CN102766632A

CN102766632A - Golgi apparatus membrane protein GP73 nucleic acid aptamer, as well as preparation method and application thereof

Info

Publication number: CN102766632A
Application number: CN2012102359522A
Authority: CN
Inventors: 徐霞; 蔡媛媛
Original assignee: Individual
Current assignee: Individual
Priority date: 2012-07-09
Filing date: 2012-07-09
Publication date: 2012-11-07
Anticipated expiration: 2032-07-09
Also published as: CN102766632B

Abstract

The invention discloses a Golgi apparatus membrane protein GP73 nucleic acid aptamer of which the nucleotide sequence is shown in SEQ ID No.1. The Golgi apparatus membrane protein GP73 nucleic acid aptamer can be well combined with Golgi apparatus membrane protein GP73, has high specificity and sensitivity, can be preserved for a long time and is lower in cost. The invention further discloses a preparation method of the aptamer and the application of the aptamer in preparing diagnostic or therapeutic hepatocellular carcinoma medicines.

Description

A kind of Golgi membrane protein GP 73 nucleic acid aptamer, Its Preparation Method And Use

Technical field

The present invention relates to a kind of adaptive son, Its Preparation Method And Use, especially a kind of Golgi membrane protein GP 73 nucleic acid aptamer, its preparation method and the purposes in preparation diagnosis or treatment hepatocellular carcinoma medicine thereof.

Background technology

Along with the development of genetic engineering technique, people can carry out various proteic artificial expression according to gene order easily, have promoted the fast development based on the immunoassay technology of antigen antibody reaction greatly.However; Because the unstable of antibody itself;, hybridoma long like preparation cycle is prone to chromosome mutation takes place in the long-term frozen and process that goes down to posterity, and environment sensitive to external world, receives pH, temperature effect to be prone to inactivation; The influence of characteristics such as preservation period is short has restricted the specificity and the sensitivity of immunoassay technology to a certain extent.

Hepatocellular carcinoma (HCC) is one of the world's five big common cancers, and its rate of growth is very fast.Liver cirrhosis is an important development process in the HCC pathogenic process, and therefore, liver cirrhosis patient has been formed the high risk population of HCC.Recent study finds, a kind of Golgi membrane protein GP 73 is regarded as the HCC affinity tag of potentialization with good sensitivity.GP73 is as potential HCC affinity tag, at first to consider be set up a kind of economy, the easy strong method of immunity from interference detects GP73, like this could be really the value of GP73 be promoted the use in clinical.

At present, enzyme-linked immunosorbent assay (ELLSA) test kit that detects people GP73 occurs, but owing to receive the influence of antibody sources and self unstable character; Like the unstable of antibody itself (preparation cycle is long, and hybridoma is prone to take place chromosome mutation in long-term frozen and the process that goes down to posterity), and environment sensitive to external world; Receive pH, temperature effect to be prone to inactivation, the influence of characteristics such as preservation period weak point has restricted the specificity and the sensitivity of immunoassay technology to a certain extent; Experimentation on animals simultaneously is difficult to control, and preparation antibody is longer experimental period, and cost is higher; Use so only limit to scientific research at present, be difficult to push to clinical.

Aptamers is the oligonucleotide strand of a kind of DNA or RNA, and it can be with other molecular target high-affinities, combine with high specificity.It is utilization index enrichment part evolutionary system (systematic evolution of ligands by exponential enrichment, SELEX) technology screening and come from the oligonucleotide library of synthetic.The oligonucleotide strand that this technology is based in the library can be folded into the three-dimensional space three-dimensional arrangement, with the target high-affinity, the bonded characteristic is set up with high specificity.

