CN106636105A - Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof - Google Patents
Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof Download PDFInfo
- Publication number
- CN106636105A CN106636105A CN201611170849.9A CN201611170849A CN106636105A CN 106636105 A CN106636105 A CN 106636105A CN 201611170849 A CN201611170849 A CN 201611170849A CN 106636105 A CN106636105 A CN 106636105A
- Authority
- CN
- China
- Prior art keywords
- staphylococcus aureus
- aptamer
- aureus enterotoxin
- enterotoxin
- ssdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
- C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56938—Staphylococcus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/305—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F)
- G01N2333/31—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F) from Staphylococcus (G)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an aptamer C203 of staphylococcal enterotoxin C2, a screening method and an application thereof. The sequence of the aptamer C203 is AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGCACGGGCGGAAACGCCGCCGGCACAATTGTGC; the screening method of the aptamer C203 comprises the steps that the SELEX screening technology in vitro based on the aptamer uses carboxyl magnetic beads as a solid phase media, the staphylococcal enterotoxin C2 is used as a target, by the staphylococcal enterotoxin C2 magnetic beads, the aptamer specifically binding with the staphylococcal enterotoxin C2 is screened and obtained from the ssDNA library; the aptamer C203 is capable of binding with the staphylococcal enterotoxin C2 in a highly affiliative and highly specific mode.
Description
Technical field
The present invention relates to the aptamer C203 and its screening technique of a kind of staphylococcus aureus enterotoxin C 2 and should
With.
Background technology
Staphylococcus aureus enterotoxin is the exotoxin with superantigen activity secreted by staphylococcus aureus.Gold
Staphylococcus aureus enterotoxin can be processed without antigen presenting cell, directly with the nonrestrictive combination of MHC class Ⅱmolecules, be formed
Compound combined with the β chain V areas of t lymphocyte antigen receptor, a large amount of activated T lymphocytes so as to activate, breed, and release
The inflammatory cytokine of amplification quantity causes strong immune response, ultimately results in the infringement of uncontrolled inflammation and multiple organ, causes poison
The diseases such as element shock.It is heat-resisting and only need the very little dosage can further, since Staphylococcus aureus enterotoxin is relatively resistant to digestion
Cause t cell response, Staphylococcus aureus enterotoxin is also by the super antigen medicine as oncotherapy.
Staphylococcus aureus enterotoxin has multiple serotypes, is respectively A types, Type B, C1 types, C2 types, C3 types, D types, E
Type, G types, H types, I types, M types, N-type, the O-shaped and type toxin of toxic shock syndrome 1, the type toxin of toxic shock syndrome 2 etc., its
Middle staphylococcus aureus enterotoxin C 2 is not only relevant with staphylococcus aureus infections relating, while being also Staphylococcus aureus
Most super antigen medicines is applied in bacterium enterotoxin.
Detection staphylococcus aureus enterotoxin C 2 mainly adopt immunological method, including precipitation reaction, agglutinating reaction,
ELISA, solid-phase RIA, biology sensor etc., these methods use the knowledge that antibody is detected as staphylococcus aureus enterotoxin C 2
Other element, and the preparation of antibody has cycle weak points such as long, complex steps, cost height.In recent years, detecting golden yellow Portugal
Grape coccus Enteromycin C 2 gene is very fast for the molecular biology method development of target, but PCR equimolecular biological methods are still suffered from
The technical barriers such as false positive, false negative.Therefore, develop with more high sensitivity, economy, easy staphylococcus aureus intestines poison
Plain C2 new detecting techniques, it is all significant for Food Hygiene Surveillance, the diagnosis and treatment of clinical infection of staphylococcus aureus etc..
The Endotoxin Shock that treatment staphylococcus aureus enterotoxin C 2 causes, it is clinical to prop up to the ill frequently with anti-inflammatory, fluid infusion etc.
Hold therapy.Current research finds that the superantigen activity of suppression staphylococcus aureus enterotoxin C 2 blocks inflammation in the starting stage
The generation of cascade reaction, is the available strategy for treating staphylococcus aureus enterotoxin C 2 relevant disease.Based on this strategy, develop
Various polypeptide drugs, antibody drug, vaccine etc., it has also become staphylococcus aureus enterotoxin C 2 biotechnology new drug research
Focus.
The acquisition of staphylococcus aureus enterotoxin C 2 super antigen medicine, frequently with the method for gene cloning, by golden yellow
Aureus enterotoxin C 2 gene fragment clone in expression in escherichia coli and is purified into prokaryotic expression carrier.But this side
Frequently with ion-exchange process or the affinity purification method of tape label, the former adsorbs selection poor specificity to purification step in method, after
Person's reagent cost is higher.
Aptamers are otherwise known as " synthetic antibody ", " chemical antibody ", and its chemical nature is a single-stranded oligonucleotide molecule
(ssDNA or RNA) is folded into specific three dimensional structure and is combined with target substance high-affinity and high specific.Aptamers are passed through
Phyletic evolution technology (the Systematic evolution of ligands by of index concentration part
Exponentialenrichment, SELEX) in-vitro screening process.Aptamer have high-affinity, high specific, can
External synthesis, can by modification change its function and pharmacokinetic properties, non-immunogenicity, it is economical the features such as.Based on above-mentioned
The aptamer medicine of advantage exploitation can specific inhibition target function;Using aptamer as recognition component, can also open
Send out easy, accurately new detecting technique and efficient economy affinity purification system.Therefore, high specific is filtered out, height is affine
Power has important scientific research, clinical and market value with reference to the aptamer of staphylococcus aureus enterotoxin C 2.
The content of the invention
It is an object of the invention to provide a kind of Staphylococcus aureus enterotoxin with high specific and high-affinity
The aptamer C203 of C2 and its screening technique and application.
The purpose of the present invention is achieved through the following technical solutions:A kind of nucleic acid adaptation of staphylococcus aureus enterotoxin C 2
Body C203, its sequence is as follows:
AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGC 40
ACGGGCGGAAACGCCGCCGGCACAATTGTGC 71
The screening technique of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, based on aptamer
External SELEX triage techniqueses, by the use of carboxyl magnetic bead as solid-phase media, with staphylococcus aureus enterotoxin C 2 as target,
Screened from ssDNA libraries by staphylococcus aureus enterotoxin C 2 magnetic bead and obtain special with staphylococcus aureus enterotoxin C 2
The aptamer that the opposite sex is combined.
The application of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, it is golden yellow separating, purifying
Application in aureus enterotoxin C 2.
The application of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, in the golden yellow Portugal of analysis detection
Non-diseases methods for diagnosis and treatment application in grape coccus Enteromycin C 2.
The application of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, in staphylococcus aureus intestines
Toxin C2 is the application in the targeted therapy of effector molecule.
The application of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, in treatment Staphylococcus aureus
Application in bacterium infection and in treatment staphylococcus aureus enterotoxin C 2 causes related syndrome.
For than prior art, it is an advantage of the current invention that:
1. aptamer C203 is non-toxic, and molecular weight is little, good penetrability, it is easy to synthesis and mark.
2. the synthesis cost of aptamer C203 compared with Antibody preparation low cost, and cycle is short, favorable reproducibility.
3. aptamer C203 can high-affinity, combined with staphylococcus aureus enterotoxin C 2 with high specificity,
Dissociation constant is 3.05 ± 0.89nM, and it does not have identification function to other homologous proteins.
4. aptamer C203 staphylococcus aureus enterotoxin C 2 separation, purifying, staphylococcus aureus
The related food safety detection of Enteromycin C 2, the diagnosis and treatment of staphylococcus aureus enterotoxin C 2 relevant disease are golden yellow
The field aspects such as the diagnosis and treatment of staphy lococcus infection, the targeted therapy of staphylococcus aureus enterotoxin C 2 mediation have wide
Wealthy application prospect and important science, society, economic worth.
Description of the drawings
Fig. 1 is the biological information simulation drawing of aptamer C203 secondary structures.
Fig. 2 schemes for the specificity of fluorescence Percentage bound experimental analysis aptamer C203.In fig. 2, abscissa is analysis
Albumen, ordinate be fluorescence Percentage bound.
Fig. 3 is the dissociation that fluorescence Percentage bound experimental analysis aptamer C203 combines staphylococcus aureus enterotoxin C 2
Constant draws curve.Dissociation constant (Kd) is 3.05 ± 0.89nM.In figure 3, abscissa is DNA concentration (pM), and ordinate is
Fluorescence Percentage bound.
Fig. 4 is that CCK-8 methods determine the PBMC propagation that aptamer C203 is induced staphylococcus aureus enterotoxin C 2
The effect of activity.
Specific embodiment
Present invention is described in detail with reference to Figure of description and embodiment:
A kind of aptamer C203 of staphylococcus aureus enterotoxin C 2, its sequence is as follows:
AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGC 40
ACGGGCGGAAACGCCGCCGGCACAATTGTGC 71
The aptamer C203 of described staphylococcus aureus enterotoxin C 2, at 25 DEG C, 100mM Na+, 1mM Mg2+
Under conditions of, its space structure is as follows:
The aptamer C203 of described staphylococcus aureus enterotoxin C 2,5 ' to the aptamer C203
End or 3 ' ends carry out FITC, amino, biotin, digoxin chemical modification.
The aptamer C203 of described staphylococcus aureus enterotoxin C 2, cuts to the aptamer C203
Product obtained by the structure of modification that short or prolongation or number of base are replaced carries out FITC, amino, biotin, digoxin chemistry and repaiies
Decorations.
The screening technique of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, based on aptamer
External SELEX triage techniqueses, by the use of carboxyl magnetic bead as solid-phase media, with staphylococcus aureus enterotoxin C 2 as target,
Screened from ssDNA libraries by staphylococcus aureus enterotoxin C 2 magnetic bead and obtain special with staphylococcus aureus enterotoxin C 2
The aptamer that the opposite sex is combined.
The screening technique of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, it includes following step
Suddenly:
(1) preparation in library is screened:Prepare the ssDNA pool shown in following sequence:
5’-AGGGCCGAGCTCACTTGT-N35-CCGCCGGCACAATTGTGC-3’;
(2) staphylococcus aureus enterotoxin C 2 and carboxyl magnetic bead coupling are prepared into staphylococcus aureus enterotoxin C 2 magnetic
Pearl;
(3) ssDNA libraries are carried out into hot activation process;
(4) by the staphylococcus aureus enterotoxin C 2 magnetic bead obtained by the ssDNA libraries Jing after step (3) and step (2)
It is incubated;
(5) staphylococcus aureus enterotoxin C 2 magnetic bead of the Magnetic Isolation Jing after step (4), washes away staphylococcus aureus
Enteromycin C 2 magnetic bead surfaces are uncombined, the ssDNA of weak binding and non-specific binding;Heating staphylococcus aureus enterotoxin C 2
Magnetic bead, collects the ssDNA with the specific binding of staphylococcus aureus enterotoxin C 2 magnetic bead, i.e. ssDNA enriched libraries;
(6) PCR amplifications:SsDNA enriched libraries obtained by step (5) are entered into performing PCR amplification, wherein PCR expands used
Primer is:
Primer P1:5’-FAM-AGGGCCGAGCTCACTTGT-3’
Primer P2:5’-Biotin-GCACAATTGTGCCGGCGG-3’;
(7) purifying of PCR primer:PCR primer is purified using small fragment purification kit;By after purification
DsDNA is incubated with Streptavidin MagneSphere, after Streptavidin MagneSphere is scrubbed, dsDNA unwinds, is used with reference to dsDNA
Magnetic frame is separated, and collects supernatant;Supernatant obtains the secondary ssDNA libraries for next round screening Jing after ethanol precipitation;
(8) Cycle Screening:By the secondary ssDNA libraries of the FAM marks obtained by step (7), as the secondary of next round screening
Level library, and the screening process of repeat step (3)~(7).
Embodiment one:The screening of aptamer C203
The screening technique of the aptamer C203 of described staphylococcus aureus enterotoxin C 2, it includes following step
Suddenly:
(1) preparation in library is screened:Design two ends FX is 18 nucleotides, middle random areas are 35 nucleosides
SsDNA pool (the 5 '-AGGGCCGAGCTCACTTGT-N of acid35- CCGCCGGCACAATTGTGC-3 '), and student on commission's work
Bioengineering limited company synthesizes.
(2) staphylococcus aureus enterotoxin C 2 is coupled with carboxyl magnetic bead:The staphylococcus aureus enterotoxin C 2 egg
Toxin Technology companies of the U.S. are purchased from vain, and the carboxyl magnetic bead and its coupling reagent are purchased from U.S. Bangs
Laboratories companies, the specification that operation is provided with reference to manufacturer;It is golden yellow before and after being coupled by BCA method determination of protein concentration
The change of protein concentration in color aureus enterotoxin C 2 solution, be computed magnetic bead couples efficiency for 85%;By golden yellow Portugal
Grape coccus Enteromycin C 2 magnetic bead is scattered in PBS, 4 DEG C of preservations.
(3) take 2nmol ssDNA pools be dissolved in 500 μ L select buffer solution (50mM Tris-HCl, 100mM NaCl,
1mM MgCl2, 5mM KCl, pH7.4), then Jing hot activations are processed.Wherein, the method for hot activation process is:95 DEG C of denaturation
After 5min, ice bath 10min in ice-water bath is immediately placed on, is subsequently placed at room temperature 10min.
(4) by the staphylococcus aureus enterotoxin C 2 magnetic bead obtained by the ssDNA libraries Jing after step (3) and step (2)
Mixing is simultaneously for (staphylococcus aureus enterotoxin C 2 carrying capacity is 100ng) and yeast tRNA (mole is 5 times of ssDNA libraries)
In incubation at room temperature 1h.
(5) staphylococcus aureus enterotoxin C 2 magnetic bead of the Magnetic Isolation Jing after step (4), with the selection containing 0.2%BSA
Buffer solution washes away the ssDNA of uncombined staphylococcus aureus enterotoxin C 2 magnetic bead surfaces, weak binding and non-specific binding;So
Afterwards by staphylococcus aureus enterotoxin C 2 magnetic bead with 200 μ L ddH2O is resuspended, after 100 DEG C of hot bath 5min, is placed in magnetic frame
1-2min, collects supernatant, obtains the ssDNA with the specific binding of staphylococcus aureus enterotoxin C 2 magnetic bead, i.e. ssDNA enrichments
Library.
(6) PCR amplifications:SsDNA enriched libraries obtained by step (5) are added in 1mL PCRmix;Vortex oscillation is mixed
After even, dispense into performing PCR amplification by the μ L of every pipe 50, amplification condition is:After 94 DEG C of denaturations 5min;94 DEG C of denaturation 30S, 58 DEG C are moved back
Fiery 30S, 72 DEG C of extension 30S, 15-25 circulation.
Contain in wherein 1mL PCRmix:The μ L of 10 × PCR buffer solutions 100;The μ L of pfu enzymes 3;dNTP 20μL;Primer P1:5’-
FAM-AGGGCCGAGCTCACTTGT-3 ' and primer P2:The each 3 μ L of 5 '-Biotin-GCACAATTGTGCCGGCGG-3 ';It is described to draw
The equal student on commission's work bioengineering limited company synthesis of thing P1 and primer P2.
(7) purifying of PCR primer:Two ends indicate respectively the PCR primer of biotin and fluorophor FAM, using small fragment
Purification Kit (described small fragment purification kit be purchased from Sheng Gong bioengineering limited company), by after purification
DsDNA is incubated 20min with Streptavidin MagneSphere (being purchased from Invitrogen-Dynal companies) at 37 DEG C, uses lavation buffer solution
After (5mM Tris-HCl, pH7.5,1M NaCl, 500 μM of EDTA) washing is with reference to the Streptavidin MagneSphere three times of dsDNA, use
50 μ L NaOH solutions (0.1M) are incubated 30min at 37 DEG C makes dsDNA unwind;Separated with magnetic frame, collect supernatant, supernatant Jing second
Alcohol precipitation obtains the secondary ssDNA libraries of FAM marks, and is dissolved in selection buffer solution, used as the secondary text of next round screening
Storehouse.
(8) screening process carries out altogether 9 wheels.From the beginning of the second wheel, the consumption of secondary library is 50pmol.
Embodiment two:The analysis of aptamer C203 sequences:
(1) after 9 wheel screenings, the ssDNA libraries of enrichment are collected, and entrusts the gloomy promise biotechnology share of the upper Shanghai's style limited
Company is analyzed using high throughput sequencing technologies to library sequence, and analysis process is:PCR expands enriched library, and plus survey
Sequence joint and Index parts;Purified library is selected by gel electrophoresis;Passed through using Agilent 2100Bioanalyzer
Agilent High Sensitivity DNA Kit are to library Quality Control;Using Quant-iT PicogGreen dsDNA
Assay Kit are carried out quantitatively to library;Using the platforms of IlluminateNextSeq 500, by template of single-stranded library bridge is carried out
The amplification of formula PCR, sequencing primer are annealed, are sequenced in synthesis;And sequencing result is compared and analysis is enriched with.
(2) using the analysis of the UNAFold network platforms at 25 DEG C, 100mM Na+, 1mM Mg2+Under conditions of, aptamer
The secondary structure of C203 sequences.The secondary structure schematic diagram for analyzing aptamer C203 sequences is as shown in Figure 1.
Embodiment three:The specificity analysis of aptamer C203:
(1) the aptamer C203 of iii vitro chemical synthesis FAM marks, and be dissolved in selecting buffer solution.
(2) with reference to step (2) in embodiment one, by BSA, staphylococcus aureus toxin A, staphylococcus aureus intestines
Toxin B and Staphylococcal enterotoxin C1 couple respectively preparation BSA magnetic beads, staphylococcus aureus intestines with carboxyl magnetic bead
Toxin A magnetic beads, SEB magnetic bead, Staphylococcal enterotoxin C1 magnetic bead and golden yellow grape
Coccus Enteromycin C 2 magnetic bead.Wherein, the BSA is purchased from Sigma companies, the staphylococcus aureus toxin A, golden yellow Portugal
Grape coccus enterotoxin B and Staphylococcal enterotoxin C1 are purchased from Toxin Technology companies of the U.S..
(3) take aptamer C203 solution obtained by 200 μ L steps (1) respectively with BSA magnetic beads obtained in step (2),
Staphylococcus aureus toxin A magnetic bead, SEB magnetic bead, Staphylococcal enterotoxin C1 magnetic
Pearl and staphylococcus aureus enterotoxin C 2 magnetic bead mix, and 1h is incubated at room temperature in magazine, if blank magnetic bead is control.
(4) the above-mentioned magnetic bead 3 times of Jing steps (3) is washed with 0.1%PBST, the aptamer combined with above-mentioned magnetic bead,
100 DEG C of buffer solution is selected to boil 5min wash-outs with 200 μ L.
(5) determine the fluorescence intensity of initial soln and eluent respectively using fluorescent quantitation instrument, calculate fluorescence Percentage bound=
(initial fluorescent intensity-wash-out fluorescence intensity)/initial fluorescent intensity × 100%, with calculated value aptamer is tentatively represented
The Percentage bound of C203 and target molecule.
As shown in Fig. 2 aptamer C203 is all remarkably higher than it with the Percentage bound of staphylococcus aureus enterotoxin C 2
With BSA, staphylococcus aureus toxin A, SEB, Staphylococcal enterotoxin C1 knot
Conjunction rate, shows that aptamer C203 and the combination of staphylococcus aureus enterotoxin C 2 have preferably specificity.
Example IV:The affinity analysis of aptamer C203
(1) take the FAM labeling nucleic acid aptamers C203 solution of variable concentrations respectively with staphylococcus aureus enterotoxin C 2
Magnetic bead mixes, and 1h is incubated at room temperature in magazine.
(2) with reference to the step (4) and step (5) in embodiment three, experiment obtains and calculates variable concentrations aptamer
The fluorescence Percentage bound of C203 solution and staphylococcus aureus enterotoxin C 2 magnetic bead.
(3) using the calculated value of fluorescence Percentage bound, draw aptamer C203 and combine Staphylococcus aureus enterotoxin
The saturation binding curve of C2, calculates aptamer C203 and combines Staphylococcus aureus enterotoxin by nonlinear regression analysis
The dissociation constant of C2.
As shown in figure 3, we obtain the saturation binding curve of aptamer C203, aptamer C203 is computed
Dissociation constant be 3.05 ± 0.89nM, show the combination that aptamer C203 and staphylococcus aureus enterotoxin C 2 are combined
Ability is strong, and dissociation constant is in nanomole rank.
Embodiment five:Aptamer C203 suppresses the superantigen activity of staphylococcus aureus enterotoxin C 2
(1) aseptic aspiration healthy adult volunteer peripheral blood, is diluted after anticoagulant heparin with equivalent RPMI1640 nutrient solution, is put
On lymphocyte separation medium, acquisition human peripheral is separated using Conventional density gradients centrifugal process (2000rmp, 20min) single
Nucleus (PBMCs).
(2) with the adjustment cell concentration of the RPMI1640 nutrient solutions containing 5% NBCS (NBS) and 5% Human autologous serum
For 1~2 × 106/ mL, spreads 96 orifice plates, per the μ L of hole 100.
(3) each group adds the concentration of aptamer C203 to be followed successively by 0 μM, 10 μM respectively, adds per hole final concentration of
The staphylococcus aureus enterotoxin C 2 of 250ng/mL, setting is not added with staphylococcus aureus enterotoxin C 2, is also not added with nucleic acid
The blank control group of aptamers C203.
(4) cell is placed in into 37 DEG C, 5%CO2CO2Cultivate in incubator, after culture 24h, the CCK- of 10 μ L is added per hole
8, continue to cultivate 4h.
(5) absorbance (OD) of the every hole of spectrophotometer detection in 450nm.
As shown in figure 4, concentration of the abscissa for aptamer C203, ordinate is the OD values at 450nm.When nucleic acid is fitted
When part C203 is 10 μM, staphylococcus aureus enterotoxin C 2 stimulates the proliferation water dawn of PBMCs aobvious reduction (P < 0.05),
The above results show that aptamer C203 has in testing in vitro to the superantigen activity of staphylococcus aureus enterotoxin C 2
There is significantly inhibitory action, be a kind of potential staphylococcus aureus enterotoxin C 2 inhibitor.
SEQUENCE LISTING
<110>Fuzhou General Hospital, Nanjing Military Area, PLA
<120>The aptamer C203 of staphylococcus aureus enterotoxin C 2 and its screening technique and application
<160> 3
<210> 1
<211> 71
<212> DNA
<213>Artificial sequence
<400> 1
agggccgagc tcacttgtca ggtcgcctct tgcgcggcgc 40
acgggcggaa acgccgccgg cacaattgtg c 71
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
agggccgagc tcacttgt 18
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<400> 3
gcacaattgt gccggcgg 18
Claims (10)
1. the aptamer C203 of a kind of staphylococcus aureus enterotoxin C 2, it is characterised in that:Its sequence is as follows:
AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGC 40
ACGGGCGGAAACGCCGCCGGCACAATTGTGC 71
2. the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 1, it is characterised in that:
25 DEG C, 100mM Na+, 1mM Mg2+Under conditions of, its space structure is as follows:
3. the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 1, it is characterised in that:It is right
5 ' the ends or 3 ' ends of the aptamer C203 carry out FITC, amino, biotin, digoxin chemical modification.
4. the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 1, it is characterised in that:It is right
The aptamer C203 truncate extend or number of base replace structure of modification obtained by product carry out FITC, ammonia
Base, biotin, digoxin chemical modification.
5. the sieve of the aptamer C203 of the staphylococcus aureus enterotoxin C 2 according to claim 1-4 any one
Choosing method, it is characterised in that:Based on the external SELEX triage techniqueses of aptamer, by the use of carboxyl magnetic bead as solid-phase media,
With staphylococcus aureus enterotoxin C 2 as target, sieved from ssDNA libraries by staphylococcus aureus enterotoxin C 2 magnetic bead
Choosing obtains the aptamer with staphylococcus aureus enterotoxin C 2 specific binding.
6. the screening technique of the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 5, its
It is characterised by:It is comprised the following steps:
(1) preparation in library is screened:Prepare the ssDNA pool shown in following sequence:
5’-AGGGCCGAGCTCACTTGT-N35-CCGCCGGCACAATTGTGC-3’;
(2) staphylococcus aureus enterotoxin C 2 and carboxyl magnetic bead coupling are prepared into staphylococcus aureus enterotoxin C 2 magnetic bead;
(3) ssDNA libraries are carried out into hot activation process;
(4) the ssDNA libraries Jing after step (3) are carried out with the staphylococcus aureus enterotoxin C 2 magnetic bead obtained by step (2)
Incubation;
(5) staphylococcus aureus enterotoxin C 2 magnetic bead of the Magnetic Isolation Jing after step (4), washes away staphylococcus aureus intestines poison
Plain C2 magnetic bead surfaces are uncombined, the ssDNA of weak binding and non-specific binding;Heating staphylococcus aureus enterotoxin C 2 magnetic
Pearl, collects the ssDNA with the specific binding of staphylococcus aureus enterotoxin C 2 magnetic bead, i.e. ssDNA enriched libraries;
(6) PCR amplifications:SsDNA enriched libraries obtained by step (5) are entered into performing PCR amplification, wherein PCR amplifications primer used
For:
Primer P1:5’-FAM-AGGGCCGAGCTCACTTGT-3’
Primer P2:5’-Biotin-GCACAATTGTGCCGGCGG-3’;
(7) purifying of PCR primer:PCR primer is purified using small fragment purification kit;By dsDNA after purification with
Streptavidin MagneSphere is incubated, scrubbed with reference to the Streptavidin MagneSphere of dsDNA, after dsDNA unwinds, with magnetic frame point
From collection supernatant;Supernatant obtains the secondary ssDNA libraries for next round screening Jing after ethanol precipitation;
(8) Cycle Screening:By the secondary ssDNA libraries obtained by step (7), as the secondary library of next round screening, and repeat
The screening process of step (3)~(7).
7. the aptamer C203 of the staphylococcus aureus enterotoxin C 2 according to claim 1-6 any one should
With, it is characterised in that:Application in separation, purifying staphylococcus aureus enterotoxin C 2.
8. the aptamer C203 of the staphylococcus aureus enterotoxin C 2 according to claim 1-6 any one should
With, it is characterised in that:Non-diseases methods for diagnosis and treatment application in analysis detection staphylococcus aureus enterotoxin C 2.
9. the aptamer C203 of the staphylococcus aureus enterotoxin C 2 according to claim 1-6 any one should
With, it is characterised in that:It is the application in the targeted therapy of effector molecule in staphylococcus aureus enterotoxin C 2.
10. the aptamer C203 of the staphylococcus aureus enterotoxin C 2 according to claim 1-6 any one
Using, it is characterised in that:Draw in treatment infection of staphylococcus aureus and in treatment staphylococcus aureus enterotoxin C 2
Play the application in related syndrome.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201611170849.9A CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201611170849.9A CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106636105A true CN106636105A (en) | 2017-05-10 |
CN106636105B CN106636105B (en) | 2019-01-22 |
Family
ID=58823295
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201611170849.9A Active CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106636105B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114634934A (en) * | 2020-12-16 | 2022-06-17 | 中国人民解放军军事科学院军事医学研究院 | Sequence of aptamer 3-2 and 2-27 for specifically recognizing staphylococcus aureus enterotoxin B and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060257864A1 (en) * | 2002-10-02 | 2006-11-16 | Hau-Yang Tsen | Primers useful in polymerase chain reaction for the identification of subtypes c1, c2 and c3 of staphylococcal enterotoxin type c |
CN102633867A (en) * | 2011-02-15 | 2012-08-15 | 中国科学院沈阳应用生态研究所 | Antigenically-changed enterotoxin C2 mutant, coding gene thereof, preparation thereof and application thereof |
-
2016
- 2016-12-16 CN CN201611170849.9A patent/CN106636105B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060257864A1 (en) * | 2002-10-02 | 2006-11-16 | Hau-Yang Tsen | Primers useful in polymerase chain reaction for the identification of subtypes c1, c2 and c3 of staphylococcal enterotoxin type c |
CN102633867A (en) * | 2011-02-15 | 2012-08-15 | 中国科学院沈阳应用生态研究所 | Antigenically-changed enterotoxin C2 mutant, coding gene thereof, preparation thereof and application thereof |
Non-Patent Citations (2)
Title |
---|
ZHAO WB等: "Transcytosis, Antitumor Activity and Toxicity of Staphylococcal Enterotoxin C2 as an Oral Administration Protein Drug", 《TOXINS》 * |
江丽等: "用SELEX技术筛选葡萄球菌肠毒素B特异性适配体", 《临床检验杂志》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114634934A (en) * | 2020-12-16 | 2022-06-17 | 中国人民解放军军事科学院军事医学研究院 | Sequence of aptamer 3-2 and 2-27 for specifically recognizing staphylococcus aureus enterotoxin B and application thereof |
CN114634934B (en) * | 2020-12-16 | 2024-04-26 | 中国人民解放军军事科学院军事医学研究院 | Sequence of aptamer 3-2 and 2-27 for specifically recognizing staphylococcus aureus enterotoxin B and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN106636105B (en) | 2019-01-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102703454B (en) | Nucleic acid aptamer capable of detecting myohemoglobin, microfluidic chip for screening and screening method and application | |
CN113151282A (en) | Aptamer binding to novel coronavirus (SARS-CoV-2) nucleocapsid protein and use thereof | |
CN103732748A (en) | Production method for nucleic acid aptamer | |
CN113481204B (en) | Aptamer of protein, derivative and application thereof | |
CN106591315B (en) | The aptamer C202 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
KR100961532B1 (en) | twenty one Single-stranded DNA aptamers having high affinity to tetracycline and it's analogues with high specificity and production method thereof | |
CN106701768B (en) | The aptamer C201 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
CN106636105B (en) | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
CN105349544A (en) | Nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof | |
CN106957905A (en) | A kind of molecular detecting method and Primer composition and kit for being used to assess immunotherapy of tumors effect | |
KR20180052991A (en) | DNA Aptamer Specifically Binding to Surface of Living Cell of Salmonella typhimurium and Uses Thereof | |
CN106854649B (en) | The aptamer C204 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
CN106801059B (en) | The aptamer C205 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
CN110819632B (en) | Aptamer for binding to trastuzumab | |
CN104774923B (en) | A kind of method for determining transcription control complex | |
CN105483133A (en) | Staphylococcus aureus toxic shock syndrome toxin-1(TSST-1) aptamer T-7 and preparation method and application thereof | |
CN110885829B (en) | Diphtheria toxin aptamer DT05 and application thereof | |
CN106866821A (en) | A kind of method that utilization high throughput sequencing technologies quickly obtain nano antibody | |
CN110904112B (en) | Diphtheria toxin aptamer DT03 and application thereof | |
CN110923239B (en) | Diphtheria toxin aptamer DT04 and application thereof | |
CN106480042A (en) | A kind of quick identification insulin aptamer INS2 and preparation method thereof | |
CN110885828B (en) | Diphtheria toxin aptamer DT01 and application thereof | |
CN102766632A (en) | Golgi apparatus membrane protein GP73 nucleic acid aptamer, as well as preparation method and application thereof | |
CN110951744B (en) | Aptamer specifically binding tumor necrosis factor-alpha and application thereof | |
CN114807150B (en) | Aptamer targeting and antagonizing HMGB1 molecule |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |