CN106957906A - A kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence - Google Patents
A kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence Download PDFInfo
- Publication number
- CN106957906A CN106957906A CN201611204857.0A CN201611204857A CN106957906A CN 106957906 A CN106957906 A CN 106957906A CN 201611204857 A CN201611204857 A CN 201611204857A CN 106957906 A CN106957906 A CN 106957906A
- Authority
- CN
- China
- Prior art keywords
- primer
- tcr
- leukemia
- minimal residual
- residual disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
Abstract
The invention belongs to biology field, more particularly to a kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence, it is characterised in that：The primer combination includes the Oligo joints of TCR 5 ', and the Oligo of TCR 3 ' (dT) primer, TCR C areas primer, label upstream and downstream primer, the kit contains primer combination as claimed in claim 1 or 2.By the anti-sense primer of the sense primer from joint to C areas, φt cell receptor is obtained（TCR）The total length information of gene order.
Description
Technical field
The invention belongs to molecular Biological Detection field, more particularly to a kind of high-flux sequence that is applied to detects T cell
The primer combination of Minimal Residual Disease of Leukemia and kit.
Background technology
Leukaemia is a class candidate stem cell malignant clone disease.Clonal leukaemia because proliferation out of control, point
Change obstacle, apoptosis mechanism a large amount of propagation accumulations in marrow and other hematopoietic tissues such as to be obstructed, and infiltrate other non-hematopoietic tissues
And organ, while suppressing normal hematopoiesis function, T cell leukaemia belongs to the malignant clone increment of T cell.
With updating for the technologies such as chemotherapy, special target treatment, HSCT (HSCT) treatment, leukaemia
Therapeutic effect increasingly improve, but recurrence is still to perplex the difficult point that leukaemia is cured, and is traced it to its cause mainly and leukaemia
Cell minimal residual disease (MRD) is relevant.It is remaining a small amount of in patient's body when MRD refers to reach complete incidence graph by inductive treatment
Leukaemia.
Recent study shows that leukemia relapse is closely related with MRD, and MRD rises can indicate the comprehensive of leukaemia in advance
Recurrence.Therefore, regular MRD inspections are to Leukemia Patients carried out using sensitivity height, high specificity and reliable and stable test method
Survey, to assessing morbid state, judging that curative effect, prediction recurrence, guiding treatment have important clinical meaning.T cell leukaemia is suffered from
Person has>50% recurrence rate, therefore periodic detection MRD is wanted, to help the treatment method of design personalized.
Detection MRD method depends on molecular immunology technology such as flow cytometer art at present
, but its sensitivity highest is only up to 10 (flowcytometry)-4The order of magnitude (0.01%), and judgement of this method to MRD results
The experiment condition in each laboratory and the personal experience of operator are largely depended on, standardization level is low, Er Qieyou
Research shows that the influence due to chemotherapeutics in chemotherapy process makes the immunophenotype of leukaemia change, i.e., " immune
Drift " phenomenon, can influence the reliability and accuracy of MRD results.
Substantial amounts of V (variable region), D (variable region), J (bonding pad) genetic fragment are in φt cell receptor on T cell locus
Each species diversity restructuring can be produced in formation.It is thin that the restructuring of this V-D-J genes imparts the unique T of each T cell oneself
Born of the same parents' acceptor (TCR), so that each TCR sequence can effectively turn into unique biomarker of a T cell clone.
Therefore the sequence composition of T cell tcr gene is sequenced, can be very good to position each T cell, including leukaemia
The T cell of canceration.And sensitivity reaches as high as 10-6(0.0001%).
Because the maximum feature of tcr gene is the random restructuring of V, D, J genetic fragment, so, for unknown gene sequence,
It is difficult to 5 ' the terminal sequences that a sense primer is used to recognize tcr gene be designed, so also TCR bases can not be expanded using round pcr
Cause and sequencing.
And the method for another TCR sequence measurement, i.e. Multiplex PCR, the partial sequence in tcr gene can only be sequenced
Information, so that sequencing gene information is imperfect.In addition, the primer of Multiplex PCR method is according to known V, J genes are set
Meter, but in cancer patient, the gene mutation of cancer cell be it is very common, if the TCR of leukaemia cancer cell generate it is prominent
Become, then the primer of known array is possible to the gene after None- identified mutation, for testing result, is easy for causing vacation
It is negative.
The content of the invention
In order to solve the above technical problems, the present invention, which provides a kind of high-flux sequence that is applied to, detects that T cell leukaemia is micro-
The primer combination of small Residual Disease and kit, T cell Minimal Residual Disease of Leukemia TCR libraries are built by high-flux sequence, with
And the cDNA joints and single pair of primer built, by the anti-sense primer of the sense primer from joint to C areas, obtain tcr gene sequence
The total length information of row.
Primer combination can effectively expand the complete sequence of tcr gene.Bis- generations of TCR sequencing library is set to build high efficiency, examination
Agent box has provided the user simple and convenient application method, stabilised efficiency.
Solve a kind of primer that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence of above technical problem
Combination, it is characterised in that：The primer, which is combined, includes the Oligo joints of TCR 5 ', the Oligo of TCR 3 ' (dT) primer, and TCR C areas draw
Thing, label upstream and downstream primer, every kind of primer sequence is as follows：
The Oligo joints of TCR 5 ', its base sequence is：5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’；
The Oligo of TCR 3 ' (dT) primer：5’TTTTTTTTTTTTTTTTTTTTGA 3’；
The end connector primer sequences of TCR 5 ' are：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C areas primer sequence is：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
Label sense primer：5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’；
Label anti-sense primer：5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC
3’；
Wherein, the index1 be ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA,
One kind in GATTCAGT, CTGTTCGT or TATACGGC；Index2 be TAGCTACT, ATTATAGC,
One kind in CCCGTACT, GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT or GTTGCTAC.
A kind of kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence, its feature in the present invention
It is：Contain the primer combination described in claim 1 or 2.
Kit also includes PCR buffer solutions, Q5High-Fidelity 2X described in the prioritization scheme of the present invention
MasterMix, remove nuclease water, AMPure XP Beads and 70% ethanol.
Kit includes described in further prioritization scheme：
(1) PCR buffer solutions：9.5μL；
(2) positive control RNA (1 μ g/ μ l)：10μL；
(3) the 10 μM of Oligo of TCR 3 ' (dT) primers：1.1μL；
(4) the 10 μM of end connectors of TCR 5 ' primers and 10 μM of TCR C areas primers：Each 1.1 μ L；
(5)Q5High-Fidelity 2X Master Mix：55μL；
(6) 10 μM of label sense primers and 10 μM of label anti-sense primers：Each 1.1 μ L；
(7) nuclease water is removed：105μL；
(8)AMPure XP Beads：88μL；
(9) 70% ethanol：165μL.
The PCR buffer solutions are made up of following system：
The preparation process of kit is purchase raw material, is then assembled into kit.All reagents can all be bought,
Primer can provide sequence and give primer Synesis Company, and they can synthesize.Ratio, loads the test tube of oneself as required, encapsulation
Into kit.
High-flux sequence detection T cell Minimal Residual Disease of Leukemia, bag are carried out using the primer in the present invention and kit
Include following steps：
(1) human blood sample 10mL is obtained in EDTA anticoagulant tubes；
(2) it is thin using lymphocyte separation medium Ficoll-1077 (Sigma Co., USA #10771) progress peripheral blood mononuclears
The separation of born of the same parents (PBMC)；
The effect of lymphocyte separation medium is that lymphocyte can be separated in whole blood, because detection object is T cell,
T cell belongs to one kind of lymphocyte, and the RNA that the cell mass after separation is obtained is to eliminate the cells such as red blood cell, blood platelet
RNA.So building the total serum IgE that storehouse uses, to include T cell RNA template purity higher.
(3) PBMC total serum IgE is extracted using Trizol method, agents useful for same is RNAzol RT (MRC companies of U.S. #
RN190)；
It is conventional method that Trizol method, which extracts RNA, also in the absence of it is characteristic or we think patent protection
Place, so I does not write out step in detail.Step is as follows：
Harvesting, is transferred in 1.5ml centrifuge tubes, adds 1ml Trizol, mixes, is stored at room temperature 5min.
0.2ml chloroforms are added, 15s is vibrated, 2min is stood.
0.5ml isopropanols are added, liquid in pipe is gently mixed, 10min is stored at room temperature.
4 DEG C of centrifugations, 12000g × 10min abandons supernatant.
The ethanol of 1ml 75% is added, gently washing precipitation.4 DEG C of centrifugations, 7500g × 5min abandons supernatant.
Natural air drying, adds 50ul DEPC H2O dissolvings, obtains lymphocyte total serum IgE.
(4) RNA reverse transcriptions are into cDNA, and simultaneously in the ends of cDNA 5 ' addition joint, and 5 ' ends are drawn when being expanded with PCR later
Thing is combined；
In reverse transcription, while adding joint, loss of the RNA during multistep reaction can be minimized.RNA is in operation
Middle stability extreme difference, is very easy to degraded, and a small amount of step can reduce degraded to the full extent, can be used for while also saving
The cDNA preparation times of amplification.
Joint is the nucleic acid linker at cDNA 5 ' ends, is the Oligo joints of TCR 5 '.
(5)PCR1:Restructuring TCR cDNA are expanded by way of single pair of primer；
(6) PCR2 and purifying：The upper of Illumina high-flux sequence instrument is added for PCR1 products (the TCR sequences after amplification)
Machine joint and label, while more upper machine gene dosage is expanded again for increase；After PCR reactions terminate, DNA is carried out using magnetic bead
Purifying.
PCR primer is typically all containing excessive primer, Taq DNA enzymatics and dNTP.The presence of these compositions will be directly affected
To processes such as follow-up library quality inspection, sequencing reactions, purifying can remove the accessory substance of these influence subsequent experimentals.Meanwhile, it is pure
The process of change is also that the DNA fragmentation in the process of clip size screening, the present invention is in 700bp or so, using difference
The magnetic bead of volume is mixed with PCR primer, and volume ratios different magnetic bead/DNA can adsorb different size of fragment, using above-mentioned
Magnetic bead volume, can successfully remove machine text in mistake (error) fragment and primer dimer when PCR is expanded, the sequencing of let us
There was only our sequencing target DNA fragments in storehouse so that sequencing result is more accurate, reduce error.
As shown in figure 3, being only found that the peak of a fragment by library quality inspection.
(7) high-flux sequence is carried out：The cDNA library of gained is sequenced by Illumina MiSeq platforms, is sequenced
Pattern is PE300, and library denaturant concentration is 2nM, and upper machine concentration is 20pM, and passes through bioinformatic analysis high-flux sequence knot
Really；
According to draw distinctive TCR sequences whether be more than 10-4(0.01%), i.e., whether certain distinctive T cell is more than 10-4(0.01%), so as to judge that the minimal residual disease of subject is positive or negative, if MRD>10-4(0.01%) it is then sun
Property, if MRD<10-4(0.01%) it is then feminine gender.
In heretofore described step (4) each RNA sample is mixed according to following ratio：
Hatch in 72 DEG C 3 minutes, then 4 DEG C 1 minute.
PCR reaction buffers are prepared according to following ratio
PCR reactions caching liquid and RNA samples are mixed, cDNA reverse transcriptions are started according to following response procedures
42 DEG C 60 minutes
70 DEG C 10 minutes
4 DEG C permanent
After reaction terminates, so that it may obtain and with the addition of total cDNA (such as Fig. 1) of joint at 5 ' ends.
Comprised the following steps that in the step (5)：Reaction system is prepared according to following ratio：
Reaction system is prepared according to above-mentioned reaction system, above-mentioned 5 sample reagent is mixed in PCR test tubes, mixes, centrifuge number
Second, the liquid residue on tube wall is centrifuged in ttom of pipe.Holding test tubes start fortune in PCR amplification instrument according to above-mentioned response procedures
OK.
The response procedures of PCR 1 are in the step (5):
95 DEG C 3 minutes；95 DEG C 30 seconds；65 DEG C 1 minute, 25 circulation；72 DEG C 1 minute；4 DEG C permanent.
Comprised the following steps that in the step (6)：
Reaction system is prepared according to following ratio：
The cumulative volume of system is 50ul in PCR1 and PCR2, if other materials are added together not enough, and supplement is just gone with water.
The response procedures of PCR 2 are in the step (6):
94 DEG C 3 minutes；94 DEG C 30 seconds；55 DEG C 30 seconds, 15 circulation；72 DEG C 20 minutes, 72 DEG C 1 minute, 4 DEG C are permanent.
Specific purification step is as follows in the step (6)：
A, 80 μ L AMPure XP Beads of addition enter PCR2 reaction products, mix.
B, in incubation at room temperature 10 minutes.
C, magnetic bead-PCR2 product mixtures test tube is placed on magnetic frame, wait after all magnetic beads are adsorbed on magnetic frame,
All supernatants are sucked with pipettor, are abandoned.
D, the addition ethanol of 150 μ L 70% are hatched 30 seconds on magnetic bead, all supernatants are sucked with pipettor, are abandoned.
E, the 4th step of repetition 2 times.
F, opening test tube cap, are waited 5 minutes, are treated that magnetic bead is air-dried, are residued in without any ethanol in test tube.
J, test tube removed from magnetic frame, and add 50 μ L and remove nuclease water, utilize pipettor piping and druming suspension magnetic bead.
H, tube back magnetic frame, wait all magnetic beads to be all adsorbed in after magnetic frame, transfer supernatant is in new test tube
In.The PCR2 products cDNA after purifying is just contained in supernatant.
The present invention is based on high throughput sequencing technologies, and the library constructing method of single pair of primer is sequenced in TCR, by thin in acquisition T
After born of the same parents RNA, RNA is being carried out to while cDNA reverse transcriptions, to cDNA 5 ' one joint of end addition, so that by known to this
The joint design TCR amplification sense primers of sequence, then coordinate tcr gene 3 ' to hold C area's genes (constant region) design anti-sense primer, from
And reach the purpose for expanding whole TCR sequences gene.
Primer combination and kit detection sensitivity are up to 10 in the present invention-6(0.0001%), higher than current clinical detection
100 times of method.
The present invention provides the joint that Minimal Residual Disease of Leukemia TCR libraries are built based on high-flux sequence, primer and method
Have the beneficial effect that：1. obtain the full transcript profile sequences of people TCR；2. obtain human specific CDR1, CDR2 and CDR3 sequence；3.
TCR sequences after obtaining that people is Clonal and having rised in value, so as to as the detection biomarker of Minimal Residual Disease of Leukemia, especially
It is to improve less than 10-4Low copy number T cell clone recall rate.
The present invention is comprehensive biological by being carried out to people's tcr gene sequencing result on the basis of high-flux sequence platform
Bioinformatics analysis, obtains gene Preferences of the TCR when VDJ is recombinated, and VDJ assortment of genes information, TCR clones kind of information,
Abrupt information on TCR diversity informations, CDR1, CDR2, CDR3 nucleotide sequence and amino acid sequence information, gene, etc..Just
It is that these factor quantity of formation are huge and TCR groups storehouse of wide variety.
Combined by primer of the present invention and kit is detected that there is provided bioinformatic data after detailed sequencing point
Analysis, and effective quality monitoring is provided to whole experiment, it can at utmost reduce experimental error and mistake.By to TCR's
Assessment is sequenced can be quick, and the help medical worker and cancer patient early prediction T cell leukaemia of Noninvasive are small
Residual Disease (MRD) level, MRD refers to that cancer, after complete incidence graph, still has the cancerous tumor cell of residual, this is palindromia in vivo
Root.To strive for patient's long-term disease-free survival and recovery from illness, it is necessary to carry out dynamic monitoring to MRD, real-time curative effect evaluation, treatment refers to
Lead and recurrence prediction.
Brief description of the drawings
RNA reverse transcription cDNA schematic diagrames in Fig. 1 present invention
Upper machine joint schematic diagram is sequenced to be expanded TCR cDNA using twice PCR in the present invention and being added in Fig. 2
Fig. 3 is sequencing library quality inspection result in the present invention.
Fig. 4 carries out bioinformatic analysis comparison for TCR sequencing results in the present invention, finds out the information (portion of every sequence
Point)
Fig. 5 is TCR sequencing result 3D forest maps in the present invention.Subject TCR diversity and clone's implementations is shown, often
One post represents a kind of TCR clone, and Clonal value-added TCR illustrates the increment situation of leukaemia cancer cell, it is value-added this
Bar TCR sequences can as cancer cell biomarker, provide biology for each Minimal Residual Disease of Leukemia detection in the future
Label.
Embodiment
The utility model is described in further detail with reference to embodiment, following primer is by the U.S.
The synthesis of Invitrogen companies:
Embodiment 1
High-flux sequence detection T cell leukaemia minimal residual is carried out applied to the primer combination in the present invention and kit
Disease, comprises the following steps：
(1) human blood sample 10mL is obtained in EDTA anticoagulant tubes；
(2) it is thin using lymphocyte separation medium Ficoll-1077 (Sigma Co., USA #10771) progress peripheral blood mononuclears
The separation of born of the same parents (PBMC)；
(3) PBMC total serum IgE is extracted using Trizol method, agents useful for same is RNAzol RT (MRC companies of U.S. #
RN190)；
(4) RNA reverse transcriptions are into cDNA, and 5 ' the end primer knots when the ends of cDNA 5 ' addition joint is expanded with PCR later
Close, comprise the following steps that,
The reagent used：
The Oligo of TCR 3 ' (dT) primer (10 μM)
5X reverse transcription buffers (250mM Tris-HCl (pH 8.3), 375mM KCl, 15mM MgCl2)
Dithiothreitol (DTT), DTT (20mM) U.S. Thermo Scientific#R0861
DNTP Mix (10mM) U.S. Invitrogen#18427088
RNAse Out (40U/ μ L) U.S. Invitrogen#10777019
The Oligo of TCR 5 ' joints (10 μM)
Superscript II RT (200U/ μ L) U.S. Invitrogen#18064022
Each RNA sample is mixed according to following ratio：
| Reagent | Volume 1X (μ L) |
| RNA | 8 |
| The Oligo of TCR 3 ' (dT) primer (10 μM) | 1 |
Hatch in 72 DEG C 3 minutes, then 4 DEG C 1 minute.
PCR reaction buffers are prepared according to following ratio
PCR reactions caching liquid and RNA samples are mixed, cDNA reverse transcriptions are started according to following response procedures
42 DEG C 60 minutes
70 DEG C 10 minutes
4 DEG C permanent
After reaction terminates, so that it may obtain the total cDNA that with the addition of joint at 5 ' ends (as schemed)
(5)PCR1.Restructuring TCR cDNA are expanded by way of " single pair of " primer, are comprised the following steps that：
The reagent used：
Q5 High-Fidelity 2X Master Mix (U.S. NEB#M0492L)
The end connectors of TCR 5 ' primer (sense primer)
TCR C areas primer (anti-sense primer)
Remove nuclease water (U.S. Thermo Scientific AM9914G)
Reaction system is prepared according to following ratio：
The response procedures of PCR 1 are:
(6) PCR2 (label PCR).Illumina high-flux sequence instrument is added for PCR1 products (the TCR sequences after amplification)
Upper machine joint and label, while more upper machine gene dosages are expanded again for increase.Comprise the following steps that：
The reagent used：
Q5High-Fidelity 2X Master Mix (U.S. NEB#M0492L)
Label sense primer
Label anti-sense primer
Remove nuclease water (U.S. Thermo Scientific AM9914G)
Reaction system is prepared according to following ratio
The response procedures of PCR 2 are:
PCR2 product purifications.After above-mentioned PCR reactions terminate, DNA purifying is carried out using magnetic bead, is comprised the following steps that：
The reagent used：
Agencourt AMPure XP Beads (U.S. Beckman#A63882)
Specific purification step is as follows：
(1) 80 μ L AMPure XP Beads of addition enter PCR2 reaction products, mix.
(2) in incubation at room temperature 10 minutes.
(3) magnetic bead-PCR2 product mixtures test tube is placed on magnetic frame, and all magnetic beads of wait are adsorbed on magnetic frame
Afterwards, all supernatants are sucked with pipettor, are abandoned.
(4) the addition ethanol of 150 μ L 70% is hatched 30 seconds on magnetic bead, all supernatants is sucked with pipettor, is abandoned.
(5) the 4th step is repeated 2 times.
(6) test tube cap is opened, is waited 5 minutes, treats that magnetic bead is air-dried, is residued in without any ethanol in test tube.
(7) test tube is removed from magnetic frame, and adds 50 μ L and remove nuclease water, suspension magnetic bead is blown and beaten using pipettor.
(8) tube back magnetic frame, all magnetic beads are waited all to be adsorbed in after magnetic frame, transfer supernatant is in new test tube
In.The PCR2 products cDNA after purifying is just contained in supernatant.
(7) high-flux sequence is carried out.The cDNA library of gained is passed through into IlluminaPlatform (the U.S.
Illumina is public
Department) it is sequenced, sequencing pattern is PE300, and passes through bioinformatic analysis high-flux sequence result.
Material and reagent explanation
T lymphocyte related leukemia patients：Originate The Children's Hospital, Zhejiang University School of Medicine, patient's informed consent.
No special illustrates, the reagent that uses of the present invention is commercial goods, the database that the embodiment of the present invention is used be it is disclosed
Line database.
Specifically, the termination of reverse transcription 5 ' header sequence of the present invention, primer sequence are following (5 ' -3 ')：
Reverse transcription step
The Oligo of TCR 3 ' (dT) primer：
5’TTTTTTTTTTTTTTTTTTTTGA 3’
The Oligo joints of TCR 5 '：
5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’
PCR1 steps
The end connector primers of TCR 5 '：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’
TCR C areas primer：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’
PCR2 steps
Label sense primer：
5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’
Label anti-sense primer：
5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’
RG=RNA nucleotides
In Tag primerUnderscoreSequence label is sequenced for Illumina in part, and interior sequence is replaced by following table sequence, uses
When multiple samples are detected simultaneously, each sample is distinguished using different index1/index2 combinations and bioinformatics
Sequencing result.
Design of primers：The joint sequence and TCR C areas gene for holding addition in TCR 5 ' during for RNA reverse transcriptions are divided
Analysis, is analyzed primer dimer and stem ring mispairing using Oligo 7.36 and Primer Premier 6.0, in TCR5 '
End manual splice is provided with sense primer, and reverse primer is designed for C downstream of gene, expands TCR total length transcripton regional sequences,
Wherein contain TCR FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 regions.
Embodiment 2
The embodiment of the present invention 1 provides a kind of preparation method of t lymphocyte receptor (TCR) RNA sample, including following step
Suddenly：
Fresh 10 milliliters of peripheral blood sample (mL) is collected, according to Ficoll-1077's (Sigma Co., USA #10771)
Specification is operated, and obtains relatively pure PMBC (PBMC)；
PBMC total serum IgE is extracted using Trizol method, agents useful for same is RNAzol RT (MRC companies of U.S. #
RN190), the total serum IgE obtained, is utilized(U.S. Thermo Fisher Scientific are public by 2.0Fluorometer
Take charge of #Q32866), coordinateRNA HS Assay Kit kits (U.S. Thermo Fisher Scientific company #
Q32852 RNA concentration) is determined, then reverse transcription RNA；
Embodiment 3
The single pair of primer that the embodiment of the present invention 2 provides a kind of use Minimal Residual Disease of Leukemia TCR libraries builds white blood
The method of sick minimal residual disease TCR high-throughput sequencing libraries, comprises the following steps：
RNA using the gained of embodiment 1 as reverse transcription template, according to the reagent in Part IV in above-mentioned " second aspect " with
Step obtains the cDNA for adding the end connectors of TCR 5 '.According still further to the reagent in the five, the six, seven parts in above-mentioned " second aspect "
Enter product (library) purifying of performing PCR 1, PCR 2 and PCR 2 with step.
After library purifying terminates, examined using Agilent 2100Bioanalyzer (U.S. Agilent company #G2939AA)
The purity and size in library are surveyed, the kit used is Agilent DNA 1000Kit (Agilent companies of U.S. #5067-
1504), testing result is as shown in figure 3, library size is in 686bp, and library purity is at a relatively high, and has not seen that other are non-specific
Property extension increasing sequence.
Utilize2.0Fluorometer (U.S. Thermo Fisher Scientific company #Q32866), matches somebody with somebody
CloseDsDNA HS Assay Kit kits (U.S. Thermo Fisher Scientific company #Q32851) are determined
DNA library concentration, and send company to carry out high-flux sequence (using Illumina MiSeq, 2*300pair-end).
After the end connectors of TCR 5 ', primer and library construction using the present invention, high-flux sequence obtains about millions of
Bar TCR sequences.
Sequencing result carries out bioinformatic analysis, and (analysis of biological information uses Bowtie 2aligner
(Ver.2.1.0), TCR database matchings derive from international immunogene information system www.imgt.org), part point
Analyse comparison result as shown in Figure 4,5.
By bioinformatic analysis, can accurately know the information of every TCR sequence, amino acid information, bar number with
And proportion.By TCR comparative analyses, present invention obtains the statistical analysis of high-flux sequence sequence TCR representativeness clones
As a result, as a result as shown in Figures 4 and 5, situation is applied in combination for TCR recombination V-J in Fig. 5.As shown in Figure 5, the present invention is passed through
The end connectors of TCR 5 ', in the TCR sequences of nearly million that obtain of PCR primer and sequencing library preparation method, it can be deduced that
Whether distinctive TCR sequences are more than 10-4(0.01%) whether 10 also, are more than with regard to certain distinctive T cell (cancer cell)-4
(0.01%), so that the minimal residual disease for judging subject is positive or negative (clinical reference value is with MRD>10-4(0.01%)
For the positive, MRD<10-4(0.01%) it is feminine gender).
The above results show, are detected using the primer and kit of the present invention, so as to build leukaemia minimal residual
Sick TCR libraries can cover the diversity information of tcr gene, improve the recall rate of low copy number T cell clone.
Presently preferred embodiments of the present invention is the foregoing is only, is not intended to limit the invention, all essences in the present invention
Any modification, equivalent and improvement made within refreshing and principle etc., should be included within the scope of the present invention.
Sequence table SEQ UENCE LISTING
<110>Sun Tao
<120>A kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 32
<212> DNA
<213>It is artificial synthesized
<220>
<223>The Oligo joints of TCR 5 '
<400> 1
atgcatcggatcttcagcatgaacttrgrgrg 32
<210> 2
<211> 22
<212> DNA
<213>It is artificial synthesized
<220>
<223>The Oligo of TCR 3 ' (dT) primer
<400> 2
ttttttttttttttttttttga 22
<210> 3
<211> 57
<212> DNA
<213>It is artificial synthesized
<220>
<223>The end connectors of TCR 5 '
<400> 3
gtctcgtgggctgggcgatgtgtatgagagacagcatgcatcggatcttcagcatga 57
<210> 4
<211> 62
<212> DNA
<213>It is artificial synthesized
<220>
<223>TCR C areas primer
<400> 4
tcgtcgccagcgtcggaagtgtataagagacagtcgcagcgtcagatgtgtataagagacag 62
<210> 5
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 5
caagcagaagacggcatacgagatatctatcggtctcgtgggctgg 46
<210> 6
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 6
caagcagaagacggcatacgagattcaggtgagtctcgtgggctgg 46
<210> 7
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 7
caagcagaagacggcatacgagatcactagttgtctcgtgggctgg 46
<210> 8
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 8
caagcagaagacggcatacgagatgaattgccgtctcgtgggctgg 46
<210> 9
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 9
caagcagaagacggcatacgagatatgtacaagtctcgtgggctgg 46
<210> 10
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 10
caagcagaagacggcatacgagatgattcagtgtctcgtgggctgg 46
<210> 11
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 11
Caagcagaagacggcatacgagatctgttcgtgtctcgtgggctgg 46
<210> 12
<211> 46
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label sense primer
<400> 12
caagcagaagacggcatacgagattatacggcgtctcgtgggctgg 46
<210> 13
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 13
aatgatacggcgaccaccgagatctacactagctacttcgtcgccagcgtc 51
<210> 14
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 14
aatgatacggcgaccaccgagatctacacattatagctcgtcgccagcgtc 51
<210> 15
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 15
aatgatacggcgaccaccgagatctacaccccgtacttcgtcgccagcgtc 51
<210> 16
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 16
aatgatacggcgaccaccgagatctacacgggtataatcgtcgccagcgtc 51
<210> 17
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 17
aatgatacggcgaccaccgagatctacacagcaggtgtcgtcgccagcgtc 51
<210> 18
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 18
aatgatacggcgaccaccgagatctacactatacgtatcgtcgccagcgtc 51
<210> 19
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 19
aatgatacggcgaccaccgagatctacaccacctagttcgtcgccagcgtc 51
<210> 20
<211> 51
<212> DNA
<213>It is artificial synthesized
<220>
<223>Label anti-sense primer
<400> 20
aatgatacggcgaccaccgagatctacacgttgctactcgtcgccagcgtc 51
Claims (6)
1. a kind of primer combination that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence, it is characterised in that：It is described
Primer, which is combined, includes the Oligo joints of TCR 5 ', the Oligo of TCR 3 ' (dT) primer, TCR C areas primer, label upstream and downstream primer, often
Plant primer sequence as follows：
The Oligo joints of TCR 5 ', its base sequence is：5’ATGCATCGGATCTTCAGCATGAACTTrGrGrG 3’；
The Oligo of TCR 3 ' (dT) primer：5’TTTTTTTTTTTTTTTTTTTTGA 3’；
The end connector primer sequences of TCR 5 ' are：
5’GTCTCGTGGGCTGGGCGATGTGTATGAGAGACAGCATGCATCGGATCTTCAGCATGA 3’；
TCR C areas primer sequence is：
5’TCGTCGCCAGCGTCGGAAGTGTATAAGAGACAGTCGCAGCGTCAGATGTGTATAAGAGACAG 3’；
Label sense primer：5’CAAGCAGAAGACGGCATACGAGAT[index1]GTCTCGTGGGCTGG 3’；
Label anti-sense primer：5’AATGATACGGCGACCACCGAGATCTACAC[index2]TCGTCGCCAGCGTC 3’。
2. a kind of primer that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence according to claim 2
Combination, it is characterised in that：The index1 be ATCTATCG, TCAGGTGA, CACTAGTT, GAATTGCC, ATGTACAA,
One kind in GATTCAGT, CTGTTCGT or TATACGGC；Index2 be TAGCTACT, ATTATAGC, CCCGTACT,
One kind in GGGTATAA, AGCAGGTG, TATACGTA, CACCTAGT or GTTGCTAC.
3. a kind of examination that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence according to claim 1 or 2
Agent box, it is characterised in that：The kit contains primer combination as claimed in claim 1 or 2.
4. a kind of reagent that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence according to claim 3
Box, it is characterised in that：The kit also includes PCR buffer solutions, Q5High-Fidelity 2X Master Mix, removes nucleic acid
Enzyme water, AMPure XP Beads and 70% ethanol.
5. a kind of reagent that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence according to claim 4
Box, it is characterised in that：The kit includes：
(1) PCR buffer solutions：9.5μL；
(2) positive control RNA (1 μ g/ μ l)：10μL；
(3) the 10 μM of Oligo of TCR 3 ' (dT) primers：1.1μL；
(4) the 10 μM of end connectors of TCR 5 ' primers and 10 μM of TCR C areas primers：Each 1.1 μ L；
(5)Q5 High-Fidelity 2X Master Mix：55μL；
(6) 10 μM of label sense primers and 10 μM of label anti-sense primers：Each 1.1 μ L；
(7) nuclease water is removed：105μL；
(8)AMPure XP Beads：88μL；
(9) 70% ethanol：165μL.
6. the reagent that T cell Minimal Residual Disease of Leukemia is detected based on high flux high flux according to claim 4 or 5
Box, it is characterised in that：The PCR buffer solutions are made up of following system：
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204857.0A CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204857.0A CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106957906A true CN106957906A (en) | 2017-07-18 |
| CN106957906B CN106957906B (en) | 2020-04-28 |
Family
ID=59481586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611204857.0A Active CN106957906B (en) | 2016-12-23 | 2016-12-23 | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106957906B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680062A (en) * | 2018-12-18 | 2019-04-26 | 杭州艾沐蒽生物科技有限公司 | A method of detection minimal residual disease MRD |
| WO2020015621A1 (en) * | 2018-07-17 | 2020-01-23 | 厦门生命互联科技有限公司 | Method for constructing platelet nucleic acid library for gene detection and kit |
| CN111261226A (en) * | 2020-03-12 | 2020-06-09 | 江苏先声医学诊断有限公司 | NGS-based automatic sequencing analysis method and device for minimal residual lesions |
| CN111363783A (en) * | 2018-12-26 | 2020-07-03 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on unique recognition sequence |
| CN114867870A (en) * | 2019-08-27 | 2022-08-05 | 10月12日大学医院生物医学研究基金会 | Method for determining the presence or absence of Minimal Residual Disease (MRD) in a subject whose disease has been treated |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063032A (en) * | 2015-08-14 | 2015-11-18 | 深圳市瀚海基因生物科技有限公司 | Multiple PCR primers and method for constructing leukemia minimal residual disease BCR library based on high-flux sequencing |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
-
2016
- 2016-12-23 CN CN201611204857.0A patent/CN106957906B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063032A (en) * | 2015-08-14 | 2015-11-18 | 深圳市瀚海基因生物科技有限公司 | Multiple PCR primers and method for constructing leukemia minimal residual disease BCR library based on high-flux sequencing |
| CN105154440A (en) * | 2015-08-14 | 2015-12-16 | 深圳市瀚海基因生物科技有限公司 | Multi-PCR primer and method for constructing leukemia minimal residual disease TCR library based on high-throughput sequencing |
Non-Patent Citations (3)
| Title |
|---|
| DMITRY A. BOLOTIN等: "Next generation sequencing for TCR repertoire profiling: Platform-specific features and correction algorithms", 《EUR. J. IMMUNOL》 * |
| HUA FANG等: "Quantitative T cell repertoire analysis by deep cDNA sequencing of T cell receptor α and β chains using next-generation sequencing (NGS)", 《ONCOIMMUNOLOGY》 * |
| 王鹏等: "Ｔ细胞TCR CDR３受体库的高通量测序分析概况", 《现代免疫学》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020015621A1 (en) * | 2018-07-17 | 2020-01-23 | 厦门生命互联科技有限公司 | Method for constructing platelet nucleic acid library for gene detection and kit |
| CN109680062A (en) * | 2018-12-18 | 2019-04-26 | 杭州艾沐蒽生物科技有限公司 | A method of detection minimal residual disease MRD |
| CN109680062B (en) * | 2018-12-18 | 2022-12-02 | 杭州艾沐蒽生物科技有限公司 | Method for detecting minimal residual disease MRD |
| CN111363783A (en) * | 2018-12-26 | 2020-07-03 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on unique recognition sequence |
| CN111363783B (en) * | 2018-12-26 | 2024-01-02 | 武汉康测科技有限公司 | T cell receptor library high-throughput sequencing library construction and sequencing data analysis method based on specific recognition sequence |
| CN114867870A (en) * | 2019-08-27 | 2022-08-05 | 10月12日大学医院生物医学研究基金会 | Method for determining the presence or absence of Minimal Residual Disease (MRD) in a subject whose disease has been treated |
| CN111261226A (en) * | 2020-03-12 | 2020-06-09 | 江苏先声医学诊断有限公司 | NGS-based automatic sequencing analysis method and device for minimal residual lesions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106957906B (en) | 2020-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957906A (en) | A kind of primer combination and kit that T cell Minimal Residual Disease of Leukemia is detected applied to high-flux sequence | |
| CN105087789B (en) | A method of BCR and TCR immune groups library in detection blood plasma cfDNA | |
| Wang et al. | Single cell sequencing: a distinct new field | |
| ES2615733T3 (en) | Methods for parallel mass analysis of nucleic acids in individual cells | |
| EP2758550B1 (en) | Detection of isotype profiles as signatures for disease | |
| Bomben et al. | Comprehensive characterization of IGHV3-21–expressing B-cell chronic lymphocytic leukemia: an Italian multicenter study | |
| US8574832B2 (en) | Methods for preparing sequencing libraries | |
| CN106755410A (en) | A kind of method for detecting T cell and B cell immune group storehouse simultaneously based on high-flux sequence | |
| Chen et al. | Distinctive IgVH gene segments usage and mutation status in Chinese patients with chronic lymphocytic leukemia | |
| WO2017028753A1 (en) | Multiplex pcr primer and application thereof | |
| CN110246539A (en) | A kind of method and device of immunity level assessment | |
| CN106755464A (en) | For the method for screening the gene marker of intestinal cancer and/or stomach cancer, the gene marker and application thereof that is screened with the method | |
| CN109593758B (en) | Multiplex primer set and method for constructing human B cell immune repertoire based on high-throughput sequencing by using same | |
| KR20210035167A (en) | Compositions and methods for evaluating genomic alteration | |
| CN109929924A (en) | A kind of IGH gene rearrangement detection method based on high-flux sequence | |
| CN109963572A (en) | For characterizing the reactive composition and method of solid tumor confrontation PD-L1 antibody monotherapy | |
| CN112322716B (en) | Specific lymphocyte content analysis method and device based on TCR/BCR high-throughput sequencing | |
| CN106978479A (en) | A kind of method that T cell Minimal Residual Disease of Leukemia is detected based on high-flux sequence | |
| CN106957905B (en) | Molecular detection method, primer composition and kit for evaluating tumor immunotherapy effect | |
| CN107058484A (en) | It is a kind of to detect T cell and the primer combination in B cell immune group storehouse and kit simultaneously applied to high-flux sequence | |
| ES2675270T3 (en) | Procedure for in vitro diagnosis of testicular cancer | |
| Szankasi et al. | Clinical laboratory analysis of immunoglobulin heavy chain variable region genes for chronic lymphocytic leukemia prognosis | |
| KR101767644B1 (en) | Composition and method for prediction of pigs litter size using gene expression profile | |
| CN103667267B (en) | For with the DNA probe storehouse of KRAS gene recombination and the method adopting its enrichment KRAS gene fragment | |
| Kuo | Next generation sequencing in hematolymphoid neoplasia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200810 Address after: Room 103-8, building 7, Chuangzhi Green Valley Development Center, 788 HONGPU Road, Jianggan District, Hangzhou City, Zhejiang Province Patentee after: HANGZHOU IMMUQUAD BIOTECHNOLOGIES, LLC Address before: 610072 No. 1, unit 2, building 91, Daqing Road, Qingyang District, Sichuan, Chengdu, 10 Patentee before: Sun Tao |