Adaptive son (Aptamer; Claim aptamer again); It is that (it is in the nature RNA or strand NDA (single stranded DNA for systematic evolution of ligands by exponential enrichment, SELEX) the novel nucleic acids molecule with recognition function that obtains of screening for index concentration Fas lignand system evolution technology through the simulating nature evolutionary process; SsDNA) fragment; These fragments are when running into target molecules, and unique separately three-dimensional structure combines with target molecule can to form pocket, hair fastener, the G-tetramer etc., are similar to the process of antibodies specific identification corresponding antigens epi-position.Compare with antibody, the avidity of adaptive son and target is higher, even is better than its native ligand, and dissociation constant (kd) is many between pmol/L-nmol/L; Adaptive son can go out hairline on the target molecule structure respectively; Even can distinguish the difference of 1 methyl or 1 hydroxyl, formed the high degree of specificity of identification, and the adaptive sub-screening cycle is shorter; A general SELEX needs 8 ~ 15 circulations, about 2 months.The adaptive son of what is more important is convenient to modify, can be when synthetic accurately, fix a point, arbitrarily connect other functional groups and molecule, like sulfydryl, amino and resorcinolphthalein, vitamin H, enzyme etc.Because adaptive son is the mononucleotide sequence; In case filter out; Just can be fast the identical adaptive son of synthetic endlessly; Exist hardly adaptive son preparation batch between error, really realize efficiently, fast, synthetic cheaply, the experimentation on animals of having abandoned the Antibody Preparation of traditional complicacy, repetition, difficult control.Therefore, the appearance of adaptive son is the revolutionary new breakthrough again of biological diagnosis field.Adaptive sons such as the zymoplasm that screens so far, theophylline, anti-angiogenic endothelial factor have shown out wide application prospect in diagnosis.Based on adaptive son technology; Development high specific and highly sensitive detection novel method are also referred to as very active research probing direction of one of current life science, but at home and abroad do not appear in the newspapers as yet to the screening of the adaptive son of Golgi membrane protein GP 73 and the research that is used for hepatocarcinoma early diagnosis thereof.

Summary of the invention

The objective of the invention is to overcome the weak point of prior art and specific specificity and higher, the lower-cost Golgi membrane protein GP 73 of sensitivity nucleic acid aptamer are provided; Simultaneously, the present invention also provides the preparation method and its usage of said adaptive son.

For realizing above-mentioned purpose; The technical scheme that the present invention takes is: a kind of Golgi membrane protein GP 73 nucleic acid aptamer, its nucleotides sequence is classified as: 5'-ACGCTCGGATGCCACTACAGTTGGTTTTTTTTTGTTATTTAGAGTAAAAACCT TGTGTGTAGTGACTCATGGACGTGCTGGTGAC-3'.

Said gorky films in the protein GP 73 nucleic acid aptamer, and two ends are respectively 20 bases of sequence fixed, and middle 45 bases are and certain site, space bonded key structure of GP73.The sequence of Golgi membrane protein GP 73 nucleic acid aptamer according to the invention can be good at combining with GP73, and applies to clinical experiment.The principle of monitoring GP73 method is mainly based on antigen antibody reaction at present; But the preparation of antibody needs experimentation on animals; It is comparatively harsh that antibody self is preserved the condition of using, and has a lot of labile factors, and Golgi membrane protein GP 73 nucleic acid aptamer of the present invention has just remedied these labile factors; And preparation method and cost can be clinical widely-used laying a solid foundation of later stage than low of antibody more.

The present invention also puies forward a kind of preparation method of the protein GP 73 of Golgi membrane as stated nucleic acid aptamer, said method comprising the steps of:

(1) structure in ssDNA library at random: the library of ssDNA at random that makes up synthetic; The two ends of all oligonucleotide molecules are fixing identical sequence in the library; The centre is a stochastic sequence, and the length of stochastic sequence is 20-110nt, and the capacity of different oligonucleotide molecules is 10 in the library ¹⁴-10 ¹⁵

(2) the ssDNA library that step (1) is made up directly is used for screening, and screening process comprises: fixing, the library of target hatched, washed and discarded unconjugated adaptive son, wash-out jointly and collect the adaptive son that combines target, pcr amplification collection with target adaptive son, PCR obtains double-stranded DNA and is transformed into ssDNA and carries out lower whorl and screen; The ssDNA library reverse transcription that perhaps step (1) is made up becomes the RNA library; Be used for screening then, screening process comprises: fixing, the library of target hatch, wash and discard unconjugated adaptive son, wash-out jointly with target and collect the adaptive son that combines target, adaptive son, PCR that the adaptive sub-reverse transcription that will collect becomes ssDNA, pcr amplification to collect obtain double-stranded DNA and be transformed into ssDNA and carry out lower whorl and screen;

(3) repeating step (2) carries out the 8-15 wheel, can screen Golgi membrane protein GP 73 nucleic acid aptamer.

In the SELEX screening process of adaptive son; At first to make up the library of ssDNA at random of synthetic; The two ends of all oligonucleotide molecules are fixing identical sequence in the library; The centre is a stochastic sequence, and the length of stochastic sequence is generally at 20-110nt, so the capacity of different oligonucleotide molecules can reach 10 in the library ¹⁴-10 ¹⁵, constituted and had the diverse libraries that enriches molecular conformation, comprised the adaptive son that almost can combine in theory with all molecules of nature.The ssDNA library can directly be used for screening; Also but reverse transcription is used for screening after becoming the RNA library; Both differences are that ssDNA is more stable than RNA, but the conformation in RNA library can be selected different libraries than ssDNA horn of plenty more according to concrete requirement of experiment in the experiment.

The whole process of SESEX is an example with the ssDNA library; Fixing, the library that comprises target hatched, washed and discard unconjugated adaptive son, wash-out jointly and collect the adaptive son that combines target, adaptive son that pcr amplification is collected (as if selection RNA library with target; To the adaptive sub-reverse transcription of collecting be become ssDNA earlier; Carry out pcr amplification again), the double-stranded DNA that obtains of PCR is transformed into ssDNA (this ssDNA is the strand in the initial library, is not its anti-chain) and carries out the lower whorl screening.Repeat above-mentioned steps and carry out the 8-15 wheel, can screen and target high-affinity and specific adaptive son.At this moment, last PCR product of taking turns the screening gained is carried out cloning and sequencing, analyze the sequence of adaptive son, and carry out the evaluation of specificity and avidity, further isolate valuable adaptive son.

Preferred implementation as the preparation method of Golgi membrane protein GP 73 nucleic acid aptamer according to the invention; The ssDNA library that makes up in the said step (1) is the single-stranded DNA banks of total length 85bp: 5'-ACGCTC GGA TGC CAC TAC AG-45n-CTC ATG GAC GTG CTG GTG AC-3'; Two ends are respectively 20 bases of sequence fixed; Middle 45 bases are stochastic sequence, and whole library capacity is 454.

In addition, the present invention also provides the purposes of said Golgi membrane protein GP 73 nucleic acid aptamer in preparation diagnosis or treatment hepatocellular carcinoma medicine.

Golgi membrane protein GP 73 nucleic acid aptamer according to the invention and existing antigen-antibody compared with techniques; Said adaptive son does not need the complicated experimentation on animals of difficult control; Only need can accomplish in common lab; Because need albumen not injected in the animal body as antigen in the experimentation, need with albumen target only, can obtain through repeating screening.Experimental period is shorter, accomplishes from screening the cloning and sequencing analysis, can accomplish in 1 ~ 2 month, and experimentation on animals takes ability completion in 5 months at the soonest.After screening obtains adaptive son, only need can synthesize identical adaptive son endlessly according to the sequence of adaptive son, as long as technology suitably can be avoided the generation of differences between batches, this point is uncontrollable avoiding in the antibody preparation process.And the adaptive son of screening can carry out various modifications, and the hold-time is long, and working conditions is not harsh, is widely used in other aspects more.

Description of drawings

Fig. 1 is the SELEX screening process synoptic diagram of Golgi membrane protein GP 73 nucleic acid aptamer according to the invention.

Fig. 2 is ssDNA level library screening process synoptic diagram.

Fig. 3 is a pcr amplification gained dsDNA electrophorogram;

Among Fig. 3, M: lowDNA marker is contained in east; The 1:PCR cycle number is 5 o'clock, the dsDNA electrophoresis result; The 2:PCR cycle number is 8 o'clock, the dsDNA electrophoresis result; The 3:PCR cycle number is 12 o'clock, the dsDNA electrophoresis result; The 4:PCR cycle number is 16 o'clock, the dsDNA electrophoresis result; The 5:PCR cycle number is 20 o'clock, the dsDNA electrophoresis result; The 6:PCR cycle number is 30 o'clock, the dsDNA electrophoresis result.

Fig. 41,3,5,6,8,10 takes turns the histogram of screening library and reorganization GP73 combination rate;

Among Fig. 4, X-coordinate representes that different screening wheels count the library of gained; Ordinate zou is illustrated in the absorbancy at 405nm place.

Fig. 5 is normal liver tissue and the om observation figure of liver cancer tissue under low power lens and high power lens;

Among Fig. 5, A: normal liver tissue, arrow are illustrated in has the red-brown material in the observed bile duct under the low power lens; B: normal liver tissue, arrow are illustrated in the red-brown material of observing under the high power lens in the bile duct; C: liver cancer tissue, arrow represent respectively under the low power lens in the bile duct with extensive hepatic tissue in the reddish-brown material; D: liver cancer tissue, arrow are illustrated under the high power lens, observe in the bile duct and the reddish-brown material in the extensive hepatic tissue.

Embodiment

The object of the invention, technical scheme and advantage will combine accompanying drawing and specific embodiment that the present invention is further described below for better explaining.

The screening of embodiment 1 Golgi membrane protein GP 73 nucleic acid aptamer

1, ssDNA library and corresponding primer synthetic at random:

The synthetic total length of design is single stranded DNA (ssDNA) library: the 5'-ACGCTCGGATGCCACTACAG-45n-CTCATGGACGTGCTGGTGAC-3' of 85bp; Two ends are respectively 20 bases of sequence fixed; So that design corresponding PCR primer; Middle 45 bases are stochastic sequence, and whole library capacity has reached 454; Upstream primer 5'-ACG CTC GGA TGC CAC TAC AG-3', downstream primer 5'-GT CAC CAG CAC GTC CAT GAG-3'; Upper reaches labeled primer 5'-DIG (digoxin)-ACG CTC GGA TGC CAC TAC AG-3', downstream labeled primer 5'-Biotin (vitamin H)-GT CAC CAG CAC GTC CAT GAG-3'.

2, the screening of the adaptive son of GP73 albumen:

(1) GP73 albumen encapsulates on 96 orifice plates (coating buffer is 0.05mol/LNaHCO3, the damping fluid of PH9.6) with the amount of every hole 200ng, and 4 ℃ encapsulate and spend the night, and set up the blank hole; Discard liquid in the hole next day, with PBS-T washing 3 times, do in the thieving paper arsis, albumen encapsulates the hole and 2h is all sealed for L37 ℃ with 3%BSA200 μ in the blank hole.

(2) the ssDNA library of 10 μ M is mixed with a certain amount of binding buffer liquid SHCMK liquid at random (attention adjustment ssDNA library amount, in the screening of the first round, the library amount is 2000pmol; Through the increase of screening wheel number, the library amount reduces gradually), mixed library combines 40min for 37 ℃ with the blank hole of 3%BSA sealing earlier; Anti-sieve goes and blank well bonded ssDNA, then mixed solution is transferred to albumen and encapsulates the hole, and 37 ℃ combine 40min; With dcq buffer liquid (SHCMK liquid+0.05%Tween20) wash six times, the unconjugated ssDNA of flush away adds elution buffer (20mmol/L Tris-HCL again; The 4mol/L guanidinium isothiocyanate, 1mmol/DTT is PH8.3) in 80 ℃ of effect 10min; Following and the target protein bonded ssDNA of wash-out through the DNA purification kit, is dissolved in ssDNA in the 50 microlitre TE damping fluids.

(3) ssDNA with above-mentioned purifying gained is a template, carries out pcr amplification with upstream primer and vitamin H downstream labeled primer, and amplification system is following:

(4) get 100 μ L magnetic bead suspensions in the EP of 1.5ml pipe, then the EP pipe is placed on 2min on the magnetic force frame, magnetic bead is adsorbed in a side of EP pipe under the effect in magnetic field; Discard with liquid in the transfer pipet draft tube, the EP pipe is got on down from the magnetic force frame, the magnetic bead in managing with the resuspended EP of 100 μ L with 1 * B&W; Repeat above-mentioned steps three times, after soon magnetic bead cleans three times, with the magnetic bead in the resuspended EP pipe of 2 * B&W50 μ L; To wait volume doubly to add the biotin labeled dsDNA behind DNA purification kit purifying in the step (3), 37 ℃ of water-bath 20min make dsDNA fully combine with the magnetic bead that is marked with avidin again; Make dsDNA unwind sex change become ssDNA with the NAOH100 μ L of 150mM last this moment, and the strand and the avidin that have vitamin H are connected and are combined on the magnetic bead, and the library chain is in unbound state; Utilize the magnetic force frame again; Separate magnetic bead and free solution, just can obtain library ssDNA as secondary library, shown in accompanying drawing 2.

(5) encapsulate on 96 orifice plates with the GP73 recombinant protein of every hole 180ng, 4 ℃ encapsulate and spend the night 3%BSA37 ℃ of sealing next day 2h again.Separating the secondary library content obtain in the adjustment (4) is 1500pmol, with final concentration be 0.15mg/LtRNA at binding buffer liquid SHCMK liquid thorough mixing, mixed solution is transferred to albumen encapsulates the hole; 37 ℃ combine 40min, wash six times the unconjugated ssDNA of flush away with dcq buffer liquid; Add elution buffer again, in 80 ℃ of effect 10min, the following and target protein bonded ssDNA of wash-out; Through the DNA purification kit, ssDNA is dissolved in the 20 microlitre TE damping fluids.

(6) subsequent step is with (3) (4), and this is second to take turns the secondary library of screening gained.Because the content of the adaptive son of high-affinity is very low in the library, thus pET-32a (+)-GP73 recombinant protein of high level in initial several the wheel, should be used, to guarantee to capture as much as possible corresponding adaptive son; In the screening subsequently; Because the adaptive son of high-affinity obtains enrichment through pcr amplification, its concentration is enough to and the adaptive son competition of high-load low-affinity, reduces pET-32a (+)-GP73 recombinant protein package amount this moment; To strengthen the preciseness of screening; TRNA is non-specific competitor, with adaptive son competition binding purposes albumen, along with the increase of screening wheel number; TRNA concentration also constantly increases, and helps from random library, filtering out the adaptive son of high-affinity.So circulation, along with the continuous increase of the rigorous degree of screening, the low-affinity sequence is eliminated gradually.After process about 6～12 is taken turns screening, measure every gained library and GP73 combination rate of taking turns, when combination rate reaches capacity, stop screening, screening process is specifically screened content and is seen table 1 shown in accompanying drawing 1.

Table 1

The mensuration of embodiment 2 libraries and target protein combination rate

(1) with 1,3,5,6,8,10 take turns the screening gained secondary ssDNA library carry out pcr amplification with the upstream primer and the biotin labeled downstream primer of digoxigenin labeled, amplification system is following:

(2) only if beyond the dsDNA library chain marked vitamin H that amplifies; The library chain also on the mark digoxin; DsDNA utilizes avidin magnetic bead and magnetic force frame (step is with (4) among the embodiment 1) can isolate the library chain of digoxigenin labeled behind DNA purification kit purifying.

(3) recombinant protein with every hole 200ng encapsulates 96 orifice plates, encapsulates 12 holes altogether, and per 2 Kong Weiyi group is all set up blank hole and syphilis albumen control wells for every group.Regulate 1,3,5,6,8,10 take turns the gained digoxigenin labeled library concentration be 40ng/ μ L, make library content consistent, add respectively every group plate hole in; 37 ℃ of incubations 2 hours; Discard solution in the hole, with lavation buffer solution (pH7.4PBS-T) washing 3 times, each 3min; Wash plate and clap dried back in each reacting hole; DigiTAb (extent of dilution after titration is 1:10000) the 200 μ L that add the alkali phosphatase enzyme mark of fresh dilution; Hatched 0.5-1 hour for 37 ℃; PBS-T washing 3 times, last is all over wash DEA (diethanolamine) damping fluid balance 5min with ddH2O; Discard in the hole solution clap do after, in each reacting hole, add the PNPP of 200 μ L 1mg/mL of interim preparation, 30 ℃ of 45min colour developings; In each reacting hole, add 1M sodium hydroxide 100 μ L termination reactions; On the ELISA detector,, survey each hole OD value with zeroing back, blank hole in the 405nm place.

Cloning and sequencing

(1) through the analysis of combination rate, taking turns the ssDNA that is obtained with 6,8,10 is template, with normal unlabelled primer up and down ssDNA is increased into dsDNA, and amplification system is following:

(2) take turns the dsDNA product that obtains that increases with 6,8,10 and link to each other with the pMD19-T carrier respectively, linked system is following:

16 ℃, connection is spent the night.

(3) be added to 6,8, the 10 product full doses (10 μ l) that will connect of taking turns in 3 EP pipe that DH5 α competent cell is housed for preparing next day respectively, places 30min in the ice; After 42 ℃ of 90 seconds of heating, in ice, place 3min again, add 500 μ l LB substratum in every arm; 37 ℃ of shaking culture 1h; The centrifugal 10min of 4100rpm rotating speed collects thalline, respectively with the resuspended thalline of the LB of 200 μ l; Then resuspended bacterium liquid is spread upon on 3 LB solid plates that contain Amp uniformly 37 ℃ of incubated overnight of marked.

(4) second days, a picking 30-50 bacterial strain was the bacterium liquid PCR that connects product and is identified on 6,8,10 flat boards of taking turns respectively.

(5) in above-mentioned 3 flat boards, each dull and stereotyped picked at random 30 strain positive strain is sent to the order-checking of Ying Jun company.

(6) according to sequencing result, utilization uses RNA Structure software that institute's calling sequence is carried out the prediction of primary structure homology analysis and secondary facility.

Experimental result

SsDNA gropes to the dsDNAPCR cycle number

SsDNA with first round screening purifying gained is a template, carries out pcr amplification with upstream primer with vitamin H downstream labeled primer and becomes dsDNA, produces the dsDNA electrophoresis result under the different PCR cycle numbers; Can be known by Fig. 4, be the library band (swimming lane 1) of 5 o'clock promptly visible 85bp in the PCR cycle number, and this moment, the product amount was not high; A little less than the band brightness of library, along with the increase of PCR cycle number, the product amount increases (swimming lane 2,3) gradually; But to cycle number is 16 o'clock; Non-specific band (

swimming lane

4,5,6) above the band of library, occurred, the PCR product when select cycle number to be 12 (swimming lanes 3) this moment is that subsequent experimental is used, has both guaranteed that product reaches maximum; Can not produce non-specific band again, see accompanying drawing 3 for details.

1,3,5,6,8,10 takes turns screening library and the detection of reorganization GP73 combination rate

Along with the increase of screening wheel number, obtained enrichment with GP73 bonded library, risen to the tenth 0.655-0.612 that take turns from the 0.060-0.057 of the first round, the result sees table 2 and Fig. 4.

Table 2

Take turns the screening library by 1,3,5,6,8,10 and can know with reorganization GP73 combination rate histogram (accompanying drawing 4), along with the increase of screening wheel number, each combination rate of organizing library and reorganization GP73 increases; To the 6th, 8,10 these three-wheels; Amplification is not obvious, explains that the combination rate of library and GP73 is tending towards saturated, stops screening this moment; Select the 6th, 8,10 libraries of taking turns to carry out cloning and sequencing, analyze.

6th, 8,10 take turns the library sequencing analysis

Get each 30 strain of bacterium liquid sample of 6,8,10 positive colonies of taking turns, the order-checking of Ying Jun company is sent in totally 90 strains, and sequencing result does, in the 10th takes turns, two pairs of identical sequences occurred, and all the other are unique sequence all, and the result is following:

The 10th takes turns The selection result:

Aptamer10-2 is consistent with the Aptamer10-3 sequence

Aptamer10-2：

ACGCTCGGATGCCACTACAGTTGGTTTTTTTTTGTTATTTAGAGTAAAAACCTTGTGTGTAGTGACTCATGGACGTGCTGGTGAC

Aptamer10-3：

The Preliminary Applications of embodiment 3 Golgi membrane protein GP 73 nucleic acid aptamers according to the invention in clinical immunohistochemical methods

Liver cancer tissue and normal liver tissue section are provided by attached first hospital of Guangzhou Medical College; Liver tissue slices is after 30 minutes processed of 60 ℃ of roasting sheets; Carry out dewaxing treatment (YLENE I 15 minutes, YLENE II 10 minutes, absolute ethyl alcohol I 2 minutes, absolute ethyl alcohol II 2 minutes, 95% alcohol 2 minutes, 90% alcohol 2 minutes); In microwave, use Citrate trianion to repair (moderate heat 10 minutes, cooling 20 minutes, TBST washed 5 minutes) again, use 3%H after the reparation ₂O ₂Handle 15 minutes again with TBST sealing 30 minutes, add biotinylated aptamer10-2 after the sealing again, hatched 2 hours for 37 ℃, hatch back TBST and wash 3 times; Each 3 minutes, washing back adding avidin mark-HRP, (1:500 dilution) 37 ℃ hatched 2 hours; With TBST washing 3 times, add the HRP-goat anti-rabbit igg again, (1:5000 dilution) 37 ℃ hatched 2 hours; Anti-washing back adds the DBA colour developing, adds haematoxylin dyeing 2 minutes after the water termination reaction, uses the flowing water color development stopping; After the hydrochloride alcohol differentiation, in flowing water, washed 15 minutes, the result is through om observation, shown in accompanying drawing 5 again.

The result

Select section of normal liver tissue bile duct and liver cancer tissue pathological section, observe the situation of adaptive sub-aptamer10-2 identification GP73, can find out from figure below; Under the low power lens, among the healthy tissues A, nucleus all is blue; Reddish-brown only at the bile duct position of arrow indication, show adaptive son can with the GP73 combination in the healthy tissues bile duct, in liver cancer tissue C; Go out bile duct and become outside the reddish-brown, liver cell is organized and all becomes reddish-brown, explains that GP73 extensively exists in liver cancer tissue; Prove also simultaneously that adaptive son can combine with the GP73 in this tissue; High power lens is observed among healthy tissues B and the liver cancer tissue D, the clearer distribution of seeing GP73 of ability, and the adaptive sub-aptamer10-2 that this explanation is screened has the function of good identification tissue GP73.

Last institute should be noted that; Above embodiment is only in order to technical scheme of the present invention to be described but not to the restriction of protection domain of the present invention; Although the present invention has been done detailed description with reference to preferred embodiment; Those of ordinary skill in the art should be appreciated that and can make amendment or be equal to replacement technical scheme of the present invention, and do not break away from the essence and the scope of technical scheme of the present invention.

Claims

1. a Golgi membrane protein GP 73 nucleic acid aptamer is characterized in that its nucleotides sequence is classified as: 5'-ACGCTCGGATGCCACTACAGTTGGTTTTTTTTTGTTATTTAGAGTAAAAACCT TGTGTGTAGTGACTCATGGACGTGCTGGTGAC-3'.

2. the preparation method of Golgi membrane protein GP 73 nucleic acid aptamer according to claim 1 is characterized in that, said method comprising the steps of:

3. the preparation method of Golgi membrane protein GP 73 nucleic acid aptamer according to claim 1; It is characterized in that; The ssDNA library that makes up in the said step (1) is the single-stranded DNA banks of total length 85bp: 5'-ACG CTC GGA TGC CAC TAC AG-45n-CTC ATG GAC GTG CTG GTGAC-3'; Two ends are respectively 20 bases of sequence fixed, and middle 45 bases are stochastic sequence, and whole library capacity is 454.

4. the purposes in the hepatocellular carcinoma medicine is diagnosed or treated to Golgi membrane protein GP 73 nucleic acid aptamer in preparation according to claim 1.