WO2019227331A1 - Method for constructing variable region sequence library, sequencing method, and kit thereof - Google Patents

Abstract

Provided is a method for constructing a variable region sequence library, comprising: (1) obtaining a DNA sample comprising an encoding variable region; (2) using the DNA sample as a template, and amplifying and encoding a DNA sequence of the variable region by using a first primer group to obtain a first amplification product library; and (3) using the first amplification product library as a template, and amplifying and encoding the DNA sequence of the variable region by using a second primer group and a primer of a first joint, thus obtaining a variable region sequence combination product. Further provided are a kit for constructing the variable region sequence library, and a sequencing method for a variable region sequence.

Description

Variable region sequence library construction method, sequencing method and kit Technical field

The invention belongs to the field of biotechnology, and particularly relates to a method for constructing a variable region sequence library, a sequencing method, and a kit thereof.

Background technique

"Immunity" is an extremely important self-defense function of the human body. Depending on its own immunity, it can resist a large variety of diseases. Almost all diseases in the human body are closely related to immunity. The immune cells responsible for defending the body in the human microenvironment are mainly T cells, B cells, macrophages, and dendritic cells. These specialized immune cells have unique structures and functions, and contain unique immune cell subgroups and functional molecules. T cells and B cells are the main lymphocytes of the human body, responsible for cellular immunity and humoral immunity, respectively. Understanding the composition of T cells and B cells is helpful to the understanding, prevention and treatment of diseases. T cell receptor (TCR) and B cell receptor (BCR) are composed of multiple peptide chains with antigen binding specificity. The amino acid composition and arrangement order of the complementary determining region (also known as the hypervariable region) of each peptide chain It presents a high degree of diversity and constitutes a large capacity TCR library and BCR library. Studies have shown that the more subtypes, the more effective it is against pathogens such as bacteria and viruses, and the less subtypes are more likely to infect diseases. In addition, age, environment, disease-causing factors, and medication also affect the diversity of immune cells. As a result, Immune Repertoire sequencing (IR-SEQ) technology came into being: it was used to amplify CDR regions for the purpose of multiplex PCR or 5'RACE technology, combined with high-throughput sequencing, from DNA or RNA The level specifically studies the immune diversity of the complementary determining regions of TCR and BCR, and is used to further explore the association between immune repertoire and disease.

At present, the immune diversity detection of TCR and BCR complementarity determining regions is performed at the DNA level. Primarily, the V genes and J gene fragments that make up the CDR regions of TCR and BCR are used to design primers, and the CDR regions are amplified. The amplified products were spliced, and the TCR and BCR diversity were detected in next-generation sequencing. Another part of the research is to detect the immune diversity of TCR and BCR complementarity determining regions at the RNA level. The main use is the reverse transcription reaction of the terminal C region of the CDR regions of TCR and BCR, which extends to the V region of the CDR region, and then performs the product. Amplification and second-generation sequencing were performed to analyze the TCR and BCR diversity.

However, the existing technologies for detecting TCR and BCR diversity still have the following problems. First, using DNA to perform multiplex PCR to amplify the CDR regions of TCR and BCR. The main problems are, first, the V at both ends of the CDR region. J is very diverse, and the primer set required at each end may range from several primers to dozens of primers, depending on the design of the primers. The set of primer pairs is used for amplification. Because there are many primer sets at both ends, primer mismatch on the template is easy to occur, and the amplification efficiency is relatively low. Once the main amplicon is formed, it is easy to cause amplification bias. On the other hand, due to the nature of second-generation sequencing, it is easy to introduce errors in the sequencing process, and the current multiplex PCR scheme cannot perform correction analysis, which often brings great deviations to the detection of diversity. Second, the use of RNA for reverse transcription PCR to amplify the CDR regions of TCR and BCR also has some problems. The processing of RNA samples is more difficult than that of DNA samples, and it is unstable and prone to degradation. At this stage, it is easier to lose diversity information. At the same time, some current reverse transcription schemes require adaptor conversion in the last step of the extension, but the conversion rate of the existing adaptor conversion technology is low. If the adaptor conversion cannot be successfully performed, in the subsequent steps, this part Information loss also has a large bias for diversity results. In addition, because each T cell or B cell corresponds to a unique TCR or BCR, and the RNA sample may be transcribed in a large amount of cells, it is impossible to achieve that each T cell or B cell corresponds to a unique TCR or BCR. Correspondence.

In summary, it is a technical problem for those skilled in the art to develop a technical solution for efficient amplification, unbiasedness, accurate analysis results, and comprehensive construction of a variable region sequence library of TCR or BCR.

Summary of the Invention

In view of this, the present invention discloses a method for constructing a variable region sequence library, a sequencing method, and a kit thereof, which can effectively solve the low amplification efficiency and bias of amplification existing in the current technology for constructing variable region sequence libraries of TCR or BCR And the technical defects that easily lose the sequence information of the variable region sequence library.

The invention provides a method for constructing a variable region sequence library and a method for sequencing a variable region sequence, including the following steps:

Step 1: Obtain a DNA sample containing a variable region;

Step 2: Use the DNA sample as a template to extend a DNA sequence encoding the variable region through a first primer group to obtain a first amplification product library, wherein the first primer group includes a specific recognition region for the J region. First primers of all subtype coding sequences, the first primers include a nucleotide sequence that specifically recognizes the coding sequence of the J region, a proofreading random segment, and a first linker, and the code that specifically recognizes the J region The nucleotide sequence of the sequence, the proofreading random segment and the first linker are sequentially connected, and the sequences of the proofreading random segment of the first primer group are different from each other;

Step 3: Using the first amplification product library as a template, a DNA sequence encoding the variable region is amplified by primers of a second primer group and a first adapter to obtain a variable region sequence combination product, wherein the The second primer group includes a second primer that specifically recognizes coding sequences of all subtypes of the V region; the second primer includes a nucleotide sequence and a second linker that specifically recognizes coding sequences of the V region, and the The nucleotide sequence that specifically recognizes the coding sequence of the V region and the second linker are connected to each other; the primers of the first linker include a nucleotide sequence that specifically recognizes the first linker.

Wherein, the first primer group includes a plurality of first primers with different sequences, and the sequence of the proofreading random segment of each of the first primers is different from each other, and each of the first primers includes a specific recognition region of the J region. The first primer group includes a sequence that specifically recognizes all subtypes of the J region. For example, the first primer A includes a sequence that specifically recognizes a subtype of the J region A subtype. Primer B includes a sequence that specifically recognizes the coding sequence of the J region B subtype, and so on. The first primer group includes primers of the first primer A, the first primer B, and the like; and the second primer group includes multiple sequences. Different second primers, each of which includes a sequence that specifically recognizes one subtype of the V region, and the second primer group includes a sequence that specifically recognizes all subtypes of the V region, such as The second primer A includes a sequence that specifically recognizes the coding region of the V region A subtype, the second primer B includes the sequence that specifically recognizes the coding region of the V region B subtype, and so on, and the second primer group includes the second primer A, second primer B, etc. The primers.

The first adaptor and the second adaptor are sequences used to construct a library, and the constructed library includes a sequencing library or a gene library.

Wherein, the nucleotide sequence of the coding sequence that specifically recognizes the V region and the second linker are connected to each other.

Wherein, the coding sequence of the J region is a sequence of all subtypes of the J-fragment of the receptor-encoding gene of the B-cell receptor or the T-cell receptor. Therefore, the first primer group includes a specific recognition of the B-cell receptor or the T-cell. The nucleotide sequences of the coding sequences of the J regions of all the subtypes of the receptors are different because the coding sequences of the J regions of all the subtypes of the B cell receptor or the T cell receptor are different. The sequences of the nucleotide sequences that specifically recognize the coding sequence of the J region are different from each other.

Wherein, the coding sequence of the V region is the sequence of all subtypes of the V-fragment of the receptor-encoding gene of the B-cell receptor or the T-cell receptor, therefore, the second primer group includes a specific recognition of the B-cell receptor or the T cell The nucleotide sequences of the coding regions of the V regions of all the subtypes of the receptors are different because the coding sequences of the V regions of all the subtypes of the B cell receptor or the T cell receptor are different. The sequences of the nucleotide sequences that specifically recognize the coding sequence of the J region are different from each other.

Preferably, step 4 is further included. The step 4 specifically includes: using the variable region sequence combination product as a template, amplifying a DNA sequence encoding the variable region through a first sequencing adapter and a second sequencing adapter to obtain a variable Region sequence library, wherein the first sequencing linker includes a nucleotide sequence that specifically recognizes the first linker and linker A for sequencing; the second sequencing linker includes a nucleoside that specifically recognizes the second linker Acid sequence and adapter B for sequencing. The purpose of step 4 is to connect the variable region sequence combination product with a sequencing adapter necessary for high-throughput sequencing.

Preferably, the sequence length of the proofreading random segment is 8-20 nucleotides.

Preferably, the sequence length of the proofreading random segment is 8-10 nucleotides.

Among them, the sequence length of the proofreading random segment is 8-10 nucleotides, which can improve the recognition efficiency of the first primer group annealing, contribute to efficient extension, and improve the yield of the product.

Preferably, the sequences of the plurality of first linkers are identical to each other.

The amplification of the third step is a multiplex PCR, which specifically includes: pre-denaturation 95 ° C, 15s; denaturation 94 ° C, 40s; annealing 60 ° C, 4min; extension 72 ° C, 90s; final extension 72 ° C, 10s; 35 cycles.

Wherein, the DNA sample is used as a template, and the single primer extension technology is used to encode the DNA sequence of the variable region by the first primer extension technology to obtain the first amplification product library. The single primer extension technology can effectively process the DNA sample and avoid Some of the inconveniences of RNA sample processing (the efficiency of adding adaptors during reverse transcription of RNA is very low), compared with RNA that needs to convert adaptors, the efficiency is also improved. After the single primer extension is obtained, the multiplex PCR in step 3 only needs to perform multiplex PCR with the first linker primer at one end, and the efficiency of the multiplex PCR is also improved.

Preferably, the variable region sequence is a variable region sequence of a B cell receptor or a T cell receptor.

Preferably, the DNA sample containing the variable region is whole genomic DNA extracted from animal peripheral blood.

Preferably, the sequences of the proofreading random segments of the first primer group do not generate primer dimers with each other, thereby improving the efficiency of introducing proofreading random segments.

The present invention also provides a kit for constructing a variable region sequence library, which includes the following primers: a first primer group, a first linker primer, and a second primer group;

Wherein, the first primer group includes first primers that specifically recognize coding sequences of all subtypes of the J region;

The first primer includes a nucleotide sequence that specifically recognizes the coding sequence of the J region, a proofreading random segment, and a first linker, and the nucleotide sequence that specifically recognizes the coding sequence of the J region, and the proofreading random segment. Connected to the first link in sequence, and the sequences of the proofreading random segments of the first primer group are different from each other;

The second primer group includes second primers that specifically recognize coding sequences of all subtypes of the V region;

The second primer includes a nucleotide sequence that specifically recognizes the coding sequence of the V region and a second linker, and the nucleotide sequence that specifically recognizes the coding sequence of the V region and the second linker are connected to each other;

The primer of the first linker includes a nucleotide sequence that specifically recognizes the first linker.

Preferably, the DNA sample encoding the variable region is a sequence of a T cell receptor, and the first primer group includes a nucleotide sequence shown in SEQ ID NO: 1-13.

Preferably, the DNA sample encoding the variable region is a sequence of a T cell receptor, and the second primer group includes a nucleotide sequence shown in SEQ ID NO: 14-65.

Preferably, the DNA sample encoding the variable region is a sequence of a B-cell receptor, and the first primer group includes a nucleotide sequence shown in SEQ ID NOs: 66-71.

Preferably, the DNA sample encoding the variable region is a sequence of a B-cell receptor, and the second primer group includes a nucleotide sequence shown in SEQ ID NOs: 72-85.

Preferably, the first linker is a nucleotide sequence shown in SEQ ID NO: 86.

Preferably, the second linker is a nucleotide sequence shown in SEQ ID NO: 87, and the sequence of SEQ ID NO: 87 is: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG.

The kit for constructing a variable region sequence library according to the present invention further includes a first sequencing adapter and a second sequencing adapter;

Wherein, the first sequencing adapter includes a nucleotide sequence that specifically recognizes the first adapter and sequencing adapter A; the second sequencing adapter includes a nucleotide sequence that specifically recognizes the second adapter and sequencing Use connector B.

Preferably, the linker A for sequencing and the linker B for sequencing are special primers of a second-generation sequencer or a third-generation sequencer.

The invention also provides a kit for constructing a variable region sequence library, which comprises: a primer set of SEQ ID NO: 1-SEQ ID NO: 87 and a PCR amplification reagent.

Among them, PCR amplification reagents include enzymes, NTPs, Buffer and buffers commonly used in PCR.

The invention also discloses a method for sequencing a variable region sequence, comprising the method as described above or a kit for constructing a variable region sequence library as described, and constructing a variable region sequence library; and The variable region sequencing library was subjected to high-throughput sequencing to obtain variable region sequences.

Optionally, according to the sequence of the adaptor primer, the high-throughput sequencing is performed using at least one selected from the group consisting of Hiseq, Miseq, 454, SOLiD, Ion Torrent, and CG sequencing platform. The adaptor primer of the embodiment of the present invention is illumina Sequencing primers.

The proofreading random segment specifically includes a randomly synthesized DNA sequence.

The invention also discloses the application of a method for constructing a variable region sequence library in a method for accurately analyzing a TCR / BCR library.

The purpose of the present invention is to address the shortcomings of the existing technology for constructing a variable region sequence library of TCR or BCR by using DNA and RNA. The disclosed method for constructing a variable region sequence library includes three steps: step one, obtaining A DNA sample containing a variable region is encoded; step two, using the DNA sample as a template, extending a DNA sequence encoding the variable region through a first primer group to obtain a first amplified product library, wherein the first The primer group includes a plurality of first primers each having a different sequence, the first primer includes a nucleotide sequence that specifically recognizes a coding sequence of the J region, a proofreading random segment, and a first linker, and the specifically recognizes the J region The nucleotide sequence of the coding sequence, the proofreading random segment and the first linker are connected in sequence. The sequence of the proofreading random segment of each of the first primers is different from each other. The nucleotide sequence of the coding sequence includes a sequence of a coding sequence that specifically recognizes a subtype of the J region, and the first primer group includes a sequence of a coding sequence that specifically recognizes all the subtypes of the J region; step three. Describe An amplification product library is used as a template, and a DNA sequence encoding the variable region is amplified by primers of a second primer group and a first adaptor to obtain a variable region sequence combination product, wherein the second primer group includes a plurality of A second primer having a different sequence, the second primer including a nucleotide sequence that specifically recognizes the coding sequence of the V region and a second linker, and the primer of the first linker includes a nucleoside that specifically recognizes the first linker Acid sequence, the nucleotide sequence of each coding sequence that specifically recognizes the V region includes a sequence that specifically recognizes a subtype of the V region, and the second primer group includes a sequence that specifically recognizes all subtypes The sequence of the coding sequence of the V region. Proofreading the random segment is equivalent to a kind of random barcode. In step two, it is added to the DNA sample by extension. After constructing the variable region library, high-throughput sequencing is needed to obtain the complete sequence of the variable region library. In this process, During sequencing, multiple PCR products of the variable region sequence are combined to introduce different PCR errors, and a proofreading random segment is added to the DNA sample. Each template has a unique random segment, which is a one-to-one correspondence. In the process of PCR, this part of the random fragment is amplified simultaneously with the connected PCR fragment to obtain a large number of amplicons. However, when a large number of PCR fragments have mutations introduced by PCR errors, due to the one-to-one correspondence, other correct and correct PCR products identified by the same random fragment can be used to bias the mutation products. Partial (correctness rate is greater than 50% is considered correct PCR product); At the same time, due to the introduction of proofreading random segments, each template has a unique proofreading random segment. When a fixed number of proofreading random segments are selected, the amount of data Comparison between samples. In the detection of immune cell receptor polymorphisms, only the comparison under the same valid data can better achieve the assessment of polymorphisms and the comparison of polymorphisms among individuals. Therefore, the present The inventive method enables comparisons between different samples. In addition, in step three, the DNA sequence encoding the variable region is amplified by a second primer and a primer of the first linker. The primer of the first linker is a single primer, and the second primer group includes a coding sequence that specifically recognizes the V region. Nucleotide sequence and the second linker, so performing a one-to-many multiplex PCR can ensure the amplification efficiency of step three and the yield of the combined product of the variable region sequences. In addition, the use of a DNA sample in the present invention can realize a one-to-one correspondence between each T cell or B cell corresponding to a unique TCR or BCR, which is beneficial to comprehensively evaluate the diversity of the TCR or BCR of the body.

BRIEF DESCRIPTION OF THE DRAWINGS

In order to explain the technical solutions in the embodiments of the present invention or the prior art more clearly, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

FIG. 1 shows a schematic flowchart of a method for constructing a variable region sequence library according to the present invention;

FIG. 2 is a schematic diagram of a bias process of correcting a random segment according to the present invention; FIG.

FIG. 3 shows the TCR unique clone number analysis of Example 1 provided by the present invention; FIG.

Figure 4 shows the analysis of the number of unique clones of BCR in Example 1 provided by the present invention;

Among them, a DNA sample containing a variable region 1, a coding sequence of the J region 11, a coding sequence of the V region 12, a first linker 2, a proofreading random segment 3, and a nucleotide sequence that specifically recognizes the coding sequence of the J region 4 First library of amplification products 5, second adapter 6, nucleotide sequence that specifically recognizes the coding sequence of the V region 7, variable region sequence combination product 8, primers for the first adapter 9, second sequencing adapter 10, Variable region sequence library 11, first sequencing adapter 12.

Detailed ways

The invention provides a kit for constructing a variable region sequence library and a method for constructing a variable region sequence library, which are used to solve the low amplification efficiency, bias, and ease of amplification existing in the current technology for constructing variable region sequence libraries of TCR or BCR. Technical shortcomings of losing sequence information from variable region sequence libraries.

The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, but not all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by a person of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

Referring to FIG. 1, the present invention discloses a method for constructing a variable region sequence library, which includes the following steps:

Step 1: Obtain a DNA sample 1 containing a variable region encoding;

Step two 101: Use the DNA sample 1 as a template to extend the DNA sequence encoding the variable region through a first primer group to obtain a first amplification product library 5, where the first primer group includes a plurality of different ones. The first primer includes a nucleotide sequence 4 that specifically recognizes the coding sequence of the J region, a proofreading random segment 3 and a first linker 2, and a nucleotide sequence 4 that specifically recognizes the coding sequence of the J region. The proofreading random segment 3 and the first adaptor 2 are connected in sequence. The sequences of the proofreading random segment 3 of each first primer are different from each other. The nucleotide sequence of each coding sequence that specifically recognizes the J region includes specifically identifying a subtype. Sequence of the coding sequence of the J region, the first primer group includes a sequence of coding sequences that specifically recognize all subtypes of the J region;

Step 3: 102. Using the first amplification product library as a template, the DNA sequence encoding the variable region is amplified by the second primer group and the primer 9 of the first linker to obtain a variable region sequence combination product 8. Among them, the second primer The group includes a plurality of second primers with different sequences. The second primer includes a nucleotide sequence 7 and a second linker 6 that specifically recognize the coding sequence of the V region. The primer 9 of the first linker includes the first linker that specifically recognizes the first linker. 2 nucleotide sequence, each nucleotide sequence that specifically recognizes the coding sequence of the V region includes a sequence that specifically recognizes a subtype of the V region, and the second primer group includes a sequence that specifically recognizes all subtypes The sequence of the coding sequence of the V region.

Further, the embodiment of the present invention further includes step 4103. Step 4103 specifically includes: using the variable region sequence combination product 8 as a template, and amplifying and encoding the variable through the first sequencing adapter 12 and the second sequencing adapter adapter 10. The variable region sequence library 11 is obtained, wherein the first sequencing linker includes a nucleotide sequence that specifically recognizes the first linker and the linker A for sequencing; the second sequencing linker 10 includes a linker that specifically recognizes the second linker. Nucleotide sequence and adapter B for sequencing.

The raw materials used in the following examples are all commercially available or homemade.

Example 1

The embodiment of the present invention provides a specific method for constructing a variable region sequence library. The steps are as follows:

1: template preparation

1. Collect 5-10ml of human peripheral blood in anticoagulant tube;

2. Add the fresh blood received to three times the volume of RBC analysis buffer, and gently turn the centrifuge tube to make it mix well;

3. Let stand for 15 minutes at room temperature;

4. Centrifuge at 450xg for 10 minutes, carefully remove the supernatant, and leave the pellet of cells;

5. If the pellet is still red, add RBC analysis buffer with twice the original blood volume, and repeat steps 2 and 3.

6. Suspend pellets with 600μl PBS, take 200μl DNA extraction with TIANamp Genomics DNAkit;

7. Primer preparation:

7.1 Primer Primer has 52 TRBV, 13 TRBJ random, 14 IgHV, 6 IgHJ random, 1 overhang, all reconstituted to 100 μM as stock primer (storage primer).

7.2. As shown in Table 1, each of the 52 TRBVs was diluted into 48 μl ddH ₂ O into 48 μl ddH ₂ O to prepare 100 μl TRBV working primers. The second primer was the TRBV working primer. The second primer included SEQ ID NO: 14-65. Display nucleotide sequence;

7.3. As shown in Table 2, 13 TRBJ random samples were each diluted with 3 μl to 11 μl ddH ₂ O, and were prepared into 50 μl TRBJ random working primers, in which random is a proofreading random segment, and the number of random fragments is 18 nucleotides. A primer group is a working primer of TRBJ random, and a working primer of TRBJ random includes a nucleotide sequence shown in SEQ ID NOs: 1-13;

7.4. As shown in Table 3, 14 IgHV samples were each diluted to 36 μl ddH ₂ O to prepare 50 μl IgHV working primers. The second primer was the IgHV working primer. The IgHV working primers are shown in SEQ ID NOs: 72-85. Nucleotide sequence

7.5. As shown in Table 4, 6 IgHJ random samples were each diluted with 3 μl to 32 ul ddH ₂ O, and 50 μl IghJ random working primers were prepared, in which random is a proofreading random segment, and the number of random fragments is 18 nucleotides. A primer group is an IghJ random working primer, and the IghJ random working primer includes a nucleotide sequence shown in SEQ ID NOs: 66-71;

7.6. As shown in Table 5, Overhang made a 10 × dilution (10 μM) to prepare 50 μl of the overhang working primer. The first linker was Overhang, the first linker was the nucleotide sequence shown in SEQ ID NO: 86, and the second linker. It is the nucleotide sequence shown in SEQ ID NO: 87.

It should be noted that TRB is a heavy chain of the T cell receptor, and this partial sequence contains a CDR3 region that determines the diversity of the T cell receptor. IgH is the heavy chain of B-cell receptors, and this partial sequence contains CDR3 regions that determine the diversity of B-cell receptors.

Table 1.TRBV working primers

Table 4 IghJ random primers (N in the table below is the nucleotide of the proofreading random segment)

table 5

Primer name	Numbering	Sequence (5’-3 ’)
SEQ ID NO: 86	Overhang (first connector)	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

2: The first PCR (annealing + extension):

1.PCR preparation (TRB and J zone extension)

ingredient	volume
Phusion 2 × MM	10μl
TRBJ Random Work Primer	2μl
100ng DNA + ddH 2 O	8μl
Total	20μl

PCR preparation (IgH and J zone extension)

ingredient	volume
Phusion 2 × MM	10μl
IghJ Random Work Primer	2μl
100ng DNA + ddH 2 O	8μl
Total	20μl

2. The first PCR program:

3. The first magnetic bead purification:

3.1. Pre-operation: AMPure XP should be warmed to room temperature before use and divided into tubes for use; 80% alcohol by volume should be prepared freshly; Purify uses 1.5ml centrifuge tubes or 96-well plates with 200μl or more.

3.2. Mix AMPure XP Beads and the products of the first PCR (30 μl AMPure Beads + 20 μl PCR products) in a volume of 1.5: 1, and mix by pipetting at least 10 times.

3.3 Incubate at room temperature for 10mins;

3.4 Place the centrifuge tube of 3.3 on the magnetic stand for 2mins or wait until the liquid is clear;

3.5. Aspirate the supernatant and discard. Be careful not to suck the magnetic beads. The amount of aspiration can be adjusted to 5 μl less than the total volume for aspiration;

3.6 Keep the centrifuge tube on the magnetic stand, add 200 μl of 80% ethanol in volume concentration, and incubate at room temperature for 30 secs. Aspirate and discard all the supernatant;

3.7. Repeat step 3.6 once (there are two 80% ethanol washings);

3.8. Absorb the remaining solution with a thin straw;

3.9, dry the centrifuge tube at room temperature for 10mins;

3.10. Remove the centrifuge tube from the magnetic base, add 20 μl Resuspension buffer, and blow at least 10 times to fully mix;

3.11 Incubate at room temperature for 2mins;

3.12 Place the 3.11 centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear;

3.13. Aspirate 17.5 μl of the supernatant into a new centrifuge tube for storage.

Third, the second PCR:

1. Multiplex PCR system (multiplex PCR in TRB region):

ingredient	volume
Qiagen Multiplex PCR 2 × MM	25μl
TRBV working primer	5μl
overhang working primer	2.5
100ng DNA + ddH2O	17.5 μl
Total	50μl

Multiplex PCR system (multiplex PCR in Igh and V regions):

ingredient	volume
Qiagen Multiplex PCR 2 × MM	25μl
IghJ working primer	5μl
overhang working primer	2.5
100ng DNA + ddH2O	17.5 μl
Total	50μl

2. Multiplex PCR program:

3. The second magnetic bead purification and size selection:

3.1. Pre-operation: AMPure XP should be warmed to room temperature before use and divided into tubes for use; 80% alcohol by volume should be prepared freshly; Purify uses 1.5ml centrifuