessment method and its use | |
| CN106957905B (en) | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect | |
| CA2997787A1 (en) | Immunorepertoire normality assessment method and its use | |
| Osman et al. | Importance of extended blood group genotyping in multiply transfused patients | |
| CN109963572A (en) | For characterizing the reactive composition and method of solid tumor confrontation PD-L1 antibody monotherapy | |
| US11249081B2 (en) | Methods for the identification, targeting and isolation of human dendritic cell (DC) precursors “pre-DC” and their uses thereof | |
| Zou et al. | Toxocara canis differentially affects hepatic microRNA expression in Beagle dogs at different stages of infection | |
| CN107058484B (en) | Primer combination and kit applied to high-throughput sequencing and simultaneous detection of T cell and B cell immune repertoire | |
| JP2023508991A (en) | Nucleic acid sequence analysis method | |
| Wardhani et al. | Quantification of domestic cat hepadnavirus DNA in various body fluid specimens of cats: The potential viral shedding routes | |
| CN114854686A (en) | T cell subset for specifically identifying salmonella typhimurium and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |