CN202671540U - SNP (single nucleotide polymorphism) typing reagent kit for BMP (bone morphogenetic protein) 15 genes related to egg laying character of chicken - Google Patents

Abstract

The utility model disclosers an SNP (single nucleotide polymorphism) typing reagent kit for BMP (bone morphogenetic protein) 15 genes related to the egg laying character of chicken, and belongs to the field of biotechnology. The SNP typing reagent kit is characterized by comprising a kit body, a liner in the kit body, a primer mixture P, a DNA (deoxyribonucleic acid) Tag enzyme, polymerase chain reaction buffer liquid, dNTP (deoxyribonucleoside triphosphate), Buffer and an incision enzyme, and the primer mixture P, the DNA Tag enzyme, the polymerase chain reaction buffer liquid, the dNTP, the Buffer and the incision enzyme are respectively placed in various cavities of the liner. The SNP typing reagent kit has the advantages that by the design of specific primers and PCR (polymerase chain reaction) and RFLP (restricted fragment length polymorphisms) methods, a product is high in specificity, and SNP typing accuracy is guaranteed. The SNP typing reagent kit is reasonable in design, convenient to use and low in cost, and a result is reliable.

Description

Chicken egg-laying deseription genes involved-BMP15 gene SNP parting kit

Technical field

The utility model belongs to biological technical field, utilizes the PCR-RFLP technology for detection that a kind of chicken egg-laying deseription genes involved-Delicious peptide 15(BMP15 is provided) test kit of SNP somatotype.

Background technology

Delicious peptide 15(bone morphogenetic protein 15, BMP15) be one of the member of β-transforming growth factor (TGF-β) superfamily, be a kind of in ovary preferential ovocyte derivative factor (Ostuka at el 2001) of expressing, many links of the female reproduction processes such as the selection of follicular development, high-quality ovarian follicle and ovulation are all played keying action (Patricia at el 2000; Shimasaki at el 2004).Studies show that, the BMP15 gene is preferentially expressed in the ovary of chicken, and the truck of energy initiating signal transduced element, induce progesterone to generate to gonad-stimulating hormone and have strong restraining effect (Elis at el 2007), illustrate that the egg laying performance of BMP15 gene pairs chicken plays important regulating and controlling effect.

Single nucleotide polymorphism (single nucleotide polymorphism, SNP), obtained develop rapidly as third generation genetic marker, at present multiple full-fledged detection technique has been arranged, such as technique means such as single strand conformation polymorphism (SSCP), Restriction fragment length polymorphism (RFLP), DNA chip and Taqman probes.Restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology is utilized the pcr amplification target DNA exactly, and amplified production cuts into different big or small fragments, directly somatotype in gel electrophoresis with the digestion of specificity restriction endonuclease again.This technology has the specificity height, detects fast, highly versatile, the characteristics such as applied widely, with low cost, and the SNP that has been successfully applied to human diseases and poultry diease genes involved molecule marker at present detects and the research and development of gene diagnosis kit.

Through the retrieval to existing domestic and foreign literature and patent, so far there are no the report of BMP15 gene polymorphism sites and chicken egg-laying deseription dependency.

The utility model content

The purpose of this utility model is to provide a kind of accuracy high, quick, cheap gene type test kit for the detection to chicken egg-laying deseription genes involved-BMP15 gene C 397T.

The purpose of this utility model is achieved through the following technical solutions, chicken egg-laying deseription genes involved-BMP15 gene SNP parting kit, it is characterized in that described test kit is by box body, liner in the box body, the primer mixture P that inserts respectively in each vestibule of liner, DNA Tag enzyme, amplification buffer, dNTP, Buffer and restriction endonuclease form.

Wherein primer mixture P details are as follows:

Primer mixture P represents that primer information is as follows for the upstream and downstream primer mixture of BMP15 gene PCR amplification:

Upstream primer: 5'GGGTTTTAGCCCTGATCTTGCACTC 3'

Downstream primer: 5'ATCACCCATTGCCACCACCTTACCT 3'.

This test kit using method:

1, place, pcr amplification SNP site fragment

1) the pcr amplification reaction system is prepared

The reaction system of PCR is 20 μ l, comprising:

Amplification buffer (10 * buffer) 2.5 μ l

2.5mM dNTP 2.0μl

Primer P (5uM) 1 μ l

Template DNA (about 50 ng) 1 μ l

5U/ul Taq 0.5μl

Adding water mends to 20 μ l

In the PCR thin-walled tube of 200 μ l, add reagent according to above reaction system, fully of short duration centrifugal behind the mixing.

2) pcr amplification reaction programming

Arrange as described in Table 1ly at eppendorf PCR instrument, after programming is complete, the PCR reaction tubes is put into the PCR instrument react amplification.

Table 1 pcr amplification reaction program

3) after reaction finishes, get 5 μ l reaction product at 2% agarose gel, electrophoresis among 1 * TBE, whether detection reaction is successful.

2, the RFLP enzyme is cut and the identified gene type

The first step gained PCR product is got 7ul, and adding 2ul10 * buffer(restriction endonuclease is supporting), restriction endonuclease ( The Ear I) 0.5ul, ultrapure water 10.5 μ l, fully of short duration centrifugal behind the mixing, then put into 37 ℃ of water-bath water-baths 10 hours, to get at last the 6ul enzyme and cut product at 3% sepharose, electrophoresis among 1 * TBE is with the video picture of gel imaging analysis system, identified gene type.

The utility model is by the design Auele Specific Primer, and pcr amplification and RFLP method so that product has more specificity, have guaranteed the accuracy of SNP somatotype.The utility model is reasonable in design, easy to use, reliable results and with low cost.

Description of drawings

Fig. 1 is structural representation of the present utility model.

Fig. 2 is BMP15 gene PCR product amplification figure in the utility model.

Fig. 3 is the utility model BMP15 gene PCR product RFLP somatotype.

Among the figure 1, box body; 2, liner; 3, primer mixture P; 4, DNA Tag enzyme; 5, amplification buffer; 6, dNTP; 7, Buffer; 8, restriction endonuclease.

Embodiment

The utility model with specific embodiments and the drawings is described further.Should be understood that these embodiment only are used for illustration purpose, and be not used in restriction scope of the present utility model.

Chicken egg-laying deseription genes involved-BMP15 gene SNP parting kit, by box body, liner in the box body, the primer mixture P that inserts respectively in each vestibule of liner, DNA Tag enzyme, amplification buffer, dNTP, Buffer(restriction endonuclease damping fluid) and the restriction endonuclease composition.

Use this test kit that somatotype is carried out in 260 the maternal hen BMP15 of uncle Shao chicken gene C 397T SNP sites.

1, sample

Gather the blood of the maternal hens of uncle 260 Shaos chicken, use traditional phenol/chloroform method extraction DNA, and with the DNA concentration dilution to 50ng/ μ l.

2, pcr amplification reaction and result

Pcr amplification and detected result are carried out according to the test kit using method:

Place, pcr amplification SNP site fragment

1) the pcr amplification reaction system is prepared

The reaction system of PCR is 20 μ l, comprising:

Amplification buffer (10 * buffer) 2.5 μ l

2.5mM dNTP 2.0μl

Primer P (5uM) 1 μ l

Template DNA (about 50 ng) 1 μ l

5U/ul Taq 0.5μl

Adding water mends to 20 μ l

In the PCR thin-walled tube of 200 μ l, add reagent according to above reaction system, fully of short duration centrifugal behind the mixing.

2) pcr amplification reaction programming

Arrange as described in Table 1ly at eppendorf PCR instrument, after programming is complete, the PCR reaction tubes is put into the PCR instrument react amplification.

Table 1 pcr amplification reaction program

3) after reaction finishes, get 5 μ l reaction product at 2% agarose gel, electrophoresis among 1 * TBE, whether detection reaction is successful.

BMP15 gene PCR product size is 517bp, and is consistent with the result who estimates, as shown in Figure 2.

3, the RFLP of BMP15 gene PCR amplified production identifies

BMP15 PCR product RFLP identifies and carries out according to the test kit using method:

The RFLP enzyme is cut and the identified gene type

Above-mentioned gained PCR product is got 7ul, and adding 2ul10 * buffer(restriction endonuclease is supporting), restriction endonuclease ( The Ear I) 0.5ul, ultrapure water 10.5 μ l, fully of short duration centrifugal behind the mixing, then put into 37 ℃ of water-bath water-baths 10 hours, to get at last the 6ul enzyme and cut product at 3% sepharose, electrophoresis among 1 * TBE is with the video picture of gel imaging analysis system, identified gene type.

The detected result basis for estimation as shown in Figure 3.

Claims (1)

1. chicken egg-laying deseription genes involved-BMP15 gene SNP parting kit, it is characterized in that described test kit is by box body, liner in the box body, the primer mixture P that inserts respectively in each vestibule of liner, DNA Tag enzyme, amplification buffer, dNTP, Buffer and restriction endonuclease form.

Images