CN111344418A - Kit for amplifying TCR full-length sequence and application thereof - Google Patents
Kit for amplifying TCR full-length sequence and application thereof Download PDFInfo
- Publication number
- CN111344418A CN111344418A CN201780095486.3A CN201780095486A CN111344418A CN 111344418 A CN111344418 A CN 111344418A CN 201780095486 A CN201780095486 A CN 201780095486A CN 111344418 A CN111344418 A CN 111344418A
- Authority
- CN
- China
- Prior art keywords
- tcr
- primer
- sequence
- sequencing
- cycles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
The invention provides a kit for amplifying a TCR full-length sequence and application thereof, wherein the kit comprises a nanoliter microporous chip, and the kit can perform TCR α/β paired amplification of 5124 single T cells at most at one time by adopting the nanoliter microporous chip as a reaction container.
Description
The invention belongs to the field of molecular biology, and relates to a kit for amplifying a TCR full-length sequence and application thereof, in particular to a kit for amplifying a TCR full-length sequence, a method for amplifying the TCR full-length sequence and application thereof.
T cell types are complex and diverse and are associated with TCR rearrangement, and in the thymus, TRB (TCR β) genes undergo D-J, V-D-J, V-D-J-C region rearrangement, ultimately producing about 108The TRA (TCR α) gene undergoes V-J, V-J-C region rearrangement to finally yield about 104Different TRA rearranged genes. In human peripheral blood, TCR diversity is up to 10 due to TRB, TRA rearrangement18It is decided how the human immune system adapts to environmental changes.
At present, one of the main identification methods of TCR is to sequence α and β chains, in the traditional immunology research, the characteristic analysis of cell heterogeneity and different cell subsets is difficult to realize based on data obtained by sequencing of population cells, the traditional TCR amplification method comprises the steps of 1. multiplex PCR amplification matched with high-throughput sequencing technology, amplification of TCR gene sequences in a population by designing primers covering all TRA and TRB typing multiple primers, capturing the TRA and TRB subtypes as complete as possible in the population, reading the TRA and TRB sequences of each subtype through high-throughput sequencing, 2.RACE amplification matched with high-throughput sequencing technology, designing primers through constant known sequences in TCR sequences, amplifying the TCR gene sequences in the population, reading the TRB sequences and the TRA of each subtype through high-throughput sequencing technology, 3.T cell population transcription group sequencing, biological information assembly TCR technology and the like, the T cell subsets and TCR α/β pairing relationship cannot be accurately distinguished through the TCR sequencing, and further understanding of T cell immunoreaction mechanism, the TCR subsets and the phenotypic differences recognized internally and mutually more accurately in different T cell subsets, thus the TCR α is more and more widely applied to the single cell immunological research.
The TCR receptor is a heterodimer formed by TCR α and TCR β chains, and because TCR genes undergo DNA sequence rearrangement during T cell formation, T cell diversity is generated, which plays a great role in effective immunity.
(1) PairSEQ high throughput TCR sequencing technology, which adopts T cell diversity characteristics, T cell corresponding TCR sequences are different among different subgroups, and the number of subgroups in a sample, the number of T cells in subgroups and corresponding TCR α/β pairing have relevance, the strategy of the technology is to perform mRNA separation and first chain cDNA amplification on cells in each well by random obvious subgroups of T cells in a 96-well plate, then to add TCR V region and C region primers, to amplify the region of TCR CDR3, to connect sample specific barcode on the amplification primers, so that specific DNA barcode is combined with the amplification products during amplification, each sample can be accurately calibrated, high throughput sequencing is performed after posing amplification products of all samples in the 96-well plate, high throughput sequencing can be performed by simultaneously reading TCR sequence information and DNA barcode information, the source of TCR corresponding to each well can be determined by DNA barcode information, TCR pairing information in T cell subgroups in each well needs to be analyzed by constructing model of TCR α/β, and calculating CDR 3875/38964 by calculating model pairing information of single cells.
The technology is characterized in that amplification and analysis of the high-throughput single-cell TCR pairing sequence can be preliminarily realized, but the technology has obvious defects, the early-stage sample processing flow is complex, T cells are required to be grouped firstly, laid on a 96-well plate and combined with random DNA barcode for sequencing, TCR α/β pairing information of different T cell subtypes is trained in a data simulation mode, accuracy of subsequent α/β pairing of TRA and TRB assembled by sequencing is greatly limited.
(2) The technology is characterized in that a full-length TCR α/β pairing sequence is reconstructed by T cell single-cell transcriptome data, TCR transcriptome information in a single cell is captured by a computer, functional T cell clones are distinguished according to TCR sequence differences, and the single-cell transcriptome data can reveal transcriptional heterogeneity among cells and evolution progress among different cells so as to calculate an obvious T cell subset.
(3) The technology is a technology for acquiring TCR sequence information of 10000 Single immune cells at one time based on a droplet microfluidic technology, which is introduced by 10Xgenomics company, 4.4.2017.however, the technology for acquiring high-flux TCR sequences based on the droplet microfluidic technology is a good entry point, but the pairing of the TCR α/β at the Single cell level is realized based on the droplet microfluidic method, but the defects of cross contamination between double-wrapped Single cells of droplets, low wrapping efficiency, high cost and the like exist.
The prior TCR amplification technology mostly stays at the scale of a 96-well plate, and a mature high-throughput single cell amplification method is not available, on one hand, the heterogeneity of T cells and the detailed analysis of different cell subsets are difficult to realize due to low flux, the pairing information of TCR α/β cannot be known, and meanwhile, a proper method for TCR full-length sequence amplification is not available, so that the application of the TCR full-length sequence amplification is limited to a certain extent.
CN 105543064 a discloses a digital PCR chip and its using method: the chip comprises a siliceous microporous chip, a microfluidic channel for filling a sample and an aluminum heat conduction base, wherein 20,000 through holes with hydrophilic inner walls and hydrophobic surfaces are processed on the siliceous microporous chip and are used for dispersing trace nucleic acid or cell solution, but the chip is not suitable for high-throughput TCR amplification.
However, there is no ideal technology to achieve full-length amplification of the TCR α/β pairing sequence at the single cell level, with coverage of all known TRA, TRB subtypes.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a kit for amplifying a TCR full-length sequence and application thereof, wherein the kit can realize the full-length amplification of a TCR α/β pairing sequence at a single cell level and can cover all known TRA and TRB subtypes.
In one aspect, the invention provides a kit for amplifying a full-length sequence of a TCR, the kit comprising a nanoliter-scale microwell chip.
The invention adopts nano-liter grade microporous chip as a reaction container, can carry out TCR α/β pairing amplification of 5124 single T cells at most at one time, can improve flux, can efficiently obtain TCR αβ chain pairing full-length sequences at thousands of single T cell layers at one time, and constructs a TCR immune group library.
In the invention, the nano-grade microporous chip is a microporous chip with a volume of nano-liter level, the number of micropores on the nano-liter level microporous chip does not influence the invention, and a person skilled in the art can select the nano-grade microporous chip according to needs without special limitation.
According to the invention, the kit further comprises a primer pair for amplifying the full-length sequence of the TCR.
According to the invention, the primer pair for amplifying the full-length sequence of the TCR comprises an upstream primer and a downstream primer, wherein the upstream primer is a complementary sequence designed according to a sequencing joint sequence, and the downstream primer is a complementary sequence designed according to a C region of the TCR.
In the invention, although the TCR has variety and better C region sequence homology, the downstream primer is designed according to the C region, and can be designed from the 5 ' end to the 3 ' end of the C region, and a sequencing linker sequence (TSO) is added at the 3 ' end of the TCR, and an upstream primer is designed according to the upstream primer and the downstream primer, so that a complete V (D) J sequence can be obtained through the upstream primer and the downstream primer, and the full length of the TCR is obtained.
In the present invention, the designed primer follows the general primer design principle, such as GC content 40-60%, no secondary hairpin structure, no primer dimer, etc., and the primer design should be designed as far as possible at the position without base polymorphism.
According to the invention, the sequencing joint sequence is introduced by a template switching method, wherein the joint primer can be a sequence with a fixed length, and the joint primer can be designed by a person skilled in the art according to requirements, the nucleotide sequence of the joint primer is shown as SEQ ID NO.1, and the nucleotide sequence shown as SEQ ID NO.1 is as follows: 5'-AAGCAGTGGTATCAACGCAGAGT-3', respectively;
according to the present invention, the sequencing linker sequence has a length of 18-35nt, such as 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt or 28nt, preferably 28 nt.
According to the invention, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence shown as SEQ ID NO.2 is as follows: 5'-AAGCAGTGGTATCAACGCAGAGT-3' are provided.
According to the invention, the downstream primer is a nested primer, and the inventor finds that the nested primer not only can be used for a sample with a small initial amount in the single cell of the application, but also has a very accurate result after amplification for a TCR mechanism with such a complex structure, and the downstream primer comprises an outer primer and/or an inner primer.
According to the invention, the TCR full length consists of TCR α gene full length and TCR β gene full length or TCR gamma gene full length and TCR delta gene full length;
according to the invention, the nucleotide sequences of the external primer and the internal primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequences of the primers are as follows:
outer primer (SEQ ID NO. 3): GCAGACAGACTTGTCACTGG, respectively;
inner primer (SEQ ID NO. 4): GGTACACGGCAGGGTCAGGGTTC, respectively;
according to the invention, the nucleotide sequences of the external primer and the internal primer of the downstream primer for amplifying the full length of the TCR β gene are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6;
the nucleotide sequence of the primer is as follows:
outer primer (SEQ ID NO. 5): TGGTCGGGGAAGAAGCCTGTG, respectively;
inner primer (SEQ ID NO. 6): TTCTGATGGCTCAAACACAGCGA, respectively;
in a second aspect, the invention provides a method of amplifying the full length sequence of a TCR, using a kit as described in the first aspect.
According to the invention, the method for amplifying the full-length sequence of the TCR comprises the following steps:
(1) performing reverse transcription of mRNA in the nano-scale micro-pore chip to obtain first chain cDNA;
(2) performing PCR amplification by using the first strand cDNA obtained in the step (1) as a template;
(3) and (5) sequencing and verifying to obtain the TCR full-length amplification product.
According to the invention, the method also comprises a single cell separation and lysis step before the step (1), wherein the single cell separation adopts a flow cytometer to sort single cells, and adopts a sample micro-aliquotter to divide the sorted single cells into the micropores of each micropore chip, and the single cells are derived from peripheral blood mononuclear cells of peripheral blood.
In the invention, the problems of TCR full-length sequencing and TCR α/β pairing can be thoroughly solved from a high-throughput single-cell layer, the paired αβ sequence information can be distinguished, and different single-cell samples can be distinguished, so that the single-tube TCR pairing full-length amplification technology is effectively applied to a high-throughput platform, and high throughput is realized.
According to the invention, the mRNA reverse transcription system in the step (1) comprises a sequencing linker sequence, and after the mRNA reverse transcription system is prepared, the system is subpackaged into the micropores of each micropore chip by adopting a sample micro-liquid separation instrument.
According to the invention, the sequencing linker sequence has a final concentration of 0.8-3. mu.M, which may be, for example, 0.8. mu.M, 0.9. mu.M, 1. mu.M, 1.2. mu.M, 1.3. mu.M, 1.5. mu.M, 1.6. mu.M, 1.8. mu.M, 2. mu.M, 2.2. mu.M, 2.4. mu.M, 2.5. mu.M, 2.6. mu.M, 2.8. mu.M or 3. mu.M, preferably 2. mu.M;
according to the invention, the reverse transcription conditions of mRNA described in step (1) are: circulating at 38-45 deg.C for 85-95min 1-3; 1-5min at 48-53 deg.C, 1-5min at 38-45 deg.C, and 8-15 circulation; circulating at 68-73 deg.C for 10-20min for 1-3 cycles; storing at 4 ℃;
according to the invention, the reverse transcription conditions of mRNA described in step (1) are: circulating at 42 ℃ for 90min 1; 2min at 50 ℃ and 2min at 42 ℃ for 10 cycles; circulating at 70 deg.C for 15min 1; stored at 4 ℃.
According to the invention, when the downstream primer is a nested primer, the PCR amplification is nested PCR;
according to the invention, the number of nested PCRs is 1-3, preferably 2;
according to the invention, the nested PCR specifically comprises:
(1') carrying out a first round of nested PCR by taking the upstream primer and the external primer as primers and taking first strand cDNA as a template to obtain a first round of amplification products;
(2 ') carrying out second round nested PCR by taking the upstream primer and the inner primer as primers and the first round amplification product obtained in the step (1') as a template to obtain a second round amplification product;
according to the present invention, the first round of nested PCR conditions in step (1') are: 1-6min at 92-98 ℃, and 1-3 cycles; 15-25s at 95-100 ℃, 10-20s at 53-58 ℃, 35-45s at 70-75 ℃ and 35-45 cycles; 3-8min at 70-75 ℃, and 1-3 cycles; storing at 4 ℃;
according to the present invention, the first round of nested PCR conditions in step (1') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃, 40s at 72 ℃ and 40 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;
according to the present invention, the first round of nested PCR conditions in step (2') are: 1-6min at 92-98 ℃, and 1-3 cycles; 15-25s at 95-100 ℃, 10-20s at 53-58 ℃, 35-45s at 70-75 ℃ and 35-45 cycles; 3-8min at 70-75 ℃, and 1-3 cycles; storing at 4 ℃;
according to the present invention, the first round of nested PCR conditions in step (2') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃, 40s at 72 ℃ and 40 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;
according to the invention, the sequencing in step (3) is sanger sequencing and/or Miseq sequencing.
In a third aspect, the invention provides the use of a kit as described in the first aspect for the pooling of TCRs.
In a fourth aspect, the present invention provides the use of a kit as described in the first aspect for the manufacture of a medicament for the immunological diagnostic treatment and/or prognostic monitoring of a disease.
Compared with the prior art, the invention has the following beneficial effects:
(1) according to the invention, the nanoliter microporous chip is used as a reaction container, and the TCR α/β pairing amplification of 5124 single T cells can be carried out at most once, so that the flux can be improved, TCR αβ chain pairing full-length sequences of thousands of single T cell layers can be efficiently obtained at one time, a TCR immune group library is constructed, meanwhile, the reagent cost of each cell is reduced by about 70%, and the labor cost is greatly reduced;
(2) the method can simultaneously obtain the TCR αβ VDJ region sequences of thousands of cell samples with initial amounts of picogram (1-100pg) and nanogram, has simple operation and short time consumption, can complete the whole process within 10-12h, has complete subtype coverage and low amplification preference;
(3) the method is suitable for high-flux cell heterogeneity and T cell subtype grouping, explores a new immunological mechanism, constructs a large-scale full-length TCR immune repertoire, facilitates disease diagnosis and health management, develops neo TCR-T tumor immune cell therapy by combining a new tumor antigen, performs tumor immunotherapy, cancer or autoimmune disease prognosis monitoring, and is beneficial to guiding medicine application and scientific research of doctors and the like.
FIG. 1 is a flow chart of the full-length sequence amplification technique of the microporous high-throughput single-cell TCR αβ;
FIG. 2(a) is a graph showing the results of the variation of the qPCR amplification real-time monitoring curve of the product at line 7 and column 45 of the microwell chip with the cycle number, and FIG. 2(b) is a graph showing the results of the variation of the qPCR amplification real-time monitoring curve of the product at line 7 and column 45 of the microwell chip with the temperature;
FIG. 3 shows the result of detecting the micro-well amplification product 2100 of the chip by using a microstep apparatus;
FIG. 4 shows electrophoresis results of high throughput T cell TCR amplification products of the microporous chip, wherein 1-11 shows electrophoresis detection results of single cell amplification products in different chip wells, and the marker is 100bp marker, 100bp, 200bp, 300bp, 400bp, 500bp (brightest band), 600bp, 700bp, 800bp, 900bp, 1000bp and 1500bp from bottom to top.
The present invention will be described in further detail with reference to the accompanying drawings and examples. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention. It should be further noted that, for the convenience of description, only some of the structures related to the present invention are shown in the drawings, not all of the structures.
EXAMPLE 1 kit Assembly
(1) Designing a primer: introducing a sequencing joint sequence into the 3' end of a first cDNA chain by a template conversion method by utilizing the sequencing joint sequence, wherein the sequencing joint sequence is shown as SEQ ID NO.1, and the nucleotide sequence shown as SEQ ID NO.1 is as follows:
designing an upstream primer according to an adaptor sequence, wherein the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence shown as SEQ ID NO.2 is as follows:
the downstream primer is designed according to the C region of the TCR gene, and the complete sequences of the C regions of the α and β chains of the T cells are as follows:
TCR α C region (SEQ ID NO. 7):
TCR β C region (SEQ ID NO. 8):
a Miseq sequencing platform is adopted, and primers of the Miseq sequencing platform are as follows:
because the longest read length of Miseq at present is 300bp/reads, a PE300 sequencing strategy is adopted, the length of a library Insert is required to be not more than 600bp, and a sequence of UTR (untranslated regions) at the 5 'end of a TCR αβ chain + V + D + J is well within 600bp, so that a downstream primer is arranged at a position which is 20-30 bp close to the 5' end of a C region, as shown in the following:
TABLE 1 sequence information of human T cell C region primers (downstream)
(2) And assembling the designed primer and the micropore chip of the wafer Gen and then filling the assembled primer and the micropore chip into a kit.
Example 2 sequencing of TCR on Miseq sequencing platform
The method for amplifying the full-length sequence of the TCR is shown in a flow chart in figure 1 and comprises the following steps:
(1) first strand cDNA synthesis:
a) preparing a lysate, wherein the formula of the lysate is shown in the following table:
the prepared lysate is blown, uniformly mixed, subpackaged into a clean 384-hole plate, subpackaged into 24 holes with 14 mu L of each hole, after membrane sealing, 2600rcf is carried out, the centrifugation is carried out for 1min at 4 ℃ (liquid drops are centrifuged to the bottom of a tube and bubbles are removed), the 384-hole plate is placed on an MSND sample micro-separator, a 35nL72 sample liquid spraying mode is selected, 35nL of each micropore liquid spraying is carried out on a chip, after membrane sealing, 2600rcf is carried out, the centrifugation is carried out for 5min at 4 ℃, the chip is placed at 4 ℃ for storage, and cells are waited to be added;
b) single cell isolation
Cell buffers were prepared according to the following table:
preparing the cell buffer solution in a 0.2mL nuclease-free PCR tube, blowing, uniformly mixing, sorting 5800-mesh single cells into the buffer solution by using a FACS (flow cytometry), gently blowing, uniformly mixing, subpackaging into a clean 384-pore plate, subpackaging for 24 pores, wherein each pore is 14 mu L, sealing membranes, placing the 384-pore plate on an MSND sample micro-liquid separator, selecting a 35nL72 sample liquid spraying mode, spraying 35nL of each micropore on a chip, sealing membranes, carrying out 2600rcf, centrifuging at 4 ℃ for 5min, and distributing cells in nano-liter-grade micropores of the chip according to a Poisson distribution rule;
c) cell lysis
Placing the chip in a special PCR instrument for Biorad chip, incubating at 72 ℃ for 5min, and immediately placing on ice for 1min after the thermal cover temperature is 75 ℃ and the cracking is finished; centrifuging at 2600rcf 4 ℃ for 5min, and immediately transferring to ice; after this step, all mRNAs were released from the single cell and Oligo-dT primers had also bound to the mRNAs;
d) reverse transcription of mRNA
The reverse transcription system is prepared as follows:
preparing the reverse transcription buffer solution in a 1.5mL nuclease-free PCR tube, blowing, uniformly mixing, subpackaging into a clean 384-hole plate, subpackaging for 24 holes, wherein each hole is 14 mu L, sealing a membrane, 2600rcf, centrifuging at 4 ℃ for 1min (centrifuging a liquid drop to the bottom of the tube and removing bubbles), placing the 384-hole plate on an MSND sample micro liquid separator, selecting a 35nL72 sample liquid spraying mode, spraying 35nL of each micropore liquid on a chip, sealing the membrane, 2600rcf, and centrifuging at 4 ℃ for 5 min;
the chip was placed in a PCR instrument dedicated to Biorad chips and reverse transcription reaction was carried out (75 ℃ hot lid) under the following conditions:
after the first strand cDNA of all mRNAs is synthesized and reverse transcription is finished, carrying out centrifugation at 2600rcf for 5min at 4 ℃;
(2) specific TCR sequence amplification, using primers in example 1:
a) first round PCR
Taking the upstream primer and the external primer as primers and taking the first strand cDNA as a template to perform a first round of nested PCR to obtain a first round of amplification product;
the PCR system was prepared as follows:
the cell buffer solution is prepared in a 1.5mL PCR tube, is evenly blown and distributed into a clean 384-hole plate, is distributed into 24 holes with 14 mu L per hole, and is sealed. Placing a 384-hole plate on an MSND sample micro liquid separator, selecting a 35nL72 sample liquid spraying mode, spraying 35nL of each micropore liquid on a chip, sealing a membrane, and centrifuging at 4 ℃ for 5min at 2600 rcf;
on a chip PCR instrument special for BIORAD, the following conditions are adopted for pre-amplification:
b) second round PCR
Performing a second round of nested PCR by taking the upstream primer and the intermediate primer as primers and the first round of amplification product obtained in the step (a) as a template to obtain a second round of amplification product;
and (3) sucking the amplification product in the micropore of the chip into a 96-well plate by using a microstep instrument, and preparing a PCR system according to the following table:
blowing, beating, mixing uniformly, centrifuging instantaneously, and pre-amplifying according to the following conditions:
(3) electrophoretic detection
After the nested PCR is finished, 1 mu l of the probe is taken for agilent 2100 detection, the detection result is shown in FIGS. 2(a), 2(b) and 3, and as can be seen from FIGS. 2(a) -2(b), the amplification product is obviously increased at the 26 th cycle of the PCR, and the melting curve of the lower left graph shows a single peak, which indicates that the amplification product is relatively single; as can be seen from FIG. 3, the detection of fragment distribution by agilent 2100 shows that there are indeed only a few relatively specific peaks in the pore, and the size of the peaks corresponds to the size of the target fragment;
and carrying out PCR electrophoresis detection on the rest samples, adopting 2% agarose gel, taking 25 mu L of products, adding 3 mu L of loading buffer solution, mixing uniformly, and carrying out electrophoresis at 130V for 45 min. The target band is cut and recovered, the result is shown in figure 4, and the result is further amplified by using the microporous chip hole amplification product (the 5 th sample) and the TCR-internal primer, so that the product has better specificity which is about 600bp and is consistent with the expected product, and the good result of TCR amplification in the microporous chip hole is proved again.
(4) The recovered product was subjected to TA cloning and Sanger sequencing, which resulted in the following:
α Strand sequence
α1：V12-2+J45+C
β chain sequence (V27+ J2)
The results are collated as shown in Table 3 below:
TABLE 3
As can be seen from table 3, α and B types of the samples are:
α V12-2 and J45
β：V9J1-6。
Therefore, by adopting a Sanger sequencing platform, the sequence of the TCR αβ VDJ region can be directly obtained by sequencing, and TCR α/β pairing can be realized.
In summary, the invention uses nano-liter micro-porous chip as reaction container, which can perform TCR α/β pairing amplification of 5124 single T cells at most once, can improve flux, and can efficiently obtain TCR αβ chain pairing full-length sequence of thousands of single T cell layers at one time to construct TCR immune repertoire.
The foregoing is considered as illustrative of the preferred embodiments of the invention and the technical principles employed. It will be understood by those skilled in the art that the present invention is not limited to the particular embodiments described herein, but is capable of various obvious changes, rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention. Therefore, although the present invention has been described in greater detail by the above embodiments, the present invention is not limited to the above embodiments, and may include other equivalent embodiments without departing from the spirit of the present invention, and the scope of the present invention is determined by the scope of the appended claims.
Claims (14)
- A kit for amplifying a TCR full-length sequence comprising a nanoliter-scale microwell chip and a primer pair for amplifying a TCR full-length sequence.
- The kit of claim 1, wherein the primer pair for amplifying the full length TCR sequence comprises an upstream primer and a downstream primer, wherein the upstream primer is a complementary sequence designed from a sequencing linker sequence and the downstream primer is a complementary sequence designed from a C region of the TCR.
- The kit of claim 2, wherein the sequencing adaptor sequence is introduced by template switching.
- The kit according to claim 2, wherein the sequencing linker sequence has a length of 18-35nt, preferably 28 nt;preferably, the nucleotide sequence of the sequencing linker sequence is shown as SEQ ID NO. 1;preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;preferably, the downstream primer is a nested primer;preferably, the downstream primer comprises an outer primer and/or an inner primer.
- The kit of any one of claims 1 to 4, wherein the TCR full length consists of the TCR α gene full length and the TCR β gene full length or the TCR γ gene full length and the TCR δ gene full length;preferably, the nucleotide sequences of the outer primer and the inner primer of the downstream primer for amplifying the full length of the TCR α gene are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4;preferably, the nucleotide sequences of the outer primer and the inner primer of the downstream primer for amplifying the full length of the TCR β gene are shown as SEQ ID No.5 and SEQ ID No.6, respectively.
- A method of amplifying the full length sequence of a TCR which utilises a kit as claimed in any one of claims 1 to 5.
- The method of claim 6, comprising the steps of:(1) performing reverse transcription of mRNA in the nano-scale micro-pore chip to obtain first chain cDNA;(2) performing PCR amplification by using the first strand cDNA obtained in the step (1) as a template;(3) and (5) sequencing and verifying to obtain the TCR full-length amplification product.
- The method of claim 7, wherein the system for reverse transcription of mRNA in step (1) comprises a sequencing linker sequence.
- The method according to claim 8, wherein the final concentration of the sequencing adapter sequence is 0.8-3 μ M, preferably 2 μ M.
- The method of claim 7, wherein the reverse transcription of mRNA in step (1) is performed under the following conditions: circulating at 38-45 deg.C for 85-95min for 1-3 cycles; 1-5min at 48-53 deg.C, 1-5min at 38-45 deg.C, and 8-15 circulation; circulating at 68-73 deg.C for 10-20min for 1-3 cycles; storing at 4 ℃;preferably, the reverse transcription of mRNA in step (1) is performed under the following conditions: circulating at 42 ℃ for 90min 1; 2min at 50 ℃ and 2min at 42 ℃ for 10 cycles; circulating at 70 deg.C for 15min 1; stored at 4 ℃.
- The method according to any one of claims 6 to 10, wherein the downstream primer is a nested primer and the PCR amplification is nested PCR;preferably, the number of nested PCR is 1-3, preferably 2;preferably, the nested PCR specifically comprises:(1') performing a first round of nested PCR (polymerase chain reaction) by using the upstream primer and the external primer as primers and using first strand cDNA as a template to obtain a first round of amplification products;(2 ') performing nested second-round PCR (polymerase chain reaction) by using the upstream primer and the inner primer as primers and using the first-round amplification product obtained in the step (1') as a template to obtain a second-round amplification product;preferably, the first nested PCR conditions of step (1') are: 1-6min at 92-98 ℃, and 1-3 cycles; 15-25s at 95-100 ℃, 10-20s at 53-58 ℃, 35-45s at 70-75 ℃ and 35-45 cycles; 3-8min at 70-75 ℃, and 1-3 cycles; storing at 4 ℃;preferably, the first nested PCR conditions of step (1') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃, 40s at 72 ℃ and 40 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;preferably, the first nested PCR conditions of step (2') are: 1-6min at 92-98 ℃, and 1-3 cycles; 15-25s at 95-100 ℃, 10-20s at 53-58 ℃, 35-45s at 70-75 ℃ and 35-45 cycles; 3-8min at 70-75 ℃, and 1-3 cycles; storing at 4 ℃;preferably, the first nested PCR conditions of step (2') are: 3min at 95 ℃ and 1 cycle; 20s at 98 ℃, 15s at 55 ℃, 40s at 72 ℃ and 40 cycles; 5min at 72 ℃ and 1 cycle; storing at 4 ℃;preferably, the sequencing in step (3) is sanger sequencing and/or Miseq sequencing.
- The method according to any one of claims 7 to 11, further comprising a step of single cell isolation and lysis prior to step (1);preferably, the single cells are derived from peripheral blood mononuclear cells of peripheral blood.
- Use of a kit according to any one of claims 1 to 5 for the pooling of TCRs.
- Use of a kit according to any one of claims 1 to 5 for the preparation of a medicament for the immunological diagnostic treatment and/or prognostic monitoring of a disease.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2017/104109 WO2019061198A1 (en) | 2017-09-28 | 2017-09-28 | Kit for amplifying tcr full-length sequence and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111344418A true CN111344418A (en) | 2020-06-26 |
Family
ID=65900270
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201780095486.3A Pending CN111344418A (en) | 2017-09-28 | 2017-09-28 | Kit for amplifying TCR full-length sequence and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN111344418A (en) |
| WO (1) | WO2019061198A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102066578A (en) * | 2008-04-16 | 2011-05-18 | 哈森阿尔法生物技术研究院 | Method for evaluating and comparing immunorepertoires |
| WO2017084023A1 (en) * | 2015-11-17 | 2017-05-26 | 深圳华大基因研究院 | Library creating method for single-cell transcriptome profile having high throughput |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI333977B (en) * | 2003-09-18 | 2010-12-01 | Symphogen As | Method for linking sequences of interest |
| CN103627808A (en) * | 2013-12-10 | 2014-03-12 | 江南大学 | T-hairpin structure-mediated method for measuring unknown sequence of DNA flank |
| WO2016015349A1 (en) * | 2014-08-01 | 2016-02-04 | 深圳华大基因科技有限公司 | Method for determining whether nucleic acids in vessel are derived from single cell and apparatus and use thereof |
| CN105506746A (en) * | 2014-09-22 | 2016-04-20 | 深圳华大基因科技有限公司 | Method for constructing variable region sequencing library, and method for determining variable region nucleic acid sequence |
-
2017
- 2017-09-28 WO PCT/CN2017/104109 patent/WO2019061198A1/en active Application Filing
- 2017-09-28 CN CN201780095486.3A patent/CN111344418A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102066578A (en) * | 2008-04-16 | 2011-05-18 | 哈森阿尔法生物技术研究院 | Method for evaluating and comparing immunorepertoires |
| WO2017084023A1 (en) * | 2015-11-17 | 2017-05-26 | 深圳华大基因研究院 | Library creating method for single-cell transcriptome profile having high throughput |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019061198A1 (en) | 2019-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11591652B2 (en) | System and methods for massively parallel analysis of nucleic acids in single cells | |
| EP2895626B1 (en) | Accurate genome sequencing of single cells by single-stranded amplification and sequencing | |
| CN110050067A (en) | Generate the method for the double stranded DNA through expanding and composition and kit for the method | |
| JP2021094038A (en) | Isothermal methods for preparing nucleic acids and related compositions | |
| JP2013529472A (en) | Application of PCR sequencing method based on DNA molecular tag technology and DNA incomplete fragmentation technology in HLA genotyping | |
| WO2013192570A1 (en) | System and methods for genetic analysis of mixed cell populations | |
| CN107400705A (en) | A kind of high-throughout unicellular whole genome amplification method | |
| CN106755410A (en) | A kind of method for detecting T cell and B cell immune group storehouse simultaneously based on high-flux sequence | |
| CN108060237B (en) | Forensic medicine composite detection kit based on 55Y chromosome SNP genetic markers | |
| KR20190116989A (en) | PCR primer set for HLA gene, and sequence analysis method using the same | |
| WO2016165591A1 (en) | Mgmt gene promoter methylation detection based on pyrosequencing technology | |
| CN112592981B (en) | Primer group, kit and method for DNA archive construction | |
| CN111344418A (en) | Kit for amplifying TCR full-length sequence and application thereof | |
| CN108517364B (en) | Forensic medicine composite detection kit based on 56Y chromosome SNP genetic markers | |
| CN107058484A (en) | It is a kind of to detect T cell and the primer combination in B cell immune group storehouse and kit simultaneously applied to high-flux sequence | |
| CN111164210A (en) | PCR primer for amplifying TCR full-length sequence and application thereof | |
| US20220259670A1 (en) | Kit and method for analyzing single t cells | |
| CN202671540U (en) | SNP (single nucleotide polymorphism) typing reagent kit for BMP (bone morphogenetic protein) 15 genes related to egg laying character of chicken | |
| CN111148836A (en) | PCR primer for detection and application thereof | |
| CN110438209A (en) | The detection method in vitamin D metabolism associated gene mutation site | |
| Pasetto et al. | T-Cell Repertoire Characterization | |
| CN116635535A (en) | Simultaneous amplification of single cell DNA and RNA | |
| CN117737219A (en) | Internal reference gene for detecting miRNA of plasma exosome | |
| CN117305430A (en) | Composition, kit and method for identifying CD45 mouse genotype | |
| CN114525345A (en) | SSR molecular marker of castor silkworm and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |