CN106957905A - A kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect - Google Patents
A kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect Download PDFInfo
- Publication number
- CN106957905A CN106957905A CN201611202309.4A CN201611202309A CN106957905A CN 106957905 A CN106957905 A CN 106957905A CN 201611202309 A CN201611202309 A CN 201611202309A CN 106957905 A CN106957905 A CN 106957905A
- Authority
- CN
- China
- Prior art keywords
- tcr
- primer
- immunotherapy
- assess
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70521—CD28, CD152
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular Biological Detection field, more particularly to a kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect, human blood sample 10mL is obtained in EDTA anticoagulant tubes, the separation of PMBC is carried out using lymphocyte separation medium Ficoll 1077, utilize the expression quantity of the molecules of flow cytomery CD8+T cells PD 1, utilize flow cytometric sorting CD8+T cells, the total serum IgE of CD8+T cells is extracted using Trizol method, agents useful for same is RNAzol RT, RNA reverse transcriptions are into cDNA, and simultaneously in the ends of cDNA 5 ' addition joint；The step such as PCR1, PCR2 and purifying and progress high-flux sequence, passes through the sense primer from the end connectors of RNA 5 ' to φt cell receptor gene（TCR）The anti-sense primer in C areas, obtains the total length information of tcr gene sequence.
Description
Technical field
It is more particularly to a kind of to be used to assess immunotherapy of tumors effect the invention belongs to molecular Biological Detection field
Molecular detecting method and Primer composition and kit.
Background technology
Cancer immunotherapy is that another after operation, radiotherapy, chemotherapy has to treating cancer and clearly imitated
The cancer treatment method of fruit, it is to be resisted by human activin self immune system, kill tumour cell, is that following cancer is controlled
Treat the direction of development.
Different patients can show different information using different immunotherapies, and this is accomplished by cancer immunotherapy
Patient carries out specific immune system assessment with monitoring cancer immunotherapeutic effects.
If PD-1 antibody is currently to get most of the attention, the class tumor therapy widely paid close attention to, in being also tumour immunotherapy
Main force.The mechanism of action of PD-1 immunotherapies is to design specific protein antibody for PD-1 or PD-L1, prevent PD-1 and
Recover the cytotoxic T cell (CD8 with antigentic specificity in PD-L1 identification process, part+T cell) function, so that
Can kill tumour cell.Flow cytometer (FC) is widely used as one, and can rapidly to homogenizing cell
Sample carries out the instrument of multi-parameter detection, and we can detect CD8 by FC+The PD1 expression quantity of T cell.Controlled by contrast
The expression of PD-1 in front and rear T cell is treated, we may determine that whether PD-1 antibody medicine serves effect to patient.
Substantial amounts of V (variable region), D (variable region), J (bonding pad) genetic fragment are in φt cell receptor on T cell locus
Each species diversity restructuring can be produced in formation.It is thin that the restructuring of this V-D-J genes imparts the unique T of each T cell oneself
Born of the same parents' acceptor (TCR), so that each TCR sequence can effectively turn into unique biomarker of a T cell clone.
Therefore the sequence composition of T cell tcr gene is sequenced, can be very good to position each T cell.This is sequenced by TCR
Plant molecular detecting method and detect CD8+The diversity state of T cell and Clonal.Low diversity represents the T cell of a people
Immunological diversity is few, and this immune state generally has higher infection rate and high mortality, also reflects and various diseases are supported
Imperial ability and to be cured ability relatively low, meanwhile, its T cell clonal expansion is also higher.If on the contrary, T cell diversity is higher
If, illustrate that immune system is more capable and resist exotic diseases, because high T cell polymorphism can prevent that " antigen is escaped
Ease ".And by contrasting the T cell polymorphism and Clonal before and after treatment, so as to judge whether the immune system of sufferer is exempted from
Epidemic disease treatment is activated.
Cancer immunotherapy effect monitoring can provide one quickly for patient, and the immune system of Noninvasive is assessed.And
The effect of medical worker and cancer patient early prediction cancer immunotherapy can be helped, allows the sufferer can be in the struggle to anticancer
In more effective selection treatment means, it is to avoid waste the time and money of cancer patients.
The content of the invention
In order to solve the above technical problems, the molecular detecting method for assessing immunotherapy of tumors effect, by having
The CD8 of activity+The PD-1 molecules of T cell detected and high-flux sequence build T cell TCR libraries, and build
CDNA joints and single pair of primer, and library preparation method, by the anti-sense primer of the sense primer from joint to C areas, are obtained
TCR polymorphism and Clonal.
Solve a kind of Molecular Detection side for being used to assess immunotherapy of tumors effect in the present invention of above technical problem
Method, it is characterised in that：Comprise the following steps：
(1) human blood sample 10mL is obtained in EDTA anticoagulant tubes；
(2) peripheral blood mononuclear is carried out using lymphocyte separation medium Ficoll-1077 (Sigma Co., USA #10771)
The separation of cell (PBMC)；
The effect of lymphocyte separation medium is that lymphocyte can be separated in whole blood, because T cell detects for us
Object, T cell belongs to one kind of lymphocyte, and the RNA that the cell mass after separation is obtained is to eliminate red blood cell, blood platelet etc.
The RNA's of cell.So building the total serum IgE that storehouse uses, to include T cell RNA template purity higher.
(3) flow cytomery CD8 is utilized+The expression quantity of T cell PD-1 molecules；Antibody used is：anti-
CD3, anti-CD8, anti-PD1 and anti-4-1BB (Biolegend companies of the U.S., anti-CD8 FITC, #300906；
Anti-CD3 APC, #300312；PD-1, #329906；4-1BB, #309820.)
Operating procedure on ice：
With 80 μ L staining buffer by cell precipitation resuspended (106Cell).
Control tube (5 1.5mL pipes) is prepared simultaneously：
1) 95 μ L staining buffer (PBS+5%FBS U.S. Gibco#26140079) are added in a blank tube
As achromophil Isotype controls, 90 μ L staining buffer are separately added into remaining control tube and are compareed as single dye,
5 μ L cell suspensions are often added in pipe.
2) anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB that 5uL is separately added into singly dye control tube resist
Body (Biolegend companies of the U.S., anti-CD8 FITC, #300906；Anti-CD3 APC, #300312；PD-1, #329906；
4-1BB, #309820.).
Such as table 1 below：
Table 1
Sample is dyed：
Prepare antibody mixed liquor (each 5 μ of anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB in single sample
L), antibody mixed liquor (20 μ L) and is added in the sample and is gently mixed.
Such as table 2 below：
Table 2
| Sample1 | Sample2 | Sample3 | Sample4 | |
| Cell suspension (μ L) | 80 | 80 | 80 | 80 |
| CD3+CD8+PD1+4-1BB(μL) | 20 | 20 | 20 | 20 |
| Cumulative volume (μ L) | 100 | 100 | 100 | 100 |
Lucifuge ice bath 25min.
Cleaned with 200 μ L staining buffer, 1500rpm centrifugations 10min.
Supernatant is abandoned, 200 μ L staining buffer is added and cleans again one time.
With 300 μ L staining buffer re-suspended cells, FACS pipes are transferred to.Place on ice and lucifuge, machine on sample presentation
Carry out FACS detections CD3+CD8+4-1BB+The PD-1 expression quantity of cell.
(4) flow cytometric sorting CD8 is utilized+T cell；
(5) CD8 is extracted using Trizol method+The total serum IgE of T cell, agents useful for same is RNAzol RT (U.S. MRC
Company #RN190)；
Trizol method is comprised the following steps that：
Harvesting, is transferred in 1.5ml centrifuge tubes, adds 1ml Trizol, mixes, is stored at room temperature 5min.
0.2ml chloroforms are added, 15s is vibrated, 2min is stood.
0.5ml isopropanols are added, liquid in pipe is gently mixed, 10min is stored at room temperature.
4 DEG C of centrifugations, 12000g × 10min abandons supernatant.
The ethanol of 1ml 75% is added, gently washing precipitation.4 DEG C of centrifugations, 7500g × 5min abandons supernatant.
Natural air drying, adds 50ul DEPC H2O dissolvings, obtains lymphocyte total serum IgE.
(6) RNA reverse transcriptions are into cDNA, and simultaneously in the ends of cDNA 5 ' addition joint, and 5 ' ends are drawn when being expanded with PCR later
Thing is combined；
In reverse transcription, while adding joint, loss of the RNA during multistep reaction can be minimized.RNA is in operation
Middle stability extreme difference, is very easy to degraded, and a small amount of step can reduce degraded to the full extent, can be used for while also saving
The cDNA preparation times of amplification.
Joint is exactly the nucleic acid linker at cDNA 5 ' ends, i.e., " Oligo of TCR 5 ' joints " cited below.
(7) PCR1:Restructuring TCR cDNA are expanded by way of single pair of primer；
(8) PCR2 and purifying：Illumina high-flux sequence instrument is added for PCR1 products (the TCR sequences after amplification)
Upper machine joint and label, while more upper machine gene dosage is expanded again for increase；After PCR reactions terminate, carried out using magnetic bead
DNA is purified.
PCR primer is typically all containing excessive primer, Taq DNA enzymatics and dNTP.The presence of these compositions will be directly affected
To processes such as follow-up library quality inspection, sequencing reactions, purifying can remove the accessory substance of these influence subsequent experimentals.Meanwhile, it is pure
The process of change is also that the DNA fragmentation in the process of clip size screening, the present invention is in 700bp or so, using difference
The magnetic bead of volume is mixed with PCR primer, and volume ratios different magnetic bead/DNA can adsorb different size of fragment, using above-mentioned
Magnetic bead volume, can successfully remove machine text in mistake (error) fragment and primer dimer when PCR is expanded, the sequencing of let us
There was only our sequencing target DNA fragments in storehouse so that sequencing result is more accurate, reduce error.
As shown in figure 3, being only found that the peak of a fragment by library quality inspection.
(9) high-flux sequence is carried out：The cDNA library of gained is sequenced by Illumina MiSeq platforms, surveyed
Sequence pattern is PE300, and passes through bioinformatic analysis high-flux sequence result；Sequencing pattern PE300 is selected, library denaturation is dense
Spend for 2nM, upper machine concentration is 20pM.
Contrast the Clonal change of the front and rear clone group more than 10% of Case treatment.Check after immunization therapy, if phase
Whether same T cell clone group has more clonal expansions.If it has, explanation immunization therapy is to serve to its immune system
Certain effect.
In the step (6), comprise the following steps that：
Each RNA sample is mixed according to following ratio：
Reagent volume 1X (μ L),
RNA 8,
The Oligo of TCR 3 ' (dT) primer (10 μM) 1,
Hatch in 72 DEG C 3 minutes, then 4 DEG C 1 minute；Prepare PCR reaction buffers.
The mixing PCR reactions caching liquid and RNA samples, cDNA reverse transcriptions are started according to following response procedures：
42 DEG C 60 minutes；70 DEG C 10 minutes；4 DEG C permanent.
The PCR reaction buffers：
In the step (7), reaction system is prepared according to following ratio：
The response procedures of PCR 1 are:
95 DEG C 3 minutes；95 DEG C 30 seconds；65 DEG C 1 minute, 25 circulation；72 DEG C 1 minute；4 DEG C permanent.The step
(8) in, reaction system is prepared according to following ratio：
The response procedures of PCR 2 are:
94 DEG C 3 minutes；94 DEG C 30 seconds；55 DEG C 30 seconds, 15 circulation；72 DEG C 20 minutes, 72 DEG C 1 minute, 4 DEG C are permanent.
In the step (8), specific purification step is as follows：
(1) 80 μ L AMPure XP Beads of addition enter PCR2 reaction products, mix；
(2) in incubation at room temperature 10 minutes；
(3) magnetic bead-PCR2 product mixtures test tube is placed on magnetic frame, and all magnetic beads of wait are adsorbed on magnetic frame
Afterwards, all supernatants are sucked with pipettor, are abandoned；
(4) the addition ethanol of 150 μ L 70% is hatched 30 seconds on magnetic bead, all supernatants is sucked with pipettor, is abandoned；
(5) the 4th step is repeated 2 times；
(6) test tube cap is opened, is waited 5 minutes, treats that magnetic bead is air-dried, is residued in without any ethanol in test tube；
(7) test tube is removed from magnetic frame, and adds 50 μ L and remove nuclease water, suspension magnetic bead is blown and beaten using pipettor；
(8) tube back magnetic frame, all magnetic beads are waited all to be adsorbed in after magnetic frame, transfer supernatant is in new examination
The PCR2 products after purifying are just contained in Guan Zhong, supernatant.
A kind of molecular detection primer composition for being used to assess immunotherapy of tumors effect in the present invention, it is characterised in that：
The Primer composition includes the Oligo of TCR 3 ' (dT) primer, the Oligo joints of TCR 5 ', TCR C area's primers and label upstream and downstream
Primer；
The sequence of each of which primer is as follows：
The Oligo of TCR 3 ' (dT) primer：5’TTTTTTTTTTTTTTTTTTTTGA 3’；
The Oligo joints of TCR 5 '：5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’；
The end connector primers of TCR 5 '：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C areas primer：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
Label sense primer：5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’；
Label anti-sense primer：5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC
3’。
Wherein, the index1 be ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA,
One kind in GATTCAGT, CTGTTCGT or TATACGGC；Index2 be TAGCTACT, ATTATAGC, CCCGTACT,
One kind in GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT or GTTGCTAC.
A kind of molecular detection kit for being used to assess immunotherapy of tumors effect in the present invention, it is characterised in that：It is described
Kit contains primer combination as claimed in claim 1 or 2.
The kit also include PCR buffer solutions, Q5 High-Fidelity 2X Master Mix, go nuclease water,
AMPure XP Beads and 70% ethanol.
Primer combination in the present invention can effectively expand the complete sequence of tcr gene.Bis- generations of TCR sequencing library is set to build effect
Efficiently, kit has provided the user simple and convenient application method, stabilised efficiency to rate.
The present invention is based on low cytometric analysis and high throughput sequencing technologies, and the library construction side of single pair of primer is sequenced in TCR
Method, by obtaining CD8+After T cell RNA, RNA is being carried out to while cDNA reverse transcriptions, the 5 ' ends to cDNA add one
Joint, so that designing TCR by the joint of this known array expands sense primer, then coordinates tcr gene 3 ' to hold C areas gene
(constant region) designs anti-sense primer, so as to reach the purpose for expanding whole TCR sequences gene.
By detecting CD8 in the present invention+The PD-1 developed by molecule amount and CD8 of T cell+The polymorphism of T cell, clone
Property judges the effect of tumour patient immunization therapy.There is not other method to evaluate the effective of immunotherapy of tumors at present
Property.
The invention provides it is a kind of as described in relation to the first aspect based on high-flux sequence build TCR libraries cDNA joints and
The construction method in TCR libraries is built described in single pair of PCR primer or second aspect based on high-flux sequence in detection CD8+T cell
Polymorphism and it is Clonal in application.
The present invention provides the joint that TCR libraries are built based on high-flux sequence, and primer and method have the beneficial effect that：1. obtain
Obtained the full transcript profile sequences of people TCR；2. obtain human specific CDR1, CDR2 and CDR3 sequence；3. obtain many of human T-cell
State property and Clonal, to be used as the foundation for the effect for evaluating immunotherapy of tumors.
The present invention is comprehensive biological by being carried out to people's tcr gene sequencing result on the basis of high-flux sequence platform
Bioinformatics analysis, obtains gene Preferences of the TCR when VDJ is recombinated, and VDJ assortment of genes information, TCR clones kind of information,
Abrupt information on TCR diversity informations, CDR1, CDR2, CDR3 nucleotide sequence and amino acid sequence information, gene, etc..Just
It is that these factor quantity of formation are huge and TCR groups storehouse of wide variety.
Bioinformatic data analysis after detailed sequencing is provided, and effective quality monitoring is provided to whole experiment,
Experimental error and mistake can at utmost be reduced.Being assessed by the sequencing to TCR can be quick, the help medical treatment of Noninvasive
Worker and the effect of cancer patient early prediction cancer immunotherapy, make sufferer more effective in the struggle to anticancer
Select treatment means, it is to avoid waste the time and money of cancer patients.
By simply gathering blood sample, CD8 of the flow cytometer to subject is utilized+T cell surface protein (PD-
1) carry out analysis of molecules and φt cell receptor gene is carried out after the sequencing of two generations and bioinformatics clinical analysis, the PD-1 of acquisition
Expression quantity, CD8+The polymorphism of T cell and Clonal, is answered immunotherapy of tumors so as to provide a current immune system
Passion condition, evaluates the effect of immunization therapy.
Brief description of the drawings
RNA reverse transcription cDNA schematic diagrames in Fig. 1 present invention
Upper machine joint schematic diagram is sequenced to be expanded TCR cDNA using twice PCR in the present invention and being added in Fig. 2
Fig. 3 is sequencing library quality inspection result in the present invention.
Fig. 4 carries out bioinformatic analysis comparison for TCR sequencing results in the present invention, finds out the information (portion of every sequence
Point)
Fig. 5 is TCR sequencing result 3D forest maps in the present invention.Subject TCR diversity and clone's implementations is shown, often
One post represents a kind of TCR clone, and Clonal value-added TCR illustrates the increment situation of leukaemia cancer cell, it is value-added this
Bar TCR sequences can as immunotherapeutic effects biomarker, unified clone is contrasted after the treatment, is seen if there is more
Clonal increment.
During Fig. 6 is of the invention, T cell PD-1 change before and after contrast tumour patient PD-1 antibody medicine immunization therapies.
During Fig. 7 is of the invention, the Clonal change of T cell before and after contrast tumour patient PD-1 antibody medicine immunization therapies.(X
Axle：V genes；Y-axis：J genes；Z axis：TcR clones number)
Embodiment
With reference to embodiment, the present invention is described in further detail, and following primer is by the U.S.
Invitrogen companies synthesize:
Embodiment 1
With the Primer composition and kit in the present invention, so as to be controlled based on high-flux sequence for assessing tumour immunity
The Molecular Detection of therapeutic effect, comprises the following steps：
(1) human blood sample 10mL is obtained in EDTA anticoagulant tubes；
(2) peripheral blood mononuclear is carried out using lymphocyte separation medium Ficoll-1077 (Sigma Co., USA #10771)
The separation of cell (PBMC)；
(3) flow cytometric sorting CD8 is utilized+T cell；Antibody used is：Anti-CD3, anti-CD8 and anti-
4-1BB (Biolegend companies of the U.S., anti-CD8 FITC, #300906；Anti-CD3 APC, #300312；PD-1, #
329906；4-1BB, #309820.)
(4) CD8 is extracted using Trizol method+The total serum IgE of T cell, agents useful for same is RNAzol RT (U.S. MRC
Company #RN190)；
(5) RNA reverse transcriptions are into cDNA, and 5 ' the end primer knots when the ends of cDNA 5 ' addition joint is expanded with PCR later
Close,
Comprise the following steps that,
The reagent used：
The Oligo of TCR 3 ' (dT) primer (10 μM)
5X reverse transcription buffers (250mM Tris-HCl (pH 8.3), 375mM KCl, 15mM MgCl2)
Dithiothreitol (DTT), DTT (20mM) U.S. Thermo Scientific#R0861
DNTP Mix (10mM) U.S. Invitrogen#18427088
RNAse Out (40U/ μ L) U.S. Invitrogen#10777019
The Oligo of TCR 5 ' joints (10 μM)
Superscript II RT (200U/ μ L) U.S. Invitrogen#18064022
Each RNA sample is mixed according to following ratio：
| Reagent | Volume 1X (μ L) |
| RNA | 8 |
| The Oligo of TCR 3 ' (dT) primer (10 μM) | 1 |
Hatch in 72 DEG C 3 minutes, then 4 DEG C 1 minute.
PCR reaction buffers are prepared according to following ratio
| Reagent | Volume 1X (μ L) |
| 5X reverse transcription buffers | 3.5 |
| DTT(20mM) | 1 |
| dNTP(10mM) | 1 |
| RNAse Out | 1 |
| The Oligo of TCR 5 ' joints (10 μM) | 1 |
| Superscript II RT | 1 |
PCR reactions caching liquid and RNA samples are mixed, cDNA reverse transcriptions are started according to following response procedures
42 DEG C 60 minutes
70 DEG C 10 minutes
4 DEG C permanent
After reaction terminates, so that it may obtain the total cDNA that with the addition of joint at 5 ' ends (as schemed)
(6) PCR1.Restructuring TCR cDNA are expanded by way of " single pair of " primer, are comprised the following steps that：
The reagent used：
Q5 High-Fidelity 2X Master Mix (U.S. NEB#M0492L)
The end connectors of TCR 5 ' primer (sense primer)
TCR C areas primer (anti-sense primer)
Remove nuclease water (U.S. Thermo Scientific AM9914G)
Reaction system is prepared according to following ratio：
The response procedures of PCR 1 are:
(7) PCR 2 (label PCR).Illumina high-flux sequences are added for PCR1 products (the TCR sequences after amplification)
The upper machine joint and label of instrument, while more upper machine gene dosage is expanded again for increase.Comprise the following steps that：
The reagent used：
Q5 High-Fidelity 2X Master Mix (U.S. NEB#M0492L)
Label sense primer
Label anti-sense primer
Remove nuclease water (U.S. Thermo Scientific AM9914G)
Reaction system is prepared according to following ratio：
The response procedures of PCR 2 are:
(8) PCR2 product purifications.After above-mentioned PCR reactions terminate, DNA purifying is carried out using magnetic bead, is comprised the following steps that：
The reagent used：
Agencourt AMPure XP Beads (U.S. Beckman#A63882)
Specific purification step is as follows：
1. adding 80 μ L AMPure XP Beads enters PCR2 reaction products, mix.
2. in incubation at room temperature 10 minutes.
3. magnetic bead-PCR2 product mixtures test tube is placed after on magnetic frame, waiting all magnetic beads to be adsorbed on magnetic frame,
All supernatants are sucked with pipettor, are abandoned.
4. adding the ethanol of 150 μ L 70% on magnetic bead, hatch 30 seconds, all supernatants are sucked with pipettor, abandon.
5. repeat the 4th step 2 times.
6. opening test tube cap, wait 5 minutes, treat that magnetic bead is air-dried, residued in without any ethanol in test tube.
7. a test tube is removed from magnetic frame, and 50 μ L of addition remove nuclease water, utilize pipettor to blow and beat suspension magnetic bead.
8. a tube back magnetic frame, waits all magnetic beads to be all adsorbed in after magnetic frame, transfer supernatant is in new test tube
In.The PCR2 products after purifying are just contained in supernatant.
(9) high-flux sequence is carried out.The cDNA library of gained is passed through into IlluminaPlatform (the U.S.
Illumina companies) it is sequenced, sequencing pattern is PE300, and passes through bioinformatic analysis high-flux sequence result.
Material and reagent explanation
Lung squamous cancer disease patient：Originate Henan Prov. People's Hospital；Immunotherapy of tumors medicine：The silent husky east PD-1 inhibitor in the U.S.
Keytruda；Patient's informed consent.No special illustrates that the reagent that the present invention is used is commercial goods, and the embodiment of the present invention is adopted
Database is disclosed online database.
Specifically, the termination of reverse transcription 5 ' header sequence of the present invention, primer sequence are following (5 ' -3 ')：
Reverse transcription step
The Oligo of TCR 3 ' (dT) primer：
5’TTTTTTTTTTTTTTTTTTTTGA 3’
The Oligo joints of TCR 5 '：
5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’
PCR1 steps
The end connector primers of TCR 5 '：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’
TCR C areas primer：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’
PCR2 steps
Label sense primer：
5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’
Label anti-sense primer：
5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’
RG=RNA nucleotides
In Tag primerUnderscoreSequence label is sequenced for Illumina in part, and interior sequence is replaced by following table sequence, uses
When multiple samples are detected simultaneously, each sample is distinguished using different index1/index2 combinations and bioinformatics
Sequencing result.
Design of primers：The joint sequence and TCR C areas gene for holding addition in TCR 5 ' during for RNA reverse transcriptions are divided
Analysis, is analyzed primer dimer and stem ring mispairing using Oligo 7.36 and Primer Premier 6.0, in TCR
5 ' end manual splicies are provided with sense primer, and reverse primer, amplification TCR total length transcription subregion sequences are designed for C downstream of gene
Row, wherein TCR FR1 is contained, CDR1, FR2, CDR2, FR3, CDR3, FR4 regions.
Embodiment 2
The embodiment of the present invention 1 provides a kind of preparation method of t lymphocyte receptor (TCR) RNA sample, including following step
Suddenly：
Fresh 10 milliliters of peripheral blood sample (mL) is collected, according to Ficoll-1077's (Sigma Co., USA #10771)
Specification is operated, and obtains relatively pure PMBC (PBMC)；
The total serum IgE of CD8+T cells is extracted using Trizol method, agents useful for same is RNAzol RT (MRC companies of U.S. #
RN190), the total serum IgE obtained, is utilized(U.S. Thermo Fisher Scientific are public by 2.0 Fluorometer
Take charge of #Q32866), coordinateRNA HS Assay Kit kits (U.S. Thermo Fisher Scientific company #
Q32852 RNA concentration) is determined, then reverse transcription RNA；
Embodiment 3
The embodiment of the present invention 2 provides a kind of molecular detecting method for being used to assess immunotherapy of tumors effect, including such as
Lower step：
Utilize flow cytomery CD8+The expression quantity of T cell PD-1 molecules；Antibody used is：anti-CD3、
Anti-CD8, anti-PD1 and anti-4-1BB (Biolegend companies of the U.S., anti-CD8FITC, #300906；anti-CD3
APC, #300312；PD-1, #329906；4-1BB, #309820.)
Comprise the following steps that：
Operate on ice：
With 80 μ L staining buffer by cell precipitation resuspended (106Cell).
Control tube (5 1.5mL pipes) is prepared simultaneously：
1) 95 μ L staining buffer are added in a blank tube as achromophil Isotype control, remaining control
90 μ L staining buffer are separately added into pipe to compare as single dye, and 5 μ L cell suspensions are often added in pipe.
2) anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB that 5uL is separately added into singly dye control tube resist
Body.
Such as table 3 below：
Table 3
Sample is dyed：
Prepare antibody mixed liquor (each 5 μ of anti-CD3, anti-CD8, anti-PD1 and anti-4-1BB in single sample
L), antibody mixed liquor (20 μ L) and is added in the sample and is gently mixed.
Such as table 4 below：
Table 4
| Sample1 | Sample2 | Sample3 | Sample4 | |
| Cell suspension (μ L) | 80 | 80 | 80 | 80 |
| CD3+CD8+PD1+4-1BB(μL) | 20 | 20 | 20 | 20 |
| Cumulative volume (μ L) | 100 | 100 | 100 | 100 |
Lucifuge ice bath 25min.
Cleaned with 200 μ L staining buffer, 1500rpm centrifugations 10min.
Supernatant is abandoned, 200 μ L staining buffer is added and cleans again one time.
With 300 μ L staining buffer re-suspended cells, FACS pipes are transferred to.Place on ice and lucifuge, machine on sample presentation
Carry out FACS detections CD3+CD8+4-1BB+The PD1 expression quantity of cell.
CD3 before and after contrast treatment+CD8+4-1BB+The change of the PD1 expression quantity of cell, as shown in Figure 6：After treatment, periphery
Blood CD3+5 times are added before the relative treatment of T cell quantity.CD8+T cell (cytotoxic T cell) has accounted for the percentage of total T cell also
Increase, and 3.26% 18.11% is increased before accounting for the percentage of total lymphocyte by treating.The toxicity T for expressing PD1 is thin
Born of the same parents, are also reduced to 43.3% from 99.9% before treatment.Illustrate Apoptosis inhibitor of the PD-1 antibody medicine immunotherapy methods to T cell
Serve certain effect.
RNA using the gained of embodiment 1 as reverse transcription template, according to the reagent in Part VI in above-mentioned " second aspect " with
Step obtains the cDNA for adding the end connectors of TCR 5 '.According still further to the reagent in the seven, the eight parts in above-mentioned " second aspect " and
Step enters product (library) purifying of performing PCR 1, PCR 2 (label PCR) and PCR 2.
After library purifying terminates, utilize the Bioanalyzer of Agilent 2100 (U.S. Agilent company #G2939AA)
The purity and size in library are detected, the kit used is Agilent DNA 1000Kit (Agilent companies of U.S. #5067-
1504), testing result is as shown in figure 3, library size is in 738bp or so, and library purity is at a relatively high, and has not seen that other are non-
Specific amplification sequence.
Utilize2.0 Fluorometer (U.S. Thermo Fisher Scientific company #Q32866), match somebody with somebody
CloseDsDNA HS Assay Kit kits (U.S. Thermo Fisher Scientific company #Q32851) are determined
DNA library concentration, and send company to carry out high-flux sequence (using Illumina MiSeq, 2*300pair-end).
After the end connectors of TCR 5 ', primer and library construction using the present invention, high-flux sequence obtains about millions of
Bar TCR sequences.
Sequencing result carries out bioinformatic analysis, and (analysis of biological information uses the aligner of Bowtie 2
(Ver.2.1.0), TCR database matchings derive from international immunogene information system www.imgt.org), part point
Analyse shown in comparison result below figure 4,5.
By bioinformatic analysis, can accurately know the information of every TCR sequence, amino acid information, bar number with
And proportion.By TCR comparative analyses, present invention obtains the statistical analysis of high-flux sequence sequence TCR representativeness clones
As a result, as a result as shown in Figures 4 and 5, Fig. 5 for TCR recombination V-J be applied in combination situation, T cell polymorphism and it is Clonal can
Depending on changing figure.As shown in Figure 7, the near of the end connectors of TCR 5 ' of the present invention, PCR primer and the acquisition of sequencing library preparation method is passed through
In the TCR sequences of million, the CD8 of person under inspection can be pointed out+T cell with treatment before occur have Clonal value-added T
Still had after cell mass treatment, maximum of which and second largest Clonal increment T cell group are respectively before treatment
16.02%, which has risen to 28.01% and 10.65%, has risen to 13.74%, point out PD-1 antibody medicines inhibit can recognize it is swollen
The apoptosis of the CD8+T cells of oncocyte, effectively help can be provided by tumors destroyed cell for immune system.
The above results show that the diversity information of tcr gene can be covered by building TCR libraries using the method for the present invention,
Improve the recall rate of low copy number T cell clone, and the testing result and T cell of the PD-1 expression quantity using flow cytometer
Clonal result, can be used for assess immunotherapy of tumors effect.
Presently preferred embodiments of the present invention is the foregoing is only, is not intended to limit the invention, all essences in the present invention
Any modification, equivalent and improvement made within refreshing and principle etc., should be included within the scope of the present invention.
Sequence table SEQ UENCE LISTING
<110>Sun Tao
<120>A kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 32
<212> DNA
<213>It is artificial synthesized
<220>
<223>The Oligo joints of TCR 5 '
<400> 1
atgcatcggatcttcagcatgaacttrgrgrg 32
<210> 2
<211> 22
<212> DNA
<213>It is artificial synthesized
<220>
<223>The Oligo of TCR 3 ' (dT) primer
<400> 2
ttttttttttttttttttttga 22
<210> 3
<211> 57
<212> DNA
<213>It is artificial synthesized
<220>
<223>The end connectors of TCR 5 '
<400> 3
gtctcgtgggctgggcgatgtgtatgagagacagcatgcatcggatcttcagcatga 57
<210> 4
<211> 62
<212> DNA
<213>It is artificial synthesized
<220>
<223>TCR C areas primer
<400> 4
tcgtcgccagcgtcggaagtgtataagagacagtcgcagcgtcagatgtgtataagagacag 62
<210> 5
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 5
caagcagaagacggcatacgagatatctatcggtctcgtgggctgg 46
<210> 6
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 6
caagcagaagacggcatacgagattcaggtgagtctcgtgggctgg 46
<210> 7
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 7
caagcagaagacggcatacgagatcactagttgtctcgtgggctgg 46
<210> 8
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 8
caagcagaagacggcatacgagatgaattgccgtctcgtgggctgg 46
<210> 9
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 9
caagcagaagacggcatacgagatatgtacaagtctcgtgggctgg 46
<210> 10
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 10
caagcagaagacggcatacgagatgattcagtgtctcgtgggctgg 46
<210> 11
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 11
Caagcagaagacggcatacgagatctgttcgtgtctcgtgggctgg 46
<210> 12
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 12
caagcagaagacggcatacgagattatacggcgtctcgtgggctgg 46
<210> 13
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 13
aatgatacggcgaccaccgagatctacactagctacttcgtcgccagcgtc 51
<210> 14
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 14
aatgatacggcgaccaccgagatctacacattatagctcgtcgccagcgtc 51
<210> 15
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 15
aatgatacggcgaccaccgagatctacaccccgtacttcgtcgccagcgtc 51
<210> 16
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 16
aatgatacggcgaccaccgagatctacacgggtataatcgtcgccagcgtc 51
<210> 17
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 17
aatgatacggcgaccaccgagatctacacagcaggtgtcgtcgccagcgtc 51
<210> 18
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 18
aatgatacggcgaccaccgagatctacactatacgtatcgtcgccagcgtc 51
<210> 19
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 19
aatgatacggcgaccaccgagatctacaccacctagttcgtcgccagcgtc 51
<210> 20
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 20
aatgatacggcgaccaccgagatctacacgttgctactcgtcgccagcgtc 51
Claims (10)
1. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect, it is characterised in that：Comprise the following steps：
(1) human blood sample 10mL is obtained in EDTA anticoagulant tubes；
(2) separation of PMBC is carried out using lymphocyte separation medium Ficoll-1077；
(3) flow cytomery CD8 is utilized+The expression quantity of T cell PD-1 molecules；Antibody used is：anti-CD3、
Anti-CD8, anti-PD1 and anti-4-1BB；
(4) flow cytometric sorting CD8 is utilized+T cell；
(5) CD8 is extracted using Trizol method+The total serum IgE of T cell, agents useful for same is RNAzol RT；
(6) RNA reverse transcriptions are into cDNA, and add joint at the ends of cDNA 5 ' simultaneously；
(7) PCR1：Restructuring TCR cDNA are expanded by way of single pair of primer；
(8) PCR2 and purifying：The upper machine joint and label of Illumina high-flux sequence instrument are added for PCR1 products, is expanded simultaneously
Increase, and DNA purifying is carried out using magnetic bead；
(9) high-flux sequence is carried out：The cDNA library of gained is sequenced by Illumina MiSeq platforms, mould is sequenced
Formula is PE300, and library denaturant concentration is 2nM, and upper machine concentration is 20pM, and passes through bioinformatic analysis high-flux sequence knot
Really；T cell polymorphism and Clonal before and after contrast treatment, to judge the response situation to immunization therapy of immune system.
2. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect according to claim 1, its feature exists
In：In the step (6), comprise the following steps that：
Each RNA sample is mixed according to following ratio：
Reagent volume 1X (μ L),
RNA 8,
The Oligo of TCR 3 ' (dT) primer (10 μM) 1,
Hatch in 72 DEG C 3 minutes, then 4 DEG C 1 minute；Prepare PCR reaction buffers.
The mixing PCR reactions caching liquid and RNA samples, cDNA reverse transcriptions are started according to following response procedures：
42 DEG C 60 minutes；70 DEG C 10 minutes；4 DEG C permanent.
3. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect according to claim 2, its feature exists
In：The PCR reaction buffers：
4. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect according to claim 1, its feature exists
In：In the step (7), reaction system is prepared according to following ratio：
The response procedures of PCR 1 are:
95 DEG C 3 minutes；95 DEG C 30 seconds；65 DEG C 1 minute, 25 circulation；72 DEG C 1 minute；4 DEG C permanent.
5. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect according to claim 1, its feature exists
In：In the step (8), reaction system is prepared according to following ratio：
The response procedures of PCR 2 are:
94 DEG C 3 minutes；94 DEG C 30 seconds；55 DEG C 30 seconds, 15 circulation；72 DEG C 20 minutes, 72 DEG C 1 minute, 4 DEG C are permanent.
6. a kind of molecular detecting method for being used to assess immunotherapy of tumors effect according to claim 1, its feature exists
In：In the step (8), specific purification step is as follows：
(1) 80 μ L AMPure XP Beads of addition enter PCR2 reaction products, mix；
(2) in incubation at room temperature 10 minutes；
(3) magnetic bead-PCR2 product mixtures test tube is placed after on magnetic frame, waiting all magnetic beads to be adsorbed on magnetic frame, is used
Pipettor sucks all supernatants, abandons；
(4) the addition ethanol of 150 μ L 70% is hatched 30 seconds on magnetic bead, all supernatants is sucked with pipettor, is abandoned；
(5) the 4th step is repeated 2 times；
(6) test tube cap is opened, is waited 5 minutes, treats that magnetic bead is air-dried, is residued in without any ethanol in test tube；
(7) test tube is removed from magnetic frame, and adds 50 μ L and remove nuclease water, suspension magnetic bead is blown and beaten using pipettor；
(8) tube back magnetic frame, wait all magnetic beads to be all adsorbed in after magnetic frame, shift supernatant in new test tube,
The PCR2 products after purifying are just contained in supernatant.
7. a kind of molecular detection primer composition for being used to assess immunotherapy of tumors effect according to right right 1, its
It is characterised by：The Primer composition include the Oligo of TCR 3 ' (dT) primer, the Oligo joints of TCR 5 ', TCR C area's primers and
Label upstream and downstream primer；
The sequence of each of which primer is as follows：
The Oligo of TCR 3 ' (dT) primer：5’TTTTTTTTTTTTTTTTTTTTGA 3’；
The Oligo joints of TCR 5 '：5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’；
The end connector primers of TCR 5 '：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C areas primer：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
Label sense primer：5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’；
Label anti-sense primer：5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’。
8. a kind of molecular detection primer composition for being used to assess immunotherapy of tumors effect described in claim 7, its feature
It is：The index1 be ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA, GATTCAGT,
One kind in CTGTTCGT or TATACGGC；Index2 be TAGCTACT, ATTATAGC, CCCGTACT, GGGTATAA,
One kind in AGCAGGTG, TATACGTA, CACCTAGT or GTTGCTAC.
9. a kind of molecular detection kit for being used to assess immunotherapy of tumors effect according to claim 7 or 8, it is special
Levy and be：The kit contains primer combination as claimed in claim 1 or 2.
10. a kind of molecular detection kit for being used to assess immunotherapy of tumors effect according to claim 9, its feature
It is：The kit also include PCR buffer solutions, Q5 High-Fidelity 2X Master Mix, go nuclease water,
AMPure XP Beads and 70% ethanol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611202309.4A CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611202309.4A CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106957905A true CN106957905A (en) | 2017-07-18 |
| CN106957905B CN106957905B (en) | 2020-12-04 |
Family
ID=59480859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611202309.4A Active CN106957905B (en) | 2016-12-23 | 2016-12-23 | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106957905B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109251961A (en) * | 2018-06-28 | 2019-01-22 | 广西医科大学 | A kind of method of unicellular sequencing detection activating T cell |
| CN111363783A (en) * | 2018-12-26 | 2020-07-03 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on unique recognition sequence |
| US10716809B2 (en) | 2013-03-01 | 2020-07-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods of producing enriched populations of tumor reactive T cells from peripheral blood |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140213463A1 (en) * | 2009-06-25 | 2014-07-31 | Fred Hutchinson Cancer Research Center | Method of Measuring Adaptive Immunity |
| CN105087789A (en) * | 2015-08-10 | 2015-11-25 | 北京吉因加科技有限公司 | Method for detecting BCR and TCR immune repertoire in blood plasma cfDNA |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
-
2016
- 2016-12-23 CN CN201611202309.4A patent/CN106957905B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140213463A1 (en) * | 2009-06-25 | 2014-07-31 | Fred Hutchinson Cancer Research Center | Method of Measuring Adaptive Immunity |
| US20160251721A1 (en) * | 2009-06-25 | 2016-09-01 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
| CN105087789A (en) * | 2015-08-10 | 2015-11-25 | 北京吉因加科技有限公司 | Method for detecting BCR and TCR immune repertoire in blood plasma cfDNA |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
Non-Patent Citations (3)
| Title |
|---|
| MANAMI MIYAI ET AL.: "Detection and Tracking of NY-ESO-1-Specific CD8+ T Cells by High-Throughput T Cell Receptor β (TCRB) Gene Rearrangements Sequencing in a Peptide-Vaccinated Patient", 《PLOS ONE》 * |
| WARREN EH ET AL.: "High-throughput sequencing of B- and T-lymphocyte antigen receptors in hematology", 《BLOOD》 * |
| 王鹏等: "T细胞TCR CDR3受体库的高通量测序分析概况", 《现代免疫学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10716809B2 (en) | 2013-03-01 | 2020-07-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods of producing enriched populations of tumor reactive T cells from peripheral blood |
| US11679128B2 (en) | 2013-03-01 | 2023-06-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods of producing enriched populations of tumor reactive T cells from peripheral blood |
| CN109251961A (en) * | 2018-06-28 | 2019-01-22 | 广西医科大学 | A kind of method of unicellular sequencing detection activating T cell |
| CN111363783A (en) * | 2018-12-26 | 2020-07-03 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on unique recognition sequence |
| CN111363783B (en) * | 2018-12-26 | 2024-01-02 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on specific recognition sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106957905B (en) | 2020-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11061030B2 (en) | Affinity-oligonucleotide conjugates and uses thereof | |
| US11118176B2 (en) | Single cell bar-coding for antibody discovery | |
| AU2020204449B2 (en) | High-throughput nucleotide library sequencing | |
| JP7341661B2 (en) | High-throughput process for T cell receptor target identification of natively paired T cell receptor sequences | |
| JP6916309B2 (en) | Systems and methods for large-scale parallel combinatorial analysis of single cells | |
| JP6929354B2 (en) | Affinity-oligonucleotide conjugates and their use | |
| CN106755410A (en) | A kind of method for detecting T cell and B cell immune group storehouse simultaneously based on high-flux sequence | |
| EP2663864A1 (en) | Immunodiversity assessment method and its use | |
| CN106957906A (en) | A kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence | |
| CN109593758B (en) | Multiplex primer set and method for constructing human B cell immune repertoire based on high-throughput sequencing by using same | |
| CN106957905A (en) | A kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect | |
| CN113308475B (en) | Aptamer for specifically recognizing gastric adenocarcinoma serum and application thereof | |
| CN107058484A (en) | It is a kind of to detect T cell and the primer combination in B cell immune group storehouse and kit simultaneously applied to high-flux sequence | |
| CN113999912A (en) | Marker for predicting resistance of tyrosine kinase inhibitor | |
| CN106755505A (en) | Kit for detecting genetic mutation in blood plasma ctDNA | |
| CN115485392A (en) | Methods for identifying ligand blocking antibodies and for determining antibody titers | |
| CN106636105A (en) | Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof | |
| CN116875608A (en) | Nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF-1 protein | |
| CN112301099A (en) | Primer group for amplifying B lymphocyte immune repertoire and application thereof | |
| CN106854649A (en) | The aptamer C204 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |