CN107779495B

CN107779495B - Construction method and kit of T cell antigen receptor diversity sequencing library

Info

Publication number: CN107779495B
Application number: CN201711051509.9A
Authority: CN
Inventors: 冯林; 张雅静; 郭丽萍; 刘玲玲; 匡满超; 程书钧; 张开泰; 肖汀; 张文
Original assignee: Cancer Hospital and Institute of CAMS and PUMC
Current assignee: Cancer Hospital and Institute of CAMS and PUMC
Priority date: 2017-10-31
Filing date: 2017-10-31
Publication date: 2022-02-22
Anticipated expiration: 2037-10-31
Also published as: CN107779495A

Abstract

The invention relates to a construction method and a kit of a T cell antigen receptor diversity sequencing library. The method utilizes specific primers designed aiming at a human or mouse TRB gene C region consensus sequence to amplify V, D and J regions of a TRB gene expressed by human or mouse T lymphocytes, and synchronously introduces a second-generation sequencing joint sequence into an amplification product to directly sequence the V, D and J regions of the TRB gene.

Description

Construction method and kit of T cell antigen receptor diversity sequencing library

Technical Field

The invention relates to a construction method of a T cell antigen receptor (TCR) sequencing library and a kit for constructing the T cell receptor sequencing library.

Background

Lymphocytes recognize specific antigens through surface antigen recognition receptors, and the specificity for antigen recognition is reflected in the level of cloning, that is, lymphocytes of the same clone have the same antigen receptor and recognize the same epitope. T cell antigen receptors (TCRs) are molecular structures that specifically recognize antigens and bind to antigenic peptide-MHC molecules on the surface of T cells.

The TCR can be divided into two types of TCR alpha/beta and TCR gamma/delta, and peripheral blood T cells are mainly TCR alpha/beta T cells and are main cells for mediating specific cellular immune response of organisms. The diversity of peripheral blood T cell TCRs is determined by the V regions of the alpha and beta chains, each of which has 3 highly variable regions, also known as Complementarity Determining Regions (CDRs), namely CDR1, CDR2, and CDR 3. However, only CDR3 interacts directly with the antigen, has a central role in the recognition of the antigen by the TCR, and the sequence has a high degree of variability, and is considered to be a marker of T cell clone origin. At the gene level, the CDRs 1 and 2 are encoded by only the V gene segments, the CDR3 of V beta is encoded by three gene segments of V-D-J, and the CDR3 of V alpha is encoded by two gene segments of V-J. The diversity of CDR3 is enriched by the multiple gene segment codes which increase the variation of CDR3, and the variation of N region nucleotide insertion and connection during rearrangement process is concentrated in the CDR3 region.

The T cell antigen receptor beta locus (TRB) is the locus that encodes the beta peptide chain in the TCR molecule. The TRB locus in the original state comprises four regions, V (variable region), J (binding region), D (diversity region) and C (constant region). V, J, D contain several alleles (e.g., 39-41 functional alleles of the human V gene) in addition to C (constant region). During T cell development, DNA recombination occurs within the TRB locus, first a D is recombined with a J, then a V is recombined with it, and finally a C segment is joined to the DJV gene by intron subtraction during post-RNA-transcriptional processing modifications. The TRB locus is translated to form a beta peptide chain with extremely high diversity by selecting different V, D, J alleles and random insertion and deletion of basic groups near the recombination site in the recombination process so as to meet the requirement of an organism for recognizing antigens.

Thanks to the development of Next Generation Sequencing (NGS), the simultaneous sequencing of the CDRs 3 of TCRs in whole T cell populations is realized. However, construction of a diversity sequencing library for human TCR in the prior art often requires designing multiple pairs of specific primers for multiple V gene sites, then amplifying the entire TCR library by multiplex PCR, and subsequently adding sequencing adapters to the amplified fragments. In such prior art, first, the design of the primer is very difficult; dozens of pairs of primers are inevitably in mutual competition, and the result is easy to deviate. In addition, after the TRB amplification product is obtained, a sequencing joint needs to be added on the amplification fragment, and a sequencing library is independently constructed, so that the procedure is complicated. Furthermore, the design of multiple primer pairs and the additional addition of sequencing adapters to the amplified fragments is also not economical from a cost control perspective.

Accordingly, there is a need in the art to develop methods and kits for constructing human or mouse T cell antigen receptor (TCR) sequencing libraries that meet the following requirements: low cost, simplified procedure, specificity, and higher sensitivity.

Disclosure of Invention

The invention provides a method and a kit for constructing a sequencing library of a TRB gene V, D and J region by amplifying the V, D and J regions of the TRB gene expressed by human or mouse T lymphocytes by using a specific primer designed aiming at a human or mouse TRB gene C region consensus sequence, synchronously introducing a second-generation sequencing joint sequence into an amplification product and directly sequencing the V, D and J regions of the TRB gene based on a Polymerase Chain Reaction (PCR) technology.

In a first aspect, the present invention provides a method for constructing a sequencing library of human or animal TRB genes V, D and J regions, the method comprising extracting total RNA from a biological sample of a subject, reverse-transcribing the V, D and J regions of the TRB genes based on a template conversion technique to add a consensus sequence and a molecular tag at the 3' end of cDNA, and then performing multiple rounds of nested PCR while adding a sequencing linker sequence to a final product, the downstream primer used in the reverse transcription and nested PCR being a nested TRBC-specific primer designed for the consensus sequence and the molecular tag of the TRB gene C region, the upstream primer being a primer designed based on the consensus sequence and the molecular tag to be introduced into the reverse transcription product in the template conversion technique, and only one downstream primer and one upstream primer being used in an amplification system of the reverse transcription and each round of the nested PCR.

Preferably, the TRB gene is a human TRB gene or a murine TRB gene.

Preferably, the biological sample of the subject is a tumor tissue of a human or a mouse; peripheral blood leukocytes; hydrothorax ascites, joint fluid, cerebrospinal fluid containing lymphocytes; and a tissue organ selected from: spleen, lymph nodes, skin.

In reverse transcription and nested PCR, the previous round of product serves as a template for the next round of PCR, and the TRBC-specific primers used in the next round of PCR are closer to the 5' end of the C region than the TRBC-specific primers used in the previous round of PCR, the subsequent PCR primers except for the first round of PCR all have partial sequencing linker sequences and the upstream and downstream primers all partially overlap with the upstream and downstream primers of the previous round, respectively.

Preferably, the TRBC specific primers used in the last round of PCR are designed as close as possible to the 5' segment of the C region. Thus, the length of the final product can be shortened as much as possible, and the final product can meet the quality standard of the sequencing library under the existing conditions.

Preferably, the partial sequencing adaptor ligated by the upstream primer in a subsequent PCR other than the first round PCR is an illumina partial P5 sequencing adaptor; the partial sequencing adaptor to which the downstream primer is ligated is the illumina partial P7 sequencing adaptor. Preferably, the sequencing linker sequence is added to the final product in two steps during the amplification process, avoiding subsequent pooling.

Preferably, reverse transcription for the V, D and J regions of the human TRB gene is performed based on the template switching technique using the following forward and reverse primers:

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO：4)；

the downstream primer is:

5’-CAGTATCTGGAGTCATTGA-3’(SEQ ID NO：9)。

preferably, reverse transcription for the V, D and J regions of the murine TRB gene is performed based on the template switching technique using the following forward and reverse primers:

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO：4)；

the downstream primer is:

5’-CTCCTTGCCATTCACCCACC-3’(SEQ ID NO：1)。

preferably, three nested PCR can be performed for human TRB genes in V, D and J regions, using the following primers:

first round PCR primers:

an upstream primer: 5'-AAGCAGTGGTATCAACGCAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-GTGTGGCCTTTTGGGTGTGG-3' (SEQ ID NO: 10);

second round PCR primers:

an upstream primer: 5' -TCTTTCCCTACACGACGCTCTTCCGATCTAAGCAGTGGTATCAACGCAG (SEQ ID NO: 12);

a downstream primer: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTGATGGCTCAAACACAGC-3' (SEQ ID NO: 11);

third round PCR primer:

an upstream primer: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG-3' (SEQ ID NO: 7);

a downstream primer: 5 '-CAAGCAGAAGACGGCATACGAGAT-barcode-GTGACTGGAGTTCAGACGTGTG-3' (SEQ ID NO: 8).

Preferably, nested PCR can be performed on the V, D and J regions of the murine TRB gene using the following primers:

first round PCR primers:

an upstream primer: AAGCAGTGGTATCAACGCA (SEQ ID NO:5)

A downstream primer: CACGAGGGTAGCCTTTTGTT (SEQ ID NO:2)

Second round PCR primers:

an upstream primer: TCTTTCCCTACACGACGCTCTTCCGATCTAAGCAGTGGTATCAACGCA (SEQ ID NO:6)

A downstream primer: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGGGTGGAGTCACATTTC (SEQ ID NO:3)

Third round PCR primer:

an upstream primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG (SEQ ID NO:7)

A downstream primer: CAAGCAGAAGACGGCATACGAGAT-barcode-GTGACTGGAGTTCAGACGTGTG (SEQ ID NO: 8).

The first round of PCR amplification aims at increasing the product specificity and reducing the interference of non-specific amplification sequences on subsequent experiments by adding a gene specific primer.

Preferably, the partial sequencing adaptor ligated by the upstream primer in the second round of PCR amplification is an illumina partial P5 sequencing adaptor; the partial sequencing adaptor to which the downstream primer is ligated is the illumina partial P7 sequencing adaptor. The sequencing linker sequence is added into the final product in two steps in the amplification process, so that the subsequent library building process is avoided.

In the third round of PCR, each downstream primer uses a unique barcode sequence (various barcode sequences are published by Illumina), which can be used as a unique marker for each sample PCR product, so that multiple samples can be sequenced in a mixed way.

Preferably, two nested PCR can be performed for V, D and J regions of human TRB gene, and the primers used are as follows:

first round PCR primers:

second round PCR primers:

Preferably, two nested PCR can be performed for the V, D and J regions of the murine TRB gene, using the following primers:

first round PCR primers:

Second round PCR primers:

Preferably, the partial sequencing adaptor ligated by the upstream primer in the first round of PCR amplification is an illumina partial P5 sequencing adaptor; the partial sequencing adaptor to which the downstream primer is ligated is the illumina partial P7 sequencing adaptor. The sequencing linker sequence is added into the final product in two steps in the amplification process, so that the subsequent library building process is avoided.

In the second round of PCR, each downstream primer adopts a unique barcode sequence (Illumina publishes various barcode sequences), which can be used as a unique mark of each sample PCR product, so that multiple samples can be sequenced in a mixed way.

In a second aspect, the invention provides a kit for constructing a sequencing library of V, D and J regions of a human or animal TRB gene, the kit comprising the following primer sets: a primer set for reverse transcription of V, D and J regions of TRB gene of a subject based on a template switching technique; nested downstream primers and nested upstream primer sets used in PCR; the downstream primer used in reverse transcription and nested PCR is a nested TRBC specific primer designed aiming at a common sequence and a TRB gene C region, the upstream primer is a primer designed based on a common sequence and a molecular label to be introduced into a reverse transcription product in a template conversion technology, and only one downstream primer and one upstream primer are used in an amplification system of reverse transcription and nested PCR.

Preferably, the TRBC-specific primers used in the next round of PCR are closer to the 5' end of the C region than the TRBC-specific primers used in the previous round of PCR, the primers of the subsequent PCR except the first round of PCR all carry partial sequencing adaptor sequences and both the upstream and downstream primers partially overlap with the upstream and downstream primers of the previous round, respectively.

Preferably, the partial sequencing adaptor ligated by the upstream primer in the subsequent PCR other than the first round of PCR is an illumina partial P5 sequencing adaptor; the partial sequencing adaptor to which the downstream primer is ligated is the illumina partial P7 sequencing adaptor.

Preferably, the primer set for reverse transcription of V, D and J regions of human TRB gene based on the template switching technique is:

an upstream primer:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO：4)；

a downstream primer:

5’-CAGTATCTGGAGTCATTGA-3’(SEQ ID NO：9)。

preferably, the primer set for reverse transcription of V, D and J regions of murine TRB gene based on the template switching technique is:

an upstream primer:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO：4)；

a downstream primer:

CTCCTTGCCATTCACCCACC(SEQ ID NO：1)。

first round PCR primers:

an upstream primer: 5'-AAGCAGTGGTATCAACGCAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-GTGTGGCCTTTTGGGTGTGG-3' (SEQ ID NO: 10);

second round PCR primers:

third round PCR primer:

first round PCR primers:

an upstream primer: AAGCAGTGGTATCAACGCA (SEQ ID NO:5)

A downstream primer: CACGAGGGTAGCCTTTTGTT (SEQ ID NO:2)

Second round PCR primers:

Third round PCR primer:

first round PCR primers:

second round PCR primers:

Second round PCR primers:

The invention also relates to the use of the kit of the invention in the construction of sequencing libraries for the V, D and J regions of the TRB gene of human or murine.

The invention fully utilizes the consensus sequence as a primer, avoids using multiple PCR, simultaneously introduces a sequencing joint sequence published by illumina (a high-throughput sequencing platform widely adopted at present) into a final product in the amplification process, and synchronously completes enrichment amplification of a TRB library and construction of a sequencing library. Moreover, the invention also realizes the construction of sequencing libraries of V, D and J regions of the mouse TRB gene.

In particular, three nested gene-specific primers are designed at the C region consensus sequence, and only one of the primers is used in each round of PCR, so that the reaction system is greatly simplified, and the use of multiple PCR is avoided. The gene specific primer used in the last round of PCR is designed to be as close to the 5' end of the C region as possible, so that the length of the final product can be shortened as much as possible, and the final product can meet the quality standard of a sequencing library under the existing conditions. And the sequencing linker sequence is added step by step (two steps) in the amplification process, so that the subsequent library building process is avoided.

The first round of PCR was aimed at increasing product specificity and reducing interference of non-specific amplified sequences in subsequent experiments by using one gene-specific primer (second TRBC-specific primer). This round of PCR may be omitted.

The library insert constructed by the scheme is between 600 and 800bp, is suitable for an illumina HiSeq2000 sequencer and is detected by a double-end 250bp (PE250) method. Compared to a pooling scheme for MiSeq sequencers, the sequencing cost is lower.

The technical scheme of the invention has the following characteristics:

performing multiplex amplification: amplification of the CDR3 region of the TCR β chain using multiple sets of PCR primers, rather than probe capture;

high flux: sequencing for one time to obtain millions of pieces of sequence information;

high accuracy: an accurate count of from a few to hundreds of thousands of copies;

high resolution: can accurately detect single base difference;

the repeatability is good: deep sequencing ensures detection randomness without technical duplication.

Template switch (template switch) technique:the template switching technique was proposed by Chudakov et al in 2014 to utilize reverse transcription and amplification of the human immune group including TRB (Nature Methods2014, 11: 653-. The template conversion technology is a method that the end transferase activity endogenous to reverse transcriptase SuperScript ll is utilized, the characteristic of 3-6 cytosines (C) can be added at the end of a cDNA chain under the premise that the 5' cap of template mRNA exists, and a specific sequence with 3-4 guanines (G) connected at one end is added into a reverse transcription system, so that the specific sequence is introduced into a reverse transcription product. Chudrakov et al in the article (Nature Methods2014, 11: 653-655) first introduced the sequence SmartNNa 5 '-adaptor into the reverse transcription product (cDNA) by means of template transformation using SmartNNna 5' -adaptor (sequence 5 'AAGCAGUGGTAUCAACGCAGAGUNNNNNNNNNNUCTTrGrGrGrGrGrGrGrGrGrGrGrGrG 3') and a primer specific for the C-segment of the human TRB gene (5 'CAGTATCTGGAGTCATTGA 3' or 5 'GTATCTGGAGTCATTGA 3'). Wherein rGrGrGrG is a nucleotide sequence with a base of G, 12N are random sequences with the length of 12, and the random sequences are used as molecular tags to introduce reverse transcription products so as to correct deviation caused by PCR amplification. Then, the cDNA product is taken as a template, a partial sequence in SmartNNna 5 '-adaptor is taken as an upstream primer (5'-AAGCAGTGGTATCAACGCA-3'), and a specific sequence (5'-TGCTTCTGATGGCTCAAACAC-3') of the human TRBC gene at the 5' end is taken as a downstream primer, so that the first round of PCR amplification is carried out. The product was then purified and used as a template for a second round of PCR amplification (this process is multiplex PCR) with the partial sequence ((N)2-4 (xxxxxx) CAGTGGTATCAACGCAGAG) in smartnnna 5' -adaptor ligated with random sequences as the upstream primer and multiple specific sequences for multiple J loci in humans as the downstream primer. And connecting sequencing joints and sequencing the amplification products by using a second-generation sequencing library building kit. Chudakov and the like skillfully utilize SmartNNna 5' -adaptor, not only avoids multiple PCR in the initial stage, but also introduces a molecular tag into a system, and can correct errors and deviations introduced by PCR in the later data analysis. However, Chudakov et al still used multiple primers for the human J locus in the second round of PCR, or changed the PCR system to a multiplex PCR system.

Description of the drawings:

FIG. 1 illustrates an experimental flow diagram of the present invention;

FIG. 2 is a graph showing fluorescence peaks of a sequencing library of V, D and J regions of the mouse TRB gene;

FIG. 3 is a graph showing fluorescence peaks of a sequencing library of V, D and J regions of the human TRB gene.

Detailed Description

The technical solution of the present invention is further described below with reference to the following embodiments and the accompanying drawings. These examples are given solely for the purpose of illustration and are not intended to limit the scope of the invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning of Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 2001), or the conditions as recommended by the manufacturer of the apparatus or reagents.

Example 1:

1. primers for experiments:

table 1:

all primers in Table 1 above were dissolved and made into 100. mu.M stock solutions. The working solution concentration was 10. mu.M.

2. The experimental process comprises the following steps:

2.1 extraction of total RNA: total RNA was extracted from the spleen of mice as a biological sample.

2.2 reverse transcription: TRBC-RT and 5TSA in the above table 1 are used as primers, SuperScript is adopted^TMII Reverse Transcriptase (Thermo Fisher #18064014) kit, performing primer-specific Reverse transcription to generate a cDNA template, and specifically comprising the following steps:

(1) RNA denaturation, primer incubation:

regulating the RNA concentration to be 100-1000 ng/muL, taking 2 muL, adding 1 muL TRBC-RT (10 muM), mixing uniformly, placing in a 70 ℃ water bath for 2min, and then placing in a 42 ℃ water bath for 2 min;

(2) reverse transcription, by template replacement, introducing molecular tags and consensus sequences at the 3' end of the cDNA, and the reaction system is as follows:

mixing the above systems, adding into the mixture of RNA and primer in 2.1, incubating in 42 deg.C water bath for 130min, placing in 70 deg.C water bath for 15min, and placing on ice;

(3) degradation of excess 5TSA primer:

mu.L of UDG enzyme and 2.3. mu.L of 10 XUDG buffer (total volume 23.3. mu.L) were added in this order, mixed well and incubated in a 37 ℃ water bath for 40 min.

2.3 first round PCR: to the contraryThe cDNA obtained by transcription was used as a template, and a first round of PCR was performed. The total volume of the reaction system after reverse transcription was about 23.3. mu.L, which was dispensed into 8 200. mu.L PCR tubes as PCR templates, at a rate of 2.5. mu.L/tube. The upstream primer is a consensus sequence introduced at the end of cDNA3 'by using a template conversion principle in a reverse transcription process, the downstream primer is a TRBC specific primer, and the designed position of the primer is closer to the 5' end of the TRBC than the reverse transcription primer. By using

Hot Start High-Fidelity DNA Polymerase (NEB # M0493L) and the corresponding reagents, configuring a PCR system, and adding the following reagents in order:

and (3) uniformly mixing the system, adding the mixture into a PCR tube filled with 2.5 mu L of reverse transcription products, uniformly mixing, and carrying out PCR according to the following procedures:

the main purpose of the amplification in this round is to increase the product specificity and reduce the interference of non-specific amplification sequences on subsequent experiments by adding a gene specific primer.

2.4 second round PCR: and performing second round PCR by using the first round PCR product as a template. The first round of PCR products 8 tubes, total 400. mu.L, were pooled and purified using the QIAquick PCR purification kit (Qiage #28106) to a volume of about 10. mu.L. This was used as a template for the second round of PCR. The upstream primer of the round is a sequencing joint of a consensus sequence connecting illumina part P5 introduced in the reverse transcription process, the downstream primer is a sequencing joint of a third TRBC specific primer connecting illumina part P7, and the third TRBC specific primer is designed at a position which is more advanced than that of the first TRBC specific primerNear the 5' end of the TRBC. Here, a partial linker sequence was added as a consensus sequence to the PCR product by PCR amplification. Also adopt

the above system was mixed and subjected to PCR according to the following protocol:

2.5 third round PCR: and performing third round PCR by using the second round PCR product as a template. In this round of PCR, the consensus sequence is used to design primers for a third round of PCR, and the complete linker sequence is incorporated into the PCR product to complete the library construction. The second round PCR product was purified using QIAquick PCR purification kit (Qiage #28106) in a volume of about 10. mu.L. This was used as a template for the third PCR. SuperF and SuperR are used as amplification primers. The SuperR is designed to contain 6-8 bases as the barcode, and each sample adopts a unique barcode sequence (various barcode sequences are published by illumina), and can be used as a unique mark of PCR products of each sample so as to facilitate multi-sample mixed sequencing. Also adopt

Preparing a PCR system by Hot Start High-Fidelity DNA Polymerase (NEB # M0493L) and matched reagents, and adding the following reagents in sequence:

2.6 fragment recovery and sequencing: and (3) cutting the obtained product to purify, recovering the band with the size of 400 bp-800 bp, and establishing a library. And (4) performing mixed sequencing after quality control is qualified.

3. As a result:

see table 2 below for results.

Table 2:

fragment size (bp)	Mass concentration (ng/. mu.L)	Molarity (nmol/L)	Comprehensive results
				625	21.2	5.733	Qualified

In addition, referring to fig. 2, it can be seen that the pattern is sharp, no tailing is present, and thus the result is acceptable. The data analysis gave the results shown in table 3 below:

TABLE 3

Statistical data obtained after testing 1 mouse spleen sample in an immune repertoire.

In the above analysis, the sequencing reads with the same molecular tag in the MS01 sample appeared 3 times or more after data evaluation, and the molecular tag was considered as a valid molecular tag, and the labeled sequence was included in the subsequent analysis process: the sequences are corrected and combined using a voting method. Molecular tags that failed this criterion were considered to have been introduced due to sequencing errors and were not included in subsequent analyses.

Example 2:

1. primers for experiments:

table 4:

2. The experimental process comprises the following steps:

2.1 extraction of total RNA: leukocytes were isolated as biological samples from 3 human peripheral blood samples, and total RNA was extracted.

2.2 reverse transcription: TRBC-RT and 5TSA in the above table 1 are used as primers, SuperScript is adopted^TMII Reverse transcription (Thermo Fisher #18064014) reagentThe kit is used for carrying out primer-specific reverse transcription to generate a cDNA template, and comprises the following specific steps:

(1) RNA denaturation, primer incubation:

taking 700ng RNA, adding 1 μ L TRBC-RT (10 μ M), adding water to 6.9 μ L, mixing well, and placing in PCR instrument at 70 deg.C for 2min and 42 deg.C for 2 min;

mixing the above systems, adding into the mixture of RNA and primer in 2.1, placing in PCR instrument at 42 deg.C for 90min and 70 deg.C for 15min, and placing on ice;

(3) degradation of excess 5TSA primer:

mu.L of UDG enzyme and 2.3. mu.L of 10 XUDG buffer (total volume 23.3. mu.L) were added in this order, mixed well and incubated at 37 ℃ for 40min in a PCR instrument.

2.3 first round PCR: first round PCR was performed using cDNA obtained by reverse transcription as a template. The total volume of the reaction system after reverse transcription was about 23. mu.L, and the reaction system was dispensed into 5 200. mu.L PCR tubes as PCR templates at a volume of 5. mu.L/tube. The upstream primer is a consensus sequence introduced at the end of cDNA3 'by using a template conversion principle in a reverse transcription process, the downstream primer is a TRBC specific primer, and the designed position of the primer is closer to the 5' end of the TRBC than the reverse transcription primer. By using

Preparing a PCR system by using High-Fidelity DNA Polymerase (NEB # M0491L) and matched reagents, and adding the following reagents in sequence:

and (3) uniformly mixing the system, adding the mixture into a PCR tube filled with 5 mu L of reverse transcription products, uniformly mixing, and carrying out PCR according to the following procedures:

2.4 second round PCR: and performing second round PCR by using the first round PCR product as a template. First round PCR product 5 tubes, total 250. mu.L, after combining them as template for second round PCR. The upstream primer of the round is a consensus sequence connected with an illumina part P5 sequencing joint introduced in the reverse transcription process, the downstream primer is a third TRBC specific primer connected with a part illumina part P7 sequencing joint, and the third TRBC specific primer is designed to be closer to the 5' end of the TRBC than the front. Here, a partial linker sequence is added as a consensus sequence to the PCR product by PCR amplification. Also adopt

2.5 third round PCR: and performing third round PCR by using the second round PCR product as a template. In this round of PCR, the consensus sequence is used to design primers for a third round of PCR, and the complete linker sequence is incorporated into the PCR product to complete the library construction.

Specifically, the second PCR product was purified using QIAquick PCR purification kit (Qiage #28106) and the volume of the purified product was about 10 to 20. mu.L, and this was used as a template for the third PCR. SuperF and SuperR are used as amplification primers. The SuperR is designed to contain 6-8 bases as the barcode, and each sample adopts a unique barcode sequence (various barcode sequences are published by illumina), and can be used as a unique mark of PCR products of each sample so as to facilitate multi-sample mixed sequencing. Also adopt

Preparing a PCR system by High-Fidelity DNA Polymerase (NEB # M0491L) and matched reagents, and adding the following reagents in sequence:

2.6 the resulting product was purified using QIAquick PCR purification kit (Qiage #28106) to a volume of about 30. mu.L, and the library was completed. And (4) performing mixed sequencing after quality control is qualified.

In addition, referring to fig. 3, it can be seen that the pattern is sharp, no tailing is present, and thus the result is acceptable.

3. As a result:

the data analysis gave the results shown in table 5 below:

TABLE 5

3 exception of the T cell clone types and the total number of T cells obtained after the detection of the peripheral blood sample by the immune repertoire

Sample numbering	Clonal species of T cells in a sample	Total number of T cells in the sample
			L01	73,291	329,386
L02	88,192	340,548
			L03	61,533	247,130

In the above analysis, the data evaluation shows that the sequencing reads with the same molecular tag in the L01 sample occur 4 times or more, and in the L02 and L03 samples 6 times or more, the molecular tag is regarded as a valid molecular tag, and the labeled sequence is included in the subsequent analysis process: the sequences are corrected and combined using a voting method. Molecular tags that failed this criterion were considered to have been introduced due to sequencing errors and were not included in subsequent analyses.

The invention simplifies the amplification system, avoids using multiple PCR, introduces molecular tags, and can further correct errors introduced by PCR in the data analysis process, thereby realizing the quantitative detection of the immune group with highly complex sequence. The results in Table 5 also show that using the protocol of the invention, the number of T cell clones detected is 1-2 orders of magnitude greater than the number of clones found in the prior art.

Sequence listing

<110> tumor hospital of Chinese medical science institute

<130> PN2185CT66CN

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 1

ctccttgcca ttcacccacc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 2

cacgagggta gccttttgtt 20

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 3

gtgactggag ttcagacgtg tgctcttccg atctcttggg tggagtcaca tttc 54

<210> 4

<211> 43

<212> DNA/RNA

<213> Artificial Sequence

<220>

<223> Unknown

<220>

<221> misc_feature

<222> (24)..(27)

<223> n is a, c, g, t or u

<220>

<221> misc_feature

<222> (29)..(32)

<223> n is a, c, g, t or u

<220>

<221> misc_feature

<222> (34)..(37)

<223> n is a, c, g, t or u

<400> 4

aagcaguggt aucaacgcag agunnnnunn nnunnnnuct trG3 43

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 5

aagcagtggt atcaacgca 19

<210> 6

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 6

tctttcccta cacgacgctc ttccgatcta agcagtggta tcaacgca 48

<210> 7

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 7

aatgatacgg cgaccaccga gatctacact ctttccctac acgacg 46

<210> 8

<211> 46

<212> DNA/RNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 8

caagcagaag acggcatacg agatbargtgact ggagttcaga cgtgtg 46

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 9

cagtatctgg agtcattga 19

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 10

gtgtggcctt ttgggtgtgg 20

<210> 11

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 11

gtgactggag ttcagacgtg tgctcttccg atcttctgat ggctcaaaca cagc 54

<210> 12

<211> 49

<212> DNA

<213> Artificial Sequence

<220>

<223> Unknown

<400> 12

tctttcccta cacgacgctc ttccgatcta agcagtggta tcaacgcag 49

Claims

1. A method for constructing a sequencing library of V, D and J regions of human or murine TRB genes, said method comprising:

(1) extracting total RNA from a biological sample of a subject, the biological sample of the subject being tumor tissue of a human or a mouse; peripheral blood leukocytes; hydrothorax ascites, joint fluid, cerebrospinal fluid containing lymphocytes; and a tissue organ selected from: spleen, lymph nodes, skin;

(2) reverse transcription of V, D and J regions of TRB gene based on template switching technique to add consensus sequence and molecular tag at the 3' end of cDNA using a primer set (a) or (b) shown below,

(a) upstream and downstream primers for reverse transcription of V, D and J regions of human TRB gene,

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO:4)；

the downstream primer is:

5'-CAGTATCTGGAGTCATTGA-3' (SEQ ID NO: 9); or

(b) Upstream and downstream primers for reverse transcription of V, D and J regions of the murine TRB gene,

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO:4)；

the downstream primer is:

5'-CTCCTTGCCATTCACCCACC-3' (SEQ ID NO: 1); and are

(3) Subsequently, two or three rounds of nested PCR using the primer set (c) or (d) shown below were performed while adding a sequencing linker sequence to the final product, the two rounds of nested PCR using the primer set (e) or (f) shown below:

(c) three nested PCR primers for sequencing library construction of human TRB gene V, D and J regions:

first round nested PCR primers:

an upstream primer: 5'-AAGCAGTGGTATCAACGCAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-GTGTGGCCTTTTGGGTGTGG-3' (SEQ ID NO: 10);

second round nested PCR primers:

the third round of nested PCR primers:

a downstream primer: 5 '-CAAGCAGAAGACGGCATACGAGAT-barcode-GTGACTGGAGTTCAGACGTGTG-3' (SEQ ID NO: 8);

(d) three nested PCR primers for sequencing library construction of the V, D and J regions of the murine TRB gene:

first round nested PCR primers:

an upstream primer: AAGCAGTGGTATCAACGCA (SEQ ID NO:5)

A downstream primer: CACGAGGGTAGCCTTTTGTT (SEQ ID NO:2)

Second round nested PCR primers:

an upstream primer: TCTTTCCCTACACGACGCTCTTCCGATCTAAGCAGTGGTATCAACGCA (SEQ ID NO: 6);

a downstream primer: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGGGTGGAGTCACATTTC (SEQ ID NO: 3);

the third round of nested PCR primers:

an upstream primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG (SEQ ID NO: 7);

a downstream primer: CAAGCAGAAGACGGCATACGAGAT-barcode-GTGACTGGAGTTCAGACGTGTG (SEQ ID NO: 8);

(e) two rounds of nested PCR primers used for sequencing library construction of V, D and J regions of human TRB gene:

first round nested PCR primers:

second round nested PCR primers:

(f) two rounds of nested PCR primers used for sequencing library construction of the V, D and J regions of the murine TRB gene:

first round nested PCR primers:

second round nested PCR primers:

2. A kit for constructing a sequencing library of V, D and J regions of human or murine TRB genes, said kit comprising the following primer sets:

(1) a primer set (a) or (b) for reverse transcription of V, D and J regions of TRB gene of a subject based on a template switching technique,

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO:4)；

the downstream primer is:

5'-CAGTATCTGGAGTCATTGA-3' (SEQ ID NO: 9); or

the upstream primer is as follows:

5’-AAGCAGUGGTAUCAACGCAGAGUNNNNUNNNNUNNNNUCTT(rG)3-3’(SEQ ID NO:4)；

the downstream primer is:

5’-CTCCTTGCCATTCACCCACC-3’(SEQ ID NO:1)；

(2) a set of downstream and upstream primers (c), (d), (e) or (f) for use in two or three cycles of nested PCR by which sequencing linker sequences are added to the final product;

first round nested PCR primers:

an upstream primer: 5'-AAGCAGTGGTATCAACGCAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-GTGTGGCCTTTTGGGTGTGG-3' (SEQ ID NO: 10);

second round nested PCR primers:

the third round of nested PCR primers:

first round nested PCR primers:

an upstream primer: AAGCAGTGGTATCAACGCA (SEQ ID NO:5)

A downstream primer: CACGAGGGTAGCCTTTTGTT (SEQ ID NO:2)

Second round nested PCR primers:

the third round of nested PCR primers:

first round nested PCR primers:

second round nested PCR primers:

first round nested PCR primers:

second round nested PCR primers:

3. Use of the kit according to claim 2 for constructing a sequencing library of V, D and J regions of TRB genes for human or mouse.