CN116875608A

CN116875608A - Nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF-1 protein

Info

Publication number: CN116875608A
Application number: CN202310917591.8A
Authority: CN
Inventors: 何磊; 方晓娜; 王晶; 仇志锌; 罗昭锋
Original assignee: Anhui Province Angpumai Biotechnology Co ltd
Current assignee: Anhui Province Angpumai Biotechnology Co ltd
Priority date: 2023-07-25
Filing date: 2023-07-25
Publication date: 2023-10-13

Abstract

The invention discloses a nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF 1 protein, which comprises at least one of the following three sequences: (1) a DNA sequence shown in any one of SEQ ID NOs 1 to 2; (2) A DNA sequence which has more than 60% homology with the DNA sequence shown in any one of SEQ ID NO. 1-2 and specifically binds to DIKKKOPF-1 protein; (3) An RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NO. 1-2 and specifically binding to DIKKKOPF-1 protein. The invention also discloses application of the nucleic acid aptamer, a conjugate and a derivative thereof. The aptamer, the conjugate and the derivative thereof provided by the invention are highly specifically combined with the DIKKKOPF-1 protein, and have the advantages of small molecular weight, stable chemical property and easy preservation and marking.

Description

Nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF-1 protein

Technical Field

The invention relates to the technical field of biology, in particular to a nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF-1 protein.

Background

The protein of the DIKKKOPF family consists of DIKKKOPF-1 protein, DIKKOPF-2 protein, DIKKOPF-3 protein and DIKKOPF-4 protein, and functions as a secreted Wnt antagonist by inhibiting Wnt co-receptor LRP 5/6. The DIKKKOPF-1 protein, DIKKOPF-2 protein and DIKKOPF-4 protein also bind to cell surface Kremen-1 or Kremen-2 and promote internalization of LRP 5/6. Dickkopf-related protein 1 (Dickkopf-1 protein) was originally identified as an inducer of xenopus embryo head formation. The DICKKOPF-1 protein regulates Wnt signaling during embryonic development. Elevated levels of the DIKKKOPF-1 protein are found in most lung cancers, esophageal squamous cell carcinomas and hormone-resistant breast cancers, while the DIKKOPF-1 protein expression is reduced in malignant melanoma and colorectal cancers.

Aptamer refers to DNA or RNA molecules obtained by screening and separating by an exponential enrichment ligand system evolution (SELEX) technology, and can be combined with other targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has wide prospects in biochemical analysis, environmental monitoring, basic medicine, new drug synthesis and the like. Compared with an antibody, the nucleic acid aptamer has the advantages of small molecular weight, better stability, easy transformation and modification, no immunogenicity, short preparation period, capability of being synthesized artificially and the like, and is free of a series of processes of animal immunization, feeding, protein extraction, purification and the like.

Based on the SELEX screening principle, the feasibility of the DICKKOPF-1 protein aptamer for biomarkers of hepatoma cells HCC has also been widely studied. Several researchers have published the nucleic acid aptamer sequences of some of the DIKKKOPF-1 proteins they discovered and have demonstrated in serum samples that DIKKOPF-1 protein aptamers can be used in place of antibodies for early HCC diagnosis. However, these nucleic acid aptamers to the DIKKKOPF-1 protein have some disadvantages, for example, some nucleic acid aptamers target the murine DIKKOPF-1 protein, and practical application is limited; some nucleic acid aptamers have large molecular weight, and have low binding affinity, poor specificity, low stability and the like for the DIKKKOPF-1 protein. Thus, there is a need in the art for nucleic acid aptamers having higher binding affinity to the DICKKOPF-1 protein expressed by HEK293 Cells.

Disclosure of Invention

Based on the technical problems existing in the background technology, the invention provides a nucleic acid aptamer which has high specificity, small molecular weight, stable chemical property and easy preservation and marking and can be combined with DIKKKOPF-1 protein, a conjugate of the nucleic acid aptamer, a derivative of the nucleic acid aptamer and application thereof.

The invention provides a nucleic acid aptamer capable of specifically binding and recognizing DIKKKOPF-1 protein, wherein the nucleotide sequence of the nucleic acid aptamer comprises at least one of the following three sequences:

(1) A DNA sequence shown in any one of SEQ ID NOs 1 to 2;

the nucleotide sequence shown in SEQ ID NO. 1 is as follows:

TCGGGGCAACCTGCGCCACGTTATTCTCACACGATT；

the nucleotide sequence shown in SEQ ID NO. 2 is as follows:

ACCATACGCTACGAGGGGGTGGTTAACAGGAAATAG；

(2) A DNA sequence which has more than 60% homology with the DNA sequence shown in any one of SEQ ID NO. 1-2 and specifically binds to DIKKKOPF-1 protein;

(3) An RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NO. 1-2 and specifically binding to DIKKKOPF-1 protein.

In addition, it will be appreciated by those skilled in the art that, as an improvement over the above-described techniques, a modification may be made at a position on the nucleotide sequence of the above-described aptamer, e.g., phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or ligation isotopicization, etc., provided that the thus modified aptamer sequence has desirable properties, e.g., may have an affinity for binding to a highly expressed DIKKKOPF 1 protein equal to or greater than that of the parent aptamer sequence prior to modification, or may have greater stability, although the affinity is not significantly improved.

Preferably, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the DICKKOPF-1 protein, the modification being selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium and isotopicization.

In another aspect, the invention also provides conjugates of nucleic acid aptamers. It will be appreciated by those skilled in the art that, as an improvement to the above-described technical scheme, a fluorescent substance, a radioactive substance, a therapeutic substance, biotin, digoxin, a nano-luminescent material, a small peptide, an siRNA or an enzyme label, etc. may be attached to the nucleotide sequence of the above-described nucleic acid aptamer, provided that the nucleic acid aptamer sequence thus modified has desirable properties, for example, may have affinity for binding to a highly expressed DICKKOPF1 protein equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or may have higher stability although affinity is not significantly improved.

In other words, the above nucleic acid aptamer sequence, whether partially substituted or modified, has substantially the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamer, and can be used for binding with the highly expressed DIKKKOPF 1 protein.

Preferably, the conjugate of the nucleic acid aptamer is obtained by connecting other substances for marking, detecting, diagnosing or treating on the nucleotide sequence of the nucleic acid aptamer, and the conjugate of the nucleic acid aptamer specifically binds to the DIKKKOPF-1 protein; preferably, the other substance for labeling, detecting, diagnosing or treating is at least one fluorescent label selected from FAM, radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material, small peptide, siRNA and enzyme label.

As a general inventive concept, the present invention also provides a derivative of a nucleic acid aptamer, which is obtained by modifying the backbone of the nucleotide sequence of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer to a phosphorothioate backbone, or a peptide nucleic acid modified from the nucleic acid aptamer or the conjugate of the nucleic acid aptamer, provided that the derivative has substantially the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamer, and binds to a high-expression DICKKOPF1 protein.

The term "phosphorothioate backbone" as used herein has the meaning generally understood by those of ordinary skill in the art and refers to a phosphodiester backbone of RNA and DNA nucleic acid aptamers in which the non-bridging oxygen atoms may be replaced with one or two sulfur atoms, resulting in a phosphorothioate backbone having phosphorothioate or phosphorodithioate linkages, respectively. Such phosphorothioate backbones are known to have increased binding affinity for their targets, as well as increased resistance to nuclease degradation.

The term "peptide nucleic acid" as used herein has a meaning generally understood by those of ordinary skill in the art and refers to an analogue of an artificially synthesized DNA molecule, which was first reported by Nielsen et al in 1991. An oligonucleotide mimetic linked by peptide bonds, called a peptide nucleic acid, was synthesized by replacing the sugar-phosphate backbone with an N-2- (aminoethyl) -glycine (N- (2-aminoethyl) -glycine) unit as a repeating structural unit. Since Peptide Nucleic Acids (PNAs) do not have a phosphate group as on DNA or RNA, the phenomenon of electrical repulsion between PNAs and DNA is lacking, resulting in a greater binding strength between the two than between DNA and DNA.

The present invention also provides the use of said aptamer or said aptamer conjugate or said aptamer derivative as a general inventive concept, selected from any one or more of the following:

(1) Purifying the DIKKKOPF-1 protein or detecting the DIKKOPF-1 protein;

(2) DIKKKOPF-1 expressing cells, tissues or living body localization imaging;

(3) Capturing cells or exosomes expressing DICKKOPF-1;

(4) Immunotherapy in tumor treatment.

The invention also provides the application of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer or the derivative of the nucleic acid aptamer in preparing medicines for targeting tumors as a general inventive concept.

In one embodiment, the nucleic acid aptamer of the invention, a conjugate thereof or a derivative thereof, preferably the nucleic acid aptamer of the invention, may be used for the purification or detection of the DICKKOPF-1 protein or for the detection of the expression level of DICKKOPF1 in tumor tissue of a subject.

The present invention also provides a kit comprising the nucleic acid aptamer or the conjugate of the nucleic acid aptamer or the derivative of the nucleic acid aptamer as a general inventive concept.

As a general inventive concept, the present invention also provides the use of said aptamer or said conjugate of a aptamer or said derivative of a aptamer in the preparation of a kit, wherein said kit is for use selected from any one or more of the following:

(1) Purifying the DIKKKOPF-1 protein or detecting the DIKKOPF-1 protein;

(2) DIKKKOPF-1 expressing cells, tissues or living body localization imaging;

(3) Capturing cells or exosomes expressing DICKKOPF-1;

(4) Inhibit tumor proliferation and metastasis;

(5) Activating lymphocytes and promoting cytokine release.

The invention uses ligand systematic evolution (SELEX) technology of in vitro index enrichment to screen and obtain the nucleic acid aptamer specifically combined with the high-expression DICKKKOPF-1 protein. Specifically, the invention designs and synthesizes a random single-stranded DNA library and corresponding primers, which are used for screening nucleic acid aptamers which have high specificity, small molecular weight, stable chemical property and easy preservation and marking and can be combined with high-expression DIKKKOPF-1 protein, thereby screening and obtaining a plurality of nucleic acid aptamers which are specifically combined with the DIKKOPF-1 protein, and detecting the combination ability of the nucleic acid aptamers and the DIKKOPF-1 protein. The screening procedure is shown in figure 1.

The beneficial effects of the invention are as follows:

the aptamer, the conjugate and the derivative thereof provided by the invention are highly specifically combined with DIKKKOPF-1 protein, and have the advantages of small molecular weight, stable chemical property and easy preservation and marking.

Drawings

FIG. 1 is a flow chart of the screening of nucleic acid aptamers that specifically bind to the recognition DIKKKOPF-1 protein according to the invention.

FIG. 2 shows the detection results of monoclonal affinity detection by the aptamer DIKKKOPF-1 Apt06 SPR (surface plasmon resonance).

FIG. 3 shows the detection results of monoclonal affinity by the aptamer DIKKKOPF 1Apt43 SPR (surface plasmon resonance).

Detailed Description

The technical scheme of the invention is described in detail through specific embodiments.

The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the examples described below, unless otherwise specified, are all conventional biochemical reagents and are commercially available.

In the following examples, DICKKOPF-1 protein was purchased from Beijing Yiqiao Shenzhou technologies and technologies Inc., cat No.: 10170-H08H.

EXAMPLE 1 screening of ssDNA nucleic acid aptamers that specifically bind to DIKKKOPF-1 protein

1. Random single stranded DNA libraries and primers shown in the following sequences were synthesized:

random single-stranded DNA library:

5-TTCAGCACTCCACGCATAGCNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNCCTATGCGTGCTACCGTGAA-3’

wherein "36N" represents a sequence of 36 arbitrary nucleotide bases joined together. The library was synthesized by the division of biological engineering (Shanghai).

Primer information is shown in Table 1 and is synthesized by Nanjing Jinsri Biotechnology Co.

Table 1 primers and sequences thereof

Wherein S in the primer name represents a forward primer, A in the primer name represents a reverse primer, 19A in the sequence represent a polyA tail consisting of 19 adenylates (A), and "Spacer 18" represents an 18-atom hexaethyleneglycol Spacer. The structural formulas of the three "Spacer 18" are shown in formulas I-III below. The structural formula of the Spacer 18 used in the 3' -end primer is shown in the formula I.

The primers were each prepared with DPBS buffer (NaCl: 8g/L, KCl:0.2g/L, na) ₂ HPO ₄ ：1.15g/L，KH ₂ PH ₄ :0.2g/L，CaCl ₂ :0.1g/L，MgCl ₂ 6H2O:0.1g/L; pH 7.4) to prepare a 100uM stock solution, and storing the stock solution at-20 ℃ for later use.

2. Magnetic bead method screening

The screening was performed by a magnetic bead method for six rounds of screening, each round of screening being shown in Table 2.

TABLE 2DICKKOPF-1 protein aptamer screening

The specific screening method is as follows:

1) Carboxyl magnetic bead immobilized DIKKKOPF-1 protein

Mu.l of carboxyl beads (Invitrogen, dynabeadsTMMyOneTMCarboxylic Acid, # 65012) were taken, washed 4 times with 200. Mu.l of ultrapure water, and the beads were magnet-fished, and the supernatant was removed. Mixing prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) in equal volume, adding into magnetic beads, incubating at 25 ℃ for 20 min to activate carboxyl groups on the surfaces of the magnetic beads, and washing the magnetic beads with DPBS buffer for 2 times for later use.

Mu.l of DIKKKOPF-1 protein (concentration: 0.5 mg/ml) was added to 160. Mu.l of sodium acetate buffer solution having pH of 5.0, and the mixture was then added to the above-mentioned activated magnetic beads. Incubation was performed at 25℃on a vertical mixer for 60min, and DIKKKOPF-1 protein was coupled to the surface of the magnetic beads via amino groups on the surface of the protein.

After the coupling, the coupling tube was placed on a magnetic rack, the supernatant was removed, 100. Mu.l of 1M ethanolamine pH8.5 was added to the beads, incubated on a vertical mixer at 25℃for 10min, and unreacted activation sites on the surface of the beads were blocked. Placing on a magnetic rack, and absorbing and discarding the sealing liquid. The beads were washed 4 times with 200. Mu.l DPBS and labeled MB-DICKKKOPF-1.

2) Reverse screen

The BSA protein was directly added to the library for reverse screening and beads (labeled MB-BSA) with the BSA protein attached thereto were used for reverse screening, and the method for coupling the BSA protein was the same as for coupling the DIKKKOPF-1 protein. BSA protein concentration was 0.5mg/ml, diluted with 10mM NaAC solution pH 4.0. Each round of bead screening was counter-screened with BSA counter-screening protein beads prior to the forward screening targeting DICKKOPF-1 protein, the counter-screening procedure being as follows: the prepared single-stranded nucleotide library was subjected to renaturation, then incubated with 50. Mu.l MB-BSA magnetic beads, and incubated at 25℃for 30min on a vertical rotator. Placing the mixture on a magnetic rack, collecting supernatant, and performing positive screening on the supernatant serving as a single-stranded nucleotide library and MB-DICKKOPF-1 magnetic beads.

3) Magnetic bead screening

1OD random single-stranded nucleotide library was taken, centrifuged at 14000rpm for 10 minutes, the library was centrifuged to the bottom of the tube, dissolved to 10. Mu.M with DPBS buffer, and split-packed into PCR tubes for renaturation treatment. The treatment process is as follows: the PCR instrument was programmed to hold at 95℃for 10 minutes, the purpose of this step being to unwind the folded strand, then at 4℃for 5 minutes, then at 25℃for 5 minutes. The resulting treated library was added to 50. Mu.l MB-BSA beads, mixed and incubated on a vertical mixer at 25℃for 30 minutes. Placing the mixture on a magnetic rack, collecting supernatant, marking the supernatant as Pool-, and carrying out positive screening on the supernatant serving as a single-stranded nucleotide library and MB-DICKKKOPF-1 magnetic beads.

The library after reverse screening was added to 50. Mu.l MB-DICKKKOPF-1 magnetic beads and incubated on a vertical mixer for 50 minutes at 25 ℃. The supernatant was removed and the beads were retained and washed 4 times with 200 μl DPBS. The washed beads were added to 200. Mu.l of DPBS in a boiling water bath for 10min, and the supernatant was collected and labeled Elutation-DICKKKOPF-1.

Amplification was performed by emulsion PCR (ePCR) using the nucleic acid molecule of Elutation-DIKKKKOPF-1 as a template. The method comprises the following steps: all templates were added to 2ml PCR mix and mixed well, 4 volumes of ePCR micro-droplets were added to generate oil, and the emulsion was prepared by vortexing. The emulsion was divided into 100. Mu.l/tube and added to the PCR tube under the following amplification conditions: pre-denaturation at 95℃for 2 min, denaturation at 95℃for 60 sec, annealing at 60 sec, elongation at 72℃for 60 sec, total of 35 cycles, preservation at 4 ℃. ePCR microdroplet generation oil was purchased from Agropmai (Aptamy) Biotechnology Inc. (product number: EPO-100), and the formulation of PCR mix is shown in Table 3.

TABLE 3ePCR mix formulation

Reagent(s)	Total volume of 1000. Mu.l
		ddH2O	866μl
Pfu enzyme buffer 10 ×	100μl
		dNTPmix(10mM)	20μl
Forward primer libP1S1-FAM (100. Mu.M)	5μl
		Reverse primer libP1A2-ployA (100. Mu.M)	5μl
Pfu enzyme	4μl(200U)

Purification of the amplified product with n-butanol: collecting all the ePCR products in a 15ml sharp bottom centrifuge tube, adding n-butanol with the volume of 2 times, and vibrating on a vortex mixer to fully mix; a bench centrifuge, 9000rpm (revolutions per minute) at 25 ℃ for 10 minutes; the upper phase (n-butanol) was removed to give a concentrated PCR amplification product in a volume ratio of 1:1 adding TBE/urea denaturation buffer, boiling denaturation for 15 min to denature DNA, then ice-bath for 1 min, subjecting all samples to urea-denatured polyacrylamide gel electrophoresis at 400V voltage until bromophenol blue reaches the bottom of the gel, separating the lengthened FAM-labeled strand from the inverted strand, and formulating urea-denatured polyacrylamide gel as shown in Table 4.

TABLE 4 modified polyacrylamide gel formulations

Composition of the components	Dosage of
		Modified PAGE gel mixed solution	5ml
10％APS	40μl
		TEMED	10μl

Cutting gel to recover FAM marked chain: the gel was taken out and placed on a plastic film, ex (nm): 495, em (nm): 517 detecting the required FAM-labeled ssDNA; the target band was cut directly with a clean blade, the strip was transferred to a 1.5ml EP tube and triturated, and 1ml ddH was added ₂ The ssDNA in the gel was transferred to the solution 10 minutes after O in a boiling water bath, and the gel was centrifuged to remove fragments, leaving a supernatant. The supernatant was concentrated with n-butanol: collecting the supernatant of all boiled gums, adding n-butanol with the volume of 2 times, and vibrating on a vortex mixer to be fully and uniformly mixed; a bench centrifuge, 9000rpm (revolutions per minute) at 25 ℃ for 10 minutes; removing the upper phase (n-butanol) to obtain concentrated ssDNA single strand, and dialyzing overnight with 3KD dialysis bag to obtain library for next round of screening;

the magnetic bead method is repeatedly screened for 6 rounds, the secondary library obtained in the previous operation is used as an initial nucleic acid library in each operation, SPR is used for detecting the change of the recognition capability of the DNA single-chain library to the DIKKKOPF-1 protein in the screening process, and when the recognition capability of the DNA single-chain library to the DIKKKOPF-1 protein meets the requirement, namely, the binding capability of the screened DNA single-chain library to a target is higher than that of the library which is screened to be initially input, and the obtained product is subjected to clone sequencing analysis to finally obtain the nucleic acid aptamer.

In the screening method, the screening pressure can be increased round by round so as to improve the enrichment degree of the screening nucleic acid aptamer and shorten the screening process. The step of increasing the screening pressure comprises the steps of reducing the amount of the single-stranded DNA library, the amount of the target protein and the incubation time of the single-stranded DNA library and the target protein, increasing the cleaning time, the cleaning times and increasing the amount of the anti-screening magnetic beads.

3. Affinity detection

Analyzing and identifying the aptamer obtained after multiple screening, cloning, sequencing and analyzing the obtained enriched library product, selecting a plurality of sequences, synthesizing by Shanghai engineering, and detecting affinity.

In the subsequent detection, the 2 sequences are determined to have strong binding capacity, the nucleic acid aptamer shown in SEQ ID NO. 1-2 is obtained after the 2 sequences are truncated, and the nucleic acid aptamer has ideal affinity for binding to the DIKKKOPF-1 protein after verification, and is named as DIKKOPF-1 Apt06 and DIKKOPF-1 Apt43 respectively.

Example 2: surface Plasmon Resonance (SPR) detection of affinity of DIKKKOPF-1 nucleic acid aptamer to DIKKOPF-1 protein

1. The above-mentioned synthetic nucleic acid aptamers DIKKKOPF-1 Apt06 (SEQ ID NO: 1) and DIKKOPF-1 Apt43 (SEQ ID NO: 2) were diluted with DPBS buffer respectively to give: 0.390625nM, 7.8125nM 15.625nM, 31.25nM, 62.5nM, 125nM, 250nM.

2. The DIKKKOPF-1 protein was coupled to the CM5 carboxyl chip surface: CM5 chip was washed with 50mM NaOH, 20. Mu.l was injected at a flow rate of 10. Mu.l/min, and then 50. Mu.l of activated chip was injected at a flow rate of 5. Mu.l/min by mixing equal volumes of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) with each other. Dikkopf-1 protein was diluted with 10mM sodium acetate, pH 5.0, to a final concentration of 50. Mu.g/mL, and was injected at a volume of 50. Mu.L, at a flow rate of 5. Mu.L/min, and at a protein-coupled amount of 5000Ru. After the sample injection is completed, the chip is blocked by ethanolamine, the flow rate is 5 mu L/min, and the sample injection is 50 mu L.

3. And (3) detection: the kinetic detection parameters are set by using a surface plasmon resonance (GE Healthcare, model: biacore T200), 30 mu L/min is injected for 3min, 30 mu L/min is dissociated for 5min, 1M NaCl30 mu L/min is regenerated for 0.5min, and the diluted nucleic acid aptamers DICKKKOPF-1 Apt06 and DICKKOPF-1Apt43 with various concentrations are sequentially injected.

The affinity detection data for the aptamer DIKKKOPF-1 Apt06 and DIKKOPF-1 Apt43 are shown in FIGS. 2 and 3. As can be seen from FIGS. 2 and 3, strong binding to DIKKKOPF-1 protein was detected by SPR apparatus for both DIKKOPF-1 Apt06 and DIKKOPF-1 Apt43, with KD values of 8.02nM and 17.81nM, respectively.

The foregoing is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art, who is within the scope of the present invention, should make equivalent substitutions or modifications according to the technical scheme of the present invention and the inventive concept thereof, and should be covered by the scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to a recognition DICKKOPF-1 protein, wherein the nucleotide sequence of the nucleic acid aptamer comprises at least one of the following three sequences:

(1) A DNA sequence shown in any one of SEQ ID NOs 1 to 2;

the nucleotide sequence shown in SEQ ID NO. 1 is as follows:

TCGGGGCAACCTGCGCCACGTTATTCTCACACGATT；

the nucleotide sequence shown in SEQ ID NO. 2 is as follows:

ACCATACGCTACGAGGGGGTGGTTAACAGGAAATAG；

2. The aptamer that specifically binds to recognize the DICKKOPF-1 protein of claim 1, wherein the nucleotide sequence of the aptamer is modified and the modified aptamer specifically binds to the DICKKOPF-1 protein, the modification selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopicization.

3. A conjugate of a nucleic acid aptamer, characterized in that it is obtained by ligating the nucleotide sequence of the nucleic acid aptamer according to claim 1 or 2 with other substances for labeling, detection, diagnosis or treatment, and the conjugate of a nucleic acid aptamer specifically binds to the DICKKOPF-1 protein; preferably, the other substance for labeling, detecting, diagnosing or treating is at least one fluorescent label selected from FAM, radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material, small peptide, siRNA and enzyme label.

4. A derivative of a nucleic acid aptamer, characterized in that it is obtained by modifying the backbone of the nucleotide sequence of the nucleic acid aptamer of claim 1 or 2 or the conjugate of the nucleic acid aptamer of claim 3 into a phosphorothioate backbone, or a peptide nucleic acid modified by the nucleic acid aptamer of claim 1 or 2 or the conjugate of the nucleic acid aptamer of claim 3, and the derivative of the nucleic acid aptamer specifically binds to the DICKKOPF-1 protein.

5. Use of a nucleic acid aptamer according to claim 1 or 2 or a conjugate of a nucleic acid aptamer according to claim 3 or a derivative of a nucleic acid aptamer according to claim 4, selected from any one or more of the following:

(1) Purifying the DIKKKOPF-1 protein or detecting the DIKKOPF-1 protein;

(2) DIKKKOPF-1 expressing cells, tissues or living body localization imaging;

(3) Capturing cells or exosomes expressing DICKKOPF-1;

(4) Immunotherapy in tumor treatment.

6. Use of a nucleic acid aptamer according to claim 1 or 2 or a conjugate of a nucleic acid aptamer according to claim 3 or a derivative of a nucleic acid aptamer according to claim 4 for the preparation of a medicament for targeting a tumor.

7. A kit comprising the aptamer of claim 1 or 2 or the conjugate of the aptamer of claim 3 or the derivative of the aptamer of claim 4.

8. Use of a nucleic acid aptamer according to claim 1 or 2 or a conjugate of a nucleic acid aptamer according to claim 3 or a derivative of a nucleic acid aptamer according to claim 4 for the preparation of a kit for use selected from any one or more of the following:

(1) Purifying the DIKKKOPF-1 protein or detecting the DIKKOPF-1 protein;

(2) DIKKKOPF-1 expressing cells, tissues or living body localization imaging;

(3) Capturing cells or exosomes expressing DICKKOPF-1;

(4) Inhibit tumor proliferation and metastasis;

(5) Activating lymphocytes and promoting cytokine release.