CN115386581A - Aptamer specifically binding to OX40 protein and application thereof - Google Patents

Abstract

The invention discloses an aptamer specifically binding to OX40 protein, which comprises at least one of the following three sequences: (1) a DNA sequence shown by any one of SEQ ID NO 1-4; (2) A DNA sequence which has more than 60% homology with the DNA sequence shown by any one of SEQ ID NO 1-4 and specifically binds to OX40 protein; (3) An RNA sequence transcribed from the DNA sequence set forth in any of SEQ ID NO 1-4 and specifically binding to OX40 protein. The invention also discloses the application of the aptamer, the conjugate and the derivative thereof. The aptamers, conjugates and derivatives thereof provided by the invention bind to OX40 protein with high specificity, and have the advantages of small molecular weight, stable chemical property, and easiness in storage and labeling.

Description

Aptamer specifically binding to OX40 protein and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to an aptamer specifically binding to OX40 protein and application thereof.

Background

T cell activation is mediated not only by antigenic stimulation of the T cell receptor, but also by induction of costimulatory signals by certain costimulatory molecules, the LES of the Tumor Necrosis Factor (TNF) superfamily of costimulatory molecules playing an important role in regulating immune responses and inducing bidirectional signals. OX40 (CD 134) and OX40L (CD 252), which are members of the Tumor Necrosis Factor Receptor Superfamily (TNFRSF) and the Tumor Necrosis Factor Superfamily (TNFSF), play an important role in the proliferation and survival of T cells, and are also abnormally expressed in tumors, infectivity, inflammation and autoimmune diseases.

OX40, also known as Tnfrfsf 4 (membrane 4), has a costimulatory function, is a 50kD glycoprotein with a cytoplasmic tail, a transmembrane domain and extracellular domain. Mainly on the surface of activated CD4+ and CD8+ T cells, and OX40L binding can stimulate activation of CD8+ T cells. Through the co-activation effect of OX40/OX40L signals, the function of T cells, including the production, proliferation of cytokines and survival of T cells, will be further enhanced. OX40 antibody activator (Agonist) can reduce Tregs in tumor and improve antitumor activity. The presently published data show that a variety of OX40 antibody drugs have entered the clinical research phase, that subsequently more and more OX40 antibody drugs will enter the clinical phase, that the OX40 target drug development market has great development potential, and that the feasibility of OX40/OX40L aptamers with similar functions to their antibodies for tumor immunotherapy is also widely investigated.

The aptamer (aptamer) refers to a DNA or RNA molecule obtained by screening and separating by an exponential enrichment ligand system evolution technology (SELEX), and can be combined with other targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has a wide prospect in the aspects of biochemical analysis, environmental monitoring, basic medicine, new drug synthesis and the like. Compared with an antibody, the aptamer has the advantages of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period, artificial synthesis and the like, and a series of processes such as animal immunization, feeding, protein extraction and purification and the like are omitted.

The feasibility of OX40/OX40L aptamers for tumor immunotherapy was also extensively studied based on the SELEX screening principle. Several investigators have published some of the OX40 aptamer sequences they have discovered and demonstrated their ability to resist tumor proliferation in a mouse model, and found that OX40/OX40L aptamers and OX40/OX40L antibodies have similar anti-tumor immune efficacy. However, these OX40/OX40L aptamers suffer from some drawbacks, for example, some aptamers are targeted to murine OX40/OX40L proteins and have limited practical applications; some aptamers have large molecular weight, and have low binding affinity, poor specificity, low stability and the like for OX40 protein. Thus, there is a need in the art for aptamers having higher binding affinity for human OX40/OX40L proteins.

Disclosure of Invention

Based on the technical problems of the background art, the present invention proposes an aptamer capable of binding to OX40 protein, a conjugate of the aptamer, a derivative of the aptamer, and uses thereof, which have high specificity, small molecular weight, stable chemical properties, and easy storage and labeling.

The invention provides an aptamer specifically binding to OX40 protein, and the nucleotide sequence of the aptamer comprises at least one of the following three sequences:

(1) 1-4, wherein:

1 is SEQ ID NO

TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCCCCGCATTAGGTTATGCGTGCGACGGTGAA，

2 is SEQ ID NO

TCCAGCACTCCACGCATAACTCCCGCTCCGATCGCGTGCGTTGACACCGTGTCCGGGTTATGCGTGCGACGGTGAA，

SEQ ID NO 3 is

TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTGCGCAAACCAGTTATGCGTGCGACGGTGAA，

SEQ ID NO. 4 is

TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCGCCCGGACGAGTTATGCGTGCGACGGTGAA；

(2) A DNA sequence which has homology of 60% or more with the DNA sequence shown in any one of SEQ ID NO. 1-4 and specifically binds to OX40 protein, preferably 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more;

(3) An RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NOS 1-4 and specifically binding to an OX40 protein.

In addition, it will be appreciated by those skilled in the art that modifications may be made to the nucleic acid aptamers described above at a position in their nucleotide sequences, for example, phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or linking isotopologue, as modifications to the above-described protocols, provided that the aptamer sequences so modified have desirable properties, for example, may have an affinity for binding to a highly expressed OX40 protein that is equal to or greater than the parent aptamer sequence prior to modification, or may have greater stability, although the affinity is not significantly increased.

In another aspect, the invention also provides conjugates of aptamers. It will be appreciated by those skilled in the art that as an improvement to the above-described embodiments, a fluorescent label, such as a radioactive substance, a therapeutic substance, biotin, digoxigenin, a nano-luminescent material, a small peptide, an siRNA or an enzyme label, or the like, may be attached to the nucleotide sequence of the aptamer, provided that the aptamer sequence so modified has desirable properties, e.g., may have an affinity for binding to a highly expressed OX40 protein that is equal to or greater than the parent aptamer sequence prior to modification, or may have greater stability, although the affinity is not significantly increased.

In other words, the aptamer sequences, whether partially substituted or modified, have substantially the same or similar molecular structure, physicochemical properties and functions as the original aptamer and are applicable to binding to a highly expressed OX40 protein.

As a general inventive concept, the present invention also provides a derivative of an aptamer obtained by modifying the backbone of the nucleotide sequence of the aptamer or a conjugate of the aptamer into a phosphorothioate backbone or a peptide nucleic acid obtained by modifying the aptamer or the conjugate of the aptamer, provided that the derivatives all have substantially the same or similar molecular structure, physicochemical properties and functions as the original aptamer and all bind to a highly expressed OX40 protein.

The term "phosphorothioate backbone" as used herein has the meaning generally understood by those of ordinary skill in the art and means that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers may be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate linkages, respectively. Such phosphorothioate backbones are known to have increased binding affinity for their targets, as well as enhanced resistance to nuclease degradation.

The term "peptide nucleic acid" as used herein has the meaning generally understood by those of ordinary skill in the art and refers to an artificially synthesized analogue of a DNA molecule, first reported by Nielsen et al in 1991. Peptide-bonded oligonucleotide mimetics, termed peptide nucleic acids, were synthesized using N-2- (aminoethyl) -glycine (N- (2-aminoethyl) -glycine) units as repeat building blocks instead of the sugar-phosphate backbone. Since Peptide Nucleic Acids (PNAs) do not have phosphate groups as on DNA or RNA, PNAs lack electrical repulsion with DNA, resulting in a stronger bond between the two than between DNA and DNA.

The present invention also provides, for a general inventive concept, the use of the aptamer or the conjugate of the aptamer or the derivative of the aptamer in any one of the group consisting of:

(1) Purifying OX40 protein or detecting OX40 protein;

(2) OX40 expressing cells, tissues, or in vivo localized imaging;

(3) Capturing OX 40-expressing cells or exosomes;

(4) Immunotherapy in the treatment of tumors.

The invention also provides, as a general inventive concept, the use of said aptamer or a conjugate of said aptamer or a derivative of said aptamer for the preparation of a medicament for targeting a tumor.

In one embodiment, the aptamer of the invention, conjugate thereof or derivative thereof, preferably the aptamer of the invention, can be used for OX40 protein purification or detection to detect the expression level of OX40 in tumor tissue of a subject.

As a general inventive concept, the present invention also provides a kit comprising the aptamer or the conjugate of the aptamer or the derivative of the aptamer; preferably, the kit comprises any one or two of the aptamers represented by SEQ ID NOS 1-4, conjugates thereof or derivatives thereof; more preferably, the kit comprises any one or two aptamers as shown in SEQ ID NOS: 1-4.

As a general inventive concept, the present invention also provides the use of said aptamer or a conjugate of said aptamer or a derivative of said aptamer in the preparation of a kit for any one selected from the group consisting of:

(1) Purifying OX40 protein or detecting OX40 protein;

(2) OX40 expressing cells, tissues, or in vivo localized imaging;

(3) Capturing OX 40-expressing cells or exosomes;

(4) Inhibiting tumor proliferation and metastasis;

(5) Activating lymphocyte and promoting cytokine release.

The invention uses in vitro exponential enrichment ligand system evolution (SELEX) technology to screen and obtain the aptamer specifically binding with high expression OX40 protein. Specifically, the present inventors designed and synthesized a random single-stranded DNA library and corresponding primers for screening aptamers capable of binding to a highly expressed OX40 protein with high specificity, small molecular weight, stable chemical properties, easy storage and labeling, thereby screening several aptamers capable of specifically binding to OX40 protein and examining their binding ability to OX40 protein.

The invention has the following beneficial effects:

the aptamer, the conjugate and the derivative thereof provided by the invention have high specificity in binding OX40 protein, and have the advantages of small molecular weight, stable chemical property, and easiness in storage and labeling.

Drawings

FIG. 1 is data (SPR data) showing the affinity detection of OX40-29 and OX40 proteins obtained by screening in example 1 of the present invention.

FIG. 2 is data on the measurement of the affinity of OX40-92 for OX40 protein (SPR data) screened in example 1 of the present invention.

FIG. 3 is data (SPR data) showing the affinity assay of OX40-10 to OX40 protein, which was screened in example 1 of the present invention.

FIG. 4 is data (SPR data) showing the affinity detection of OX40-61 to OX40 protein obtained by screening in example 1 of the present invention.

FIG. 5 shows the results of dot blot experiments with OX 40-92.

Detailed Description

The technical means of the present invention will be described in detail below with reference to specific examples.

The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples are all conventional biochemical reagents, and are commercially available, unless otherwise specified.

Example 1: screening of ssDNA aptamers that specifically bind to OX40 protein

1. A random single-stranded DNA library and primers shown by the following sequences were synthesized:

random single-stranded DNA library:

5’-TCCAGCACTCCACGCATAAC-36N-GTTATGCGTGCGACGGTGAA-3’

wherein "36N" represents a sequence in which 36 arbitrary nucleotide bases are linked. The library was synthesized by Biotechnology engineering (Shanghai) GmbH.

Primer information is as shown in table 1, synthesized by tsry biotechnology limited of tokyo.

TABLE 1 primers and sequences thereof

Wherein S in the name of the primer represents a forward primer, A in the name of the primer represents a reverse primer, 19A in the sequence represent a polyA tail consisting of 19 adenylic acid (A), and "Spacer 18" represents an 18-atom hexaethyleneglycol Spacer. The structural formulas of the three types of 'Spacer 18' are shown as the following formulas I-III. The structural formula of the ' Spacer 18 ' used in the 3' end primer is shown as a formula I.

Primers were separated from the primer by MES buffer (MES: 100mM, naCl ₂ ：1mM，CaCl ₂ :1mM; pH6.0, 25 ℃) to prepare 100 mu M stock solution, and the stock solution is stored at-20 ℃ for later use.

2. Screening by magnetic bead method

Screening by the magnetic bead method is adopted, six rounds of screening are performed in total, and the screening process of each round is shown in table 2.

TABLE 2 OX40 protein aptamer screening protocol

The specific screening method is as follows:

1) Carboxyl magnetic bead fixed OX40 protein

50. Mu.l of carboxyl magnetic beads (Invitrogen, dynabeads) were taken ^TM MyOne ^TM Carboxylic Acid, # 65012), washed 4 times with 200. Mu.l of ultrapure water, and the magnetic beads were magnetically fished to remove the supernatant. And mixing the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) in equal volume, adding the mixture into magnetic beads, incubating the mixture at 25 ℃ for 20 minutes to activate carboxyl on the surfaces of the magnetic beads, and washing the magnetic beads for 2 times by using MES buffer solution for later use.

80. Mu.l of OX40 protein (which was subjected to molecular cloning using a gene Sequence of amino acids 18 to 132 of NCBI Reference Sequence: NP-054862.1 as a template and expressed using E.coli) (concentration: 0.1 mg/ml) was added to 20. Mu.l of a glycine hydrochloride solution having pH 3.0, mixed well, added to the above-mentioned activated magnetic beads, incubated at 25 ℃ on a vertical mixer for 50min, and the OX40 protein was coupled to the surfaces of the magnetic beads via amino groups on the protein surfaces.

After the coupling, the coupling tube is placed on a magnetic frame, the supernatant is removed by suction, 100. Mu.l of 1M ethanolamine with pH8.5 is added into the magnetic beads, the mixture is incubated on a vertical mixer at 25 ℃ for 10min, and the unreacted activation sites on the surfaces of the magnetic beads are blocked. Placing on a magnetic frame, and absorbing and discarding the sealing liquid. The beads were washed 4 times with 200. Mu.l MES and labeled MB-OX40.

2) Reverse sieve

Magnetic beads (marked as MB-BSA) connected with BSA protein are used for back screening, and the coupling method of the BSA protein is the same as that of OX40 protein. The BSA protein concentration was 0.5mg/ml, diluted with 10mM NaAC solution at pH 4.0. In each round of magnetic bead screening, BSA (bovine serum albumin) reverse-screening protein magnetic beads are used for reverse screening before positive screening which takes OX40 protein as a target, and the reverse screening steps are as follows: the prepared single-stranded nucleotide library was denatured, incubated with 50. Mu.l of MB-BSA magnetic beads, and incubated at 25 ℃ for 30min on a vertical rotator. And (4) placing the mixture on a magnetic frame, collecting supernatant, and performing positive screening on the supernatant serving as a single-stranded nucleotide library and MB-OX40 magnetic beads.

3) Magnetic bead screening

A1 OD random single-stranded nucleotide library was centrifuged at 14000rpm for 10 minutes, and the library was centrifuged to the bottom of the tube, dissolved in MES buffer solution to 10. Mu.M, and dispensed into a PCR tube for annealing treatment. The treatment process is as follows: the PCR instrument was programmed for 10 minutes at 95 ℃ in order to unwind the folded strands, then for 5 minutes at 4 ℃ and then for 5 minutes at 25 ℃. The resulting treated library was added to 50. Mu.l of MB-BSA magnetic beads, mixed well and incubated on a vertical mixer at 25 ℃ for 30 minutes. And (4) placing the mixture on a magnetic frame, collecting the supernatant, marking the supernatant as pool-, and performing positive screening on the supernatant serving as a single-stranded nucleotide library and MB-OX40 magnetic beads.

The back-screened library was added to 50. Mu.l MB-OX40 magnetic beads and incubated for 50 minutes at 25 ℃ on a vertical mixer. Place on magnetic stand, aspirate the supernatant, retain the beads, wash the beads 4 times with 200 μ l MES. The washed magnetic beads were added into a 200. Mu.l MES boiling water bath for 10min, and the supernatant was collected and labeled as elusion-OX 40.

Amplification was performed by emulsion PCR (ePCR) using nucleic acid molecules in the elusion-OX 40 as templates. The method comprises the following steps: adding all the template solution-OX 40 into 2ml of PCR mix, mixing uniformly, adding ePCR micro-droplets with 4 times of volume to generate oil, and performing vortex to prepare emulsion. The emulsion was added to the PCR tube in 100. Mu.l/tube under the following amplification conditions: pre-denaturation at 95 ℃ for 2 min, denaturation at 95 ℃ for 60 sec, annealing at 60 ℃ for 60 sec, extension at 72 ℃ for 60 sec for 35 cycles, and storage at 4 ℃. ePCR microdroplet generating oil was purchased from Onputtoma (Aptamy) Biotech Inc. (Cat. No.: EPO 100), anhui, and the formulation of PCR mix is shown in Table 3.

TABLE 3 ePCRmix formulations

Reagent	Total volume 1000. Mu.l
		ddH 2 O	866μl
10 pfu enzyme buffer	100μl
		dNTPmix(10mM)	20μl
Forward primer lib18S1-FAM (100. Mu.M)	5μl
		Reverse primer lib18A2-ployA (100. Mu.M)	5μl
Pfu enzyme	4μl(200U)

The amplification product was purified with n-butanol: collecting all ePCR products in a 15ml pointed-bottom centrifuge tube, adding n-butanol with 2 times of volume, and oscillating on a vortex mixer to fully mix uniformly; a bench centrifuge, centrifuging at 9000rpm (revolutions per minute) at 25 ℃ for 10 minutes; removing the upper phase (n-butanol) to obtain a concentrated PCR amplification product, and mixing the concentrated PCR amplification product with the water according to a volume ratio of 1:1 into TBE/urea denaturing buffer, boiling for denaturing for 15 min to denature DNA, then ice-cooling for 1 min, subjecting all samples to urea denaturing polyacrylamide gel electrophoresis at 400V until bromophenol blue reaches the bottom of the gel, separating the lengthened FAM-labeled strand from the reversed strand, 7M urea denaturing polyacrylamide gel formulation as in Table 4.

TABLE 4 modified Polyacrylamide gel formulations

Composition (A)	Dosage of
		Urea	3.78g
40% polyacrylamide	1.8ml
		5*TBE	1.8ml
ddH 2 O	2.25ml
		10％APS	60μl
TEMED	15μl

Gel cutting to recover FAM labeled chains: the gel was taken out and placed on a plastic film, ex (nm): 495, em (nm): 517 detecting the needed ssDNA with FAM label; the target strip was cut off directly with a clean blade, the strip was transferred to a 1.5ml EP tube and triturated, 1ml ddH was added ₂ After O, the ssDNA in the gel was transferred to the solution in a boiling water bath for 10 minutes, and the gel was centrifuged to remove debris, leaving the supernatant. Purifying the supernatant by using n-butanol, wherein the method comprises the following steps: adding n-butanol with 2 times of volume, and shaking on a vortex mixer to fully mix; a bench centrifuge, centrifuging at 9000rpm (revolutions per minute) at 25 ℃ for 10 minutes; removing the upper phase (n-butanol), dialyzing the obtained DNA single strand with 3KD dialysis bag overnight, and selecting the DNA single strand as the one for the next round of screeningA library;

and (3) repeatedly screening for 6 rounds by using a magnetic bead method, wherein each operation is performed by taking a secondary library obtained in the previous operation as an initial nucleic acid library, detecting the change of the recognition capability of the DNA single-chain library on the OX40 protein by using SPR in the screening process, and when the recognition capability of the DNA single-chain library on the OX40 protein meets the requirement, namely the binding capacity of the screened DNA single-chain library and a target is higher than that of the library initially put into the screening, and finally obtaining the nucleic acid aptamer by carrying out clone sequencing analysis on the obtained product.

In the screening method, the screening pressure can be increased by turns so as to improve the enrichment degree of the screened aptamer and shorten the screening process. The increase of the screening pressure comprises the reduction of the amount of the single-stranded DNA library, the amount of the target protein and the incubation time of the single-stranded DNA library and the target protein, the increase of the washing time and the washing frequency and the increase of the amount of the magnetic reverse screening beads.

3. Analyzing and identifying the aptamer obtained after multiple screening, carrying out clone sequencing analysis on the obtained enriched library product, selecting a plurality of sequences to be synthesized from Shanghai, and detecting the affinity.

In subsequent tests, 4 sequences are determined to have strong binding capacity, aptamers shown in SEQ ID NO 1-4 are obtained after the 4 sequences are truncated, and ideal affinity for binding OX40 protein is verified and the aptamers are named as OX40-29, OX40-92, OX40-10 and OX40-61 respectively.

Example 2: surface Plasmon Resonance (SPR) detection of the affinity of OX40 aptamers to OX40 proteins

1. The Shanghai synthesized nucleic acid aptamers OX40-29 (SEQ ID NO: 1), OX40-92 (SEQ ID NO: 2), OX40-10 (SEQ ID NO: 3) and OX40-61 (SEQ ID NO: 4) were diluted with MES buffer to: 0.390625, 1.5625, 12.5, 25, 50nM; and 0.78125, 1.5625, 3.125, 6.25, 12.5nM.

2. Coupling of OX40 protein prepared in example 1 to the BSA chip surface: the chip was washed with 50mM NaOH and injected at a flow rate of 10. Mu.l/min, then 50. Mu.l of activated chip was injected after mixing equal volumes of two reagents, EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution), at a flow rate of 5. Mu.l/min. OX40 protein is diluted by 10mM sodium acetate with pH4.0 to the final concentration of 50 mug/mL, then sample injection is carried out, the sample injection volume is 50 mug L, the flow rate is 5 mug L/min, and the coupling amount of OX40 protein is 5000Ru. After the sample injection is finished, the chip is sealed by ethanolamine at the flow rate of 5 mu L/min, and the sample injection is carried out at 50 mu L.

3. And (3) detection: a surface plasma resonance instrument (GE Healthcare, model: biacore T200) is used for setting kinetic detection parameters, sample injection is carried out for 30 muL/min 3min, dissociation is carried out for 30 muL/min 5min, regeneration is carried out for 1M NaCl30 muL/min 0.5min, and diluted aptamers OX40-29 and OX40-92 with various concentrations are injected in sequence.

The affinity assay data are shown in FIGS. 1 (OX 40-29) and 2 (OX 40-92), which indicate that both OX40-29 and OX40-92 detected strong binding to OX40 protein using an SPR with KD values of 3.438nM and 0.9944nM, respectively.

Example 3 dot blot hybridization to identify the affinity of OX40-92 aptamers to OX40 protein

1. 10cm by 5cm nitrocellulose membranes (from Millipore) were used and OX40 protein was diluted with MES to the following concentrations: 0.5/0.17/0.05/0.017/0.005mg/ml. Spotting 1ul of the solution on a nitrocellulose membrane, and naturally drying. At the same time, the control protein (CD 172) was diluted to 0.5mg/ml, spotted onto membranes and air dried naturally.

2. After drying, blocking with 10% BSA at room temperature for 6 hours, washing with MES 3 times after blocking, blotting, and washing while placing on a shaker for 10 minutes each time.

3. The biotin-modified aptamer OX40-92 was diluted to 1uM and renatured: denaturation at 95 ℃ for 10min, followed by immediate ice-cooling for 5min and equilibration at room temperature for 10 min.

4. The renatured aptamers were incubated with the nitrocellulose membrane on a protein shaker for 2 hours at room temperature.

5. After the incubation, the cells were washed three times with MEST (containing 0.5% tween 20) and on a shaker for 10 minutes each time.

6. HRP-labeled streptavidin (purchased from Biyuntian, cat # A0303) was added in MES in a formulation of 1.

7. 3 MEST washes, while washing, they were placed on a shaker for 10 minutes each.

8. Mixing the following liquid A: liquid B =1 (v/v) a color developing solution (BeyoECL Star hypersensitivity ECL chemiluminescence kit, purchased from petun cloudy day, cat No. P0018A, liquid a and liquid B are kit-in-kit solutions) was added at a ratio of 1 (v/v) and developed at room temperature for 1 minute.

9. The imaging system observes and takes a picture: imageQuant with instrumentation as department of GE medical Life sciences ^TM LAS 4000 digital imaging system.

As shown in FIG. 5, the color development was significant in the experimental group, and was not observed in the control CD172 protein. This indicates that the biotin-modified aptamer OX40-92 can be used for detection of membrane-hybridized OX40 protein and does not bind to the control protein CD172, and FIG. 5 also contains the case of a gradient of the concentration of the respective protein as well as the case of the control protein. As can be seen, the color of the developed spot became lighter as the concentration of OX40 protein decreased, indicating that OX40-92 can be used for detection of membrane-hybridized OX40 protein with higher sensitivity. The aptamer obtained by the invention is not combined with the CD172 protein.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered as the technical solutions and the inventive concepts of the present invention within the technical scope of the present invention.

SEQUENCE LISTING

<110> On & P Tuo Mei Biotechnology Limited liability company

<120> nucleic acid aptamer specifically binding to OX40 protein and application thereof

<130> 2021

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 76

<212> DNA

<213> Artificial Synthesis

<400> 1

TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCCCCGCATTAGGTTATGCGTGCGACGGTGAA 76

<210> 2

<211> 76

<212> DNA

<213> Artificial Synthesis

<400> 2

TCCAGCACTCCACGCATAACTCCCGCTCCGATCGCGTGCGTTGACACCGTGTCCGGGTTATGCGTGCGACGGTGAA 76

<210> 3

<211> 76

<212> DNA

<213> Artificial Synthesis

<400> 3

TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTGCGCAAACCAGTTATGCGTGCGACGGTGAA 76

<210> 4

<211> 76

<212> DNA

<213> Artificial Synthesis

<400> 4

TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCGCCCGGACGAGTTATGCGTGCGACGGTGAA 76

Claims (8)

1. An aptamer that specifically binds to an OX40 protein, wherein the nucleotide sequence of the aptamer comprises at least one of the following three sequences:

(1) 1-4, wherein:

1 is SEQ ID NO

TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCC CCGCATTAGGTTATGCGTGCGACGGTGAA，

2 is SEQ ID NO

TCCAGCACTCCACGCATAACTCCCGCTCCGATCGCGTGCGTTGACACC GTGTCCGGGTTATGCGTGCGACGGTGAA，

SEQ ID NO 3 is

TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTG CGCAAACCAGTTATGCGTGCGACGGTGAA，

SEQ ID NO. 4 is

TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCG CCCGGACGAGTTATGCGTGCGACGGTGAA；

(2) A DNA sequence which has more than 60% homology with the DNA sequence shown in any one of SEQ ID NO 1-4 and specifically binds to OX40 protein;

(3) An RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NOS 1-4 and specifically binding to an OX40 protein.

2. The aptamer of claim 1 that specifically binds to an OX40 protein, wherein the nucleotide sequence of the aptamer is modified and the modified aptamer specifically binds to an OX40 protein, the modification being selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopolization.

3. A conjugate of a nucleic acid aptamer, which is obtained by linking another substance for labeling, detection, diagnosis or treatment to the nucleotide sequence of the nucleic acid aptamer according to claim 1 or 2, and which specifically binds to OX40 protein; preferably, the other substance for labeling, detecting, diagnosing or treating is a fluorescent label, preferably at least one of FAM, radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material, small peptide, siRNA and enzyme label.

4. A derivative of an aptamer obtained by modifying the backbone of the nucleotide sequence of the aptamer according to claim 1 or 2 or the conjugate of the aptamer according to claim 3 to a phosphorothioate backbone, or a peptide nucleic acid obtained by modifying the aptamer according to claim 1 or 2 or the conjugate of the aptamer according to claim 3, wherein the derivative of the aptamer specifically binds to an OX40 protein.

5. Use of the aptamer of claim 1 or 2 or the conjugate of the aptamer of claim 3 or the derivative of the aptamer of claim 4 in any one of the group consisting of:

(1) Purifying OX40 protein or detecting OX40 protein;

(2) OX40 expressing cells, tissues, or in vivo localized imaging;

(3) Capturing OX40 expressing cells or exosomes;

(4) Immunotherapy in the treatment of tumors.

6. Use of the nucleic acid aptamer of claim 1 or 2 or the conjugate of the nucleic acid aptamer of claim 3 or the derivative of the nucleic acid aptamer of claim 4 in the preparation of a medicament for targeting a tumor.

7. A kit comprising the aptamer of claim 1 or 2 or the conjugate of the aptamer of claim 3 or the derivative of the aptamer of claim 4.

8. Use of the aptamer of claim 1 or 2 or the conjugate of the aptamer of claim 3 or the derivative of the aptamer of claim 4 for the preparation of a kit for any one selected from the group consisting of:

(1) Purifying OX40 protein or detecting OX40 protein;

(2) OX40 expressing cells, tissues, or in vivo localized imaging;

(3) Capturing OX40 expressing cells or exosomes;

(4) Inhibiting tumor proliferation and metastasis;

(5) Activate lymphocytes and promote cytokine release.

Images