CN110117595B - Aptamer specifically binding to PDL1 and application thereof - Google Patents
Aptamer specifically binding to PDL1 and application thereof Download PDFInfo
- Publication number
- CN110117595B CN110117595B CN201910407453.9A CN201910407453A CN110117595B CN 110117595 B CN110117595 B CN 110117595B CN 201910407453 A CN201910407453 A CN 201910407453A CN 110117595 B CN110117595 B CN 110117595B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- pdl1
- cells
- tumor
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57423—Specifically defined cancers of lung
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/5743—Specifically defined cancers of skin, e.g. melanoma
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70532—B7 molecules, e.g. CD80, CD86
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid aptamer specifically binding to a PDL1 protein molecule on the surface of a cancer cell, wherein the sequence of the nucleic acid aptamer is shown as SEQ ID NO: 1 and application thereof in tumor detection and promotion of killing of T cells on tumor cells; the aptamer disclosed by the invention can be specifically bound with PDL1 protein on the surface of a tumor cell, the affinity is high, and the single-stranded oligonucleotide only recognizes a complementary spatial structure, so that non-specific binding can be almost completely avoided; the aptamer disclosed by the invention is low in synthesis cost, automation can be realized by adopting a SELEX screening technology, and the screened aptamer is high in purity, good in accuracy and good in repeatability through chemical synthesis.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a nucleic acid aptamer specifically binding to PDL1 and application thereof.
Background
Programmed death receptor 1 (PD-1) is a transmembrane receptor on the surface of a T cell and is involved in apoptosis of the cell, PD1 interacts with PDL1(PD-1ligand1, PD-L1) and PDL2(PD-1ligand2, PD-L2) ligands to inhibit proliferation of the T cell, and PDL1 and DPL2 are mainly expressed in antigen presenting cells (such as DC cells and macrophages). The research shows that PDL1 is highly expressed by various tumor cells, such as multiple myeloma, melanoma, non-small cell lung cancer, ovarian cancer, renal cancer and the like. The tumor cells highly express PDL1 under the action of various factors, interact with PD1 molecules on the surface of T cells, inhibit the activation and proliferation of the T cells, and further cause an immune escape phenomenon. Meanwhile, a plurality of researches prove that the increase of the expression level of PDL1 protein in cancer tissues obviously reduces the prognosis and survival rate of patients, so that the PDL 1/PDL1 signal channel is blocked, and the killing of T cells to tumor cells and the treatment effect of tumors can be effectively enhanced.
An Aptamer (Aptamer) is a piece of DNA, usually an oligonucleotide fragment obtained from a library of nucleic acid molecules using in vitro screening techniques, the exponential enrichment of ligands by exponential evolution, SELEX. Aptamers are widely used in the field of biosensors because they bind to a variety of target substances with high specificity and selectivity, and the configuration of the aptamers itself changes when the aptamers bind specifically to the target substances. The traditional antigen-antibody reaction has better sensitivity and specificity, enzyme-linked immunosorbent assay plays a very important role in the detection of various biomolecules, but protein is used as a probe molecule, is easily denatured by environmental factors such as pH, temperature and the like, is expensive to synthesize, and an aptamer is composed of DNA or RNA (mainly DNA), has smaller volume and better stability than protein, is expected to replace enzyme-linked immunosorbent assay in the future, and becomes a powerful weapon for the detection of various chemical molecules.
Disclosure of Invention
In order to solve the above problems, it is an object of the present invention to provide a nucleic acid aptamer that specifically binds to PDL1, and use thereof.
In order to achieve the purpose, the invention is realized by the following technical scheme:
an aptamer specifically binding to cancer cell surface PDL1 protein molecules, wherein the sequence of the aptamer is shown as SEQ ID NO: 1 is shown.
The invention also comprises the application of the aptamer specifically binding to the PDL1 protein molecule on the surface of the cancer cell in tumor detection.
The invention also comprises application of the aptamer specifically binding to the PDL1 protein molecule on the surface of the cancer cell in promoting killing of the T cell to the tumor cell.
Preferably, the tumor is lung cancer, multiple myeloma, renal cancer or melanoma.
Compared with the prior art, the invention has the following advantages:
the aptamer disclosed by the invention can be specifically bound with PDL1 protein on the surface of a tumor cell, the affinity is high, and the single-stranded oligonucleotide only recognizes a complementary spatial structure, so that non-specific binding can be almost completely avoided; the aptamer disclosed by the invention is low in synthesis cost, automation can be realized by adopting a SELEX screening technology, and the screened aptamer is high in purity, good in accuracy and good in repeatability through chemical synthesis.
Drawings
FIG. 1 is a schematic flow diagram of a process for preparing a nucleic acid aptamer that specifically binds to PDL 1;
FIG. 2 is a schematic representation of flow cytometry to detect the intensity of PE fluorescence in various groups of cells;
FIG. 3 is a graph of fluorescence intensity of aptamers No. 2 and unintentional aptamers incubated with human multiple myeloma cell lines RPMI8226 and L363, respectively;
FIG. 4 is a graph of KD values for aptamer No. 2 versus RPMI8226 and L363 cells;
FIG. 5 is a graphical representation of the results of microscopic identification and binding of aptamers # 2 and control to renal cancer tissue sections;
FIG. 6 is a schematic diagram of the microscopic fluorescence results of recognition and binding of PDL1 protein on the surface of lung cancer cells and normal lung cells by aptamer No. 2.
Detailed Description
The invention aims to provide a nucleic acid aptamer specifically binding to PDL1 and application thereof, and the nucleic acid aptamer is realized by the following technical scheme:
an aptamer specifically binding to cancer cell surface PDL1 protein molecules, wherein the sequence of the aptamer is shown as SEQ ID NO: 1 is shown.
The invention also discloses application of the aptamer specifically binding to the PDL1 protein molecule on the surface of the cancer cell in tumor detection.
The invention also discloses application of the aptamer specifically binding to the PDL1 protein molecule on the surface of the cancer cell in promoting killing of the T cell on the tumor cell.
Preferably, the tumor is lung cancer, multiple myeloma, kidney cancer and melanoma, and the multiple myeloma cell line is RPMI8226, L363, etc.
The invention is further described with reference to specific examples.
Example 1
An aptamer specifically binding to cancer cell surface PDL1 protein molecules, wherein the sequence of the aptamer is shown as SEQ ID NO: 1 is shown.
Example 2
1. As shown in the flow chart of FIG. 1, a random oligonucleotide library is created by artificial synthesis, and nucleic acid aptamers (aptamers) specifically binding to a target protein are selectively isolated by using PDL1 protein as the target protein.
2. RPMI8226 belongs to PDL1 positive high-expression cells, and L363 belongs to negative low-expression cells. Subtractive SELEX was used to screen for aptamers that specifically bind to PDL1 protein. Subtractive SELEX screening of three aptamers that specifically bind to PDL1 protein, while designing an unintended aptamer;
unintended aptamer sequence SEQ ID NO: 2:
acgggccaaatactcattcggtacgaccatgcgaccactgcttacgt；
aptamer sequence No. 1 SEQ ID NO: 3:
acgggcctcacacatcaataattagccactgcctagagcgttcgcgt；
aptamer sequence No. 2 SEQ ID NO: 1:
acgggcctctctgaacaaaggtattagacatcatgcgtgcccccagt；
aptamer sequence No. 3 SEQ ID NO: 4:
acgggcacacatcactcgctgcccgtaagattattgaccaatcacgt；
subtractive SELEX screening employs the following steps:
adding 35 microliters of random oligonucleotide library with the concentration of 10 pmol/. mu.L into 200 microliters of selective buffer (Tris.HCl 50 mM; KCl 5 mM; NaCl 100 mM; MgCl 1 mM; pH7.4), heating to 99 ℃ for 5min for denaturation, and immediately placing at 0 ℃ for 5min (adding excessive yeast tRNA and BSA to reduce background);
mixing the solution with 1/105Uniformly mixing and incubating RPMI8226 cells at 37 ℃ for 30min, centrifuging at 1000rpm for 5min, discarding supernatant, dissolving precipitate with selective buffer solution, uniformly mixing, centrifuging at 1000rpm, and repeating the steps for 6 times;
thirdly, adding double distilled water into the precipitate, heating at 100 ℃ for 10min, centrifuging at 10000rpm for 5min, extracting nucleotide from the supernatant, and dissolving in 20 microliters of buffer solution;
fourthly, performing PCR amplification by taking the extracted nucleotide as a template:
reaction system: 20 microliter of template; 10 microliter of buffer solution; 5 microliters of dNTPs; MgCL23.5 microliters; 5 microliters of each of the upstream and downstream primers; 5 microliter of Taq enzyme; adding water to 50 microliter;
reaction conditions: 94 ℃ 3min, 20 cycles: 94 ℃ 50s, 55 ℃ 50s, 72 ℃ 50s, and finally 72 ℃ for 5 min.
Carrying out phenol reaction on the PCR product: extracting nucleic acid with chloroform, and dissolving in buffer solution;
sixthly, repeating the steps of the first step and the second step for about 10 times, screening out a proper amount of aptamer, and further eliminating non-specific binding through inverse screening;
performing inverse screening on the 10-round screened oligonucleotide library by using L363 cells as negative target cells, heating the PCR product at 99 ℃ for 5min, and immediately placing the PCR product at 0 ℃ for 5 min;
and firstly 1 x 105Centrifuging L363 cells, removing supernatant, mixing the above liquid and cell precipitate at 37 deg.C, incubating for 30min, centrifuging at 1000rpm for 5min, collecting supernatant, and further centrifuging with 1 × 105Incubating the L363 cells at 37 ℃ for 30min, centrifuging at 1000rpm for 5min, collecting the supernatant, and repeating the steps for 5 times;
the self-checking is to amplify the last screened nucleotide into dsDNA by using an upstream and downstream sequencing primer, to be connected to a T carrier after recovery and purification, and to be randomly selected for sequencing after screening;
10) finally, determining three aptamers and synthesizing an unintentional aptamer through 11 rounds of positive sieves and 6 rounds of negative sieves;
3. the research shows that the expression of PDL1 protein on the cell surface of the multiple myeloma cell line RPMI8226 is obviously increased under the stimulation of IFN-gamma. Based on this, we examined the binding of the selected aptamer to human PDL1 protein and compared it with PDL1 antibody. RPMI8226 cell line was passaged into ten wells of a twenty-four well plate, 3 x 10 per well5Selecting five wells at random, adding 1000IU IFN-gamma to each well, 37 deg.C, and 5% CO2Incubating for 24 hours in an incubator;
4. after 24h, the cells in eight of the wells (4 without stimulation, 4 IFN- γ with stimulation for 24h) were removed and added separately to a sterilized 1.5ml EP tube, centrifuged at 1000rpm for 15min, the supernatant discarded, washed once with pre-cooled PBS, centrifuged to discard the supernatant, incubated with PE-labeled different aptamers (unintentional aptamers and aptamers No. 1-3) in 100 μ l of pre-cooled PBS solution in the dark for 20min, while the cells in the remaining two wells were collected and incubated with 5 μ l of PE-PDL1 antibody in the dark for 20 min. After incubation, centrifuging, removing the supernatant, washing once with 200 microliters of precooled PBS, centrifuging again, removing the supernatant, adding 600 microliters of precooled PBS, resuspending the cells, and detecting the PE fluorescence intensity in each group of cells by a flow cytometer, as shown in fig. 2, it has been reported that the expression of PDL1 protein on the cell surface is significantly increased by RPMI8226 under the stimulation of IFN- γ, and the result is also confirmed by co-incubation of PE-PDL1 antibody and cells. We also found that PE-labeled aptamer No. 2 showed results that most closely matched those of PDL1 antibody, suggesting that our binding of aptamer No. 2 to PDL1 protein was slightly different from that of PDL1 antibody. (p <0.05 compared to placebo, p <0.01 compared to placebo).
5. Human multiple myeloma cell lines RPMI8226 (high expression PDL 1) and L363 (low expression PDL 1) were cultured in 1640 medium containing 10% FBS at 37 ℃ and 5% CO, respectively2Culturing in an incubator. During the logarithmic growth phase, 1 x 10 cells were collected5RPMI8226 and L363, which were reacted with a series of FAM-labeled aptamers No. 2 at different concentrations (0, 5, 25, 125, 250, 500, 1000nM) in 100 μ L binding buffer (PBS solution containing 0.5% BSA) at 37 ℃ for 60 minutes, washed twice with PBS and detected on an on-cell flow cytometer: an equivalent length of unintended aptamer served as a random control. The results in FIG. 3 show that 1000nM fluorescence intensity of aptamer No. 2 incubated with high expression RPMI8226 cells in PDL1 is significantly stronger than that of the random control group, while the fluorescence intensity of aptamer No. 2 incubated with low expression L363 cells is slightly different from that of the random control group. The result shows that the 2 # aptamer has strong binding property with PDL1 high-expression cells. Calculating KD values of the aptamer No. 2, RPMI8226 cells and L363 cells by using GraphPad Prism5 software, wherein the KD values of the aptamer No. 2 and the RPMI8226 cells are 68.45 +/-5.36, the KD value of the L363 cells is 189.35 +/-51.34, and the binding capacity of the aptamer No. 2 and the RPMI8226 cells is stronger than that of the L363 cells as shown in the analysis result shown in FIG. 4;
6. clinical renal cancer pathological sections are adopted to verify the recognition and binding of No. 2 aptamer to PDL1 protein on the surface of the cancer tissue. Baking the normal kidney tissue and kidney cancer tissue sections embedded in paraffin in an oven at 65 ℃ for 1h, and soaking the sections in xylene for dewaxing twice, wherein each time lasts for 10 min; soaking in anhydrous ethanol twice, each for 5 min; slicing with gradient ethanol (90%, 85%, 70% ethanol once each for 3min), and soaking in PBS; performing antigen retrieval on the slices by a microwave retrieval method, cooling to room temperature, and washing twice by PBS; then sealing the mixture for 1h at room temperature by using goat serum; removing the confining liquid, and adding HRP-labeled aptamer No. 2 respectively to incubate for 1h at 4 ℃; washing with washing buffer for 5min for 3 times; then adding horseradish enzyme labeled streptavidin working solution for incubation for 30min at room temperature; after washing, adding DAB developing solution for developing (controlling time under the mirror). Gradient alcohol dehydration, xylene transparency, neutral gum sealing, and microscopic observation. As shown in FIG. 5, the aptamer No. 2 can specifically recognize PDL1 protein on the surface of the kidney cancer cell, but shows weak binding with normal kidney, and the aptamer in the control group also has weak binding with PDL1 protein in kidney cancer tissue, so that the aptamer No. 2 can be clinically used for detecting and diagnosing PDL1 protein on the surface of the kidney cancer cell.
7. Clinical non-small cell lung cancer pathological sections are adopted to further verify the recognition and the combination of the aptamer No. 2 and the PDL1 protein on the surface of the lung cancer cells. Baking paraffin-embedded normal lung and non-small cell lung cancer histopathological sections in an oven at 60 ℃ for 1.5h, and soaking the sections in xylene for dewaxing twice, wherein each time lasts for 10-20 min; soaking in anhydrous ethanol twice, each for 5-10 min; slicing with gradient ethanol (90%, 85%, 70% ethanol once each for 3-5min), and soaking in PBS; performing antigen retrieval on the slices by a microwave retrieval method, cooling to room temperature, and washing twice by PBS; adding Cy5 labeled aptamer No. 2, incubating at 4 ℃ for 1-2 hours, washing twice with PBS (phosphate buffer solution) for 3-5min each time, sealing with an anti-fluorescence quenching sealing agent, and observing under a fluorescence microscope. The results are shown in fig. 6, the red fluorescence intensity of the non-small cell lung cancer tissue is significantly higher than that of the normal lung tissue, which suggests that the aptamer No. 2 can identify and bind to PDL1 protein on the surface of the non-small cell lung cancer tissue.
Sequence listing
<110> Shandong Oncuo Biotech Co., Ltd
<120> nucleic acid aptamer specifically binding to PDL1 and application thereof
<141> 2019-05-10
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acgggcctct ctgaacaaag gtattagaca tcatgcgtgc ccccagt 47
<210> 2
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgggccaaa tactcattcg gtacgaccat gcgaccactg cttacgt 47
<210> 3
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
acgggcctca cacatcaata attagccact gcctagagcg ttcgcgt 47
<210> 4
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
acgggcacac atcactcgct gcccgtaaga ttattgacca atcacgt 47
Claims (4)
1. An aptamer that specifically binds to a cancer cell surface PDL1 protein molecule, wherein: the sequence is shown as SEQ ID NO: 1 is shown.
2. The use of the aptamer of claim 1, which specifically binds to cancer cell surface PDL1 protein molecule, for the preparation of a tumor detection reagent.
3. The use of the aptamer of claim 1, which specifically binds to PDL1 protein molecule on the surface of cancer cells, in the preparation of a reagent for promoting T cell killing of tumor cells.
4. Use according to claim 2 or 3, characterized in that: the tumor is lung cancer, multiple myeloma, renal cancer or melanoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910407453.9A CN110117595B (en) | 2019-05-15 | 2019-05-15 | Aptamer specifically binding to PDL1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910407453.9A CN110117595B (en) | 2019-05-15 | 2019-05-15 | Aptamer specifically binding to PDL1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110117595A CN110117595A (en) | 2019-08-13 |
| CN110117595B true CN110117595B (en) | 2020-11-10 |
Family
ID=67522577
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910407453.9A Active CN110117595B (en) | 2019-05-15 | 2019-05-15 | Aptamer specifically binding to PDL1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110117595B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021132936A1 (en) * | 2019-12-27 | 2021-07-01 | 인터올리고 주식회사 | Anti-cancer immunotherapeutic composition for treating cancer |
| CN113699157B (en) * | 2020-05-20 | 2023-03-31 | 中国科学院苏州纳米技术与纳米仿生研究所 | PD-L1 aptamer, and screening method and application thereof |
| CN114127293B (en) * | 2020-06-30 | 2023-08-04 | 首都师范大学 | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application of method in cancer diagnosis |
| CN113667672A (en) * | 2021-08-09 | 2021-11-19 | 优葆优保健康科技(宁波)有限公司 | DNA aptamer targeting PD-L1 extracellular segment |
| CN116875604A (en) * | 2022-10-19 | 2023-10-13 | 聊城市人民医院 | DNA aptamer for detecting PD-L1 positive cells and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108026533B (en) * | 2015-09-01 | 2021-08-17 | 中央研究院 | Antagonistic PDL1 aptamers and their use in cancer therapy |
| CN107794268B (en) * | 2017-03-14 | 2021-03-26 | 湖南大学 | Aptamer for detecting human PDL1 protein and application of aptamer in preparation of detection preparation |
| CN107794267B (en) * | 2017-03-14 | 2021-03-26 | 湖南大学 | Bispecific aptamer targeting PD1-PDL1 and derivative thereof |
| CN109387499B (en) * | 2017-08-08 | 2021-03-26 | 华东师范大学 | PD-L1 probe and preparation method and application thereof |
| CN108929874B (en) * | 2018-07-11 | 2021-12-14 | 安徽省昂普拓迈生物科技有限责任公司 | Nucleic acid aptamer specifically binding to cell with high-expression PDL1 protein and application of nucleic acid aptamer |
-
2019
- 2019-05-15 CN CN201910407453.9A patent/CN110117595B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110117595A (en) | 2019-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117595B (en) | Aptamer specifically binding to PDL1 and application thereof | |
| Sole et al. | The circulating transcriptome as a source of cancer liquid biopsy biomarkers | |
| Berezovski et al. | Aptamer-facilitated biomarker discovery (AptaBiD) | |
| JP2019535307A (en) | Sequencing and analysis of exosome-bound nucleic acids | |
| Ozato et al. | Spatial and single-cell transcriptomics decipher the cellular environment containing HLA-G+ cancer cells and SPP1+ macrophages in colorectal cancer | |
| JP2024009855A (en) | Non-coding rna for detection of cancer | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN106957906B (en) | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease | |
| CN107090503B (en) | Probe composition, gene capture chip, kit and application thereof | |
| CN111073892A (en) | Aptamer for identifying grouper iridovirus infected cells and construction method and application thereof | |
| Afshar et al. | Transcriptional drifts associated with environmental changes in endothelial cells | |
| CN113699156B (en) | PD-1 nucleic acid aptamer, screening method and application thereof | |
| JP6451632B2 (en) | Method and kit for measuring modified nucleobases using heterologous nucleic acid probes | |
| Wang et al. | Identification of a novel molecular probe for recognition of human osteosarcoma cell using the cell-SELEX method | |
| KR101513766B1 (en) | DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use | |
| JP6451634B2 (en) | Method for measuring modified nucleobase using absorbent polynucleotide and kit thereof | |
| KR102539423B1 (en) | Non-invasive diagnosis and analysis of colorectal cancer using RNA isolated from exosomes | |
| Kaur et al. | Single-Cell Genomics: Technology and Applications | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN113699157B (en) | PD-L1 aptamer, and screening method and application thereof | |
| CN114317544A (en) | Aptamer specifically binding to CD133, and screening method and application thereof | |
| CN112877333A (en) | Aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof | |
| CN113564172A (en) | Liquid biopsy tumor cell DNA aptamer | |
| CN114574498B (en) | Nucleic acid aptamer for targeting tumor-associated fibroblasts and application thereof | |
| CN111363749A (en) | Aptamer for detecting Chinese softshell turtle iridovirus and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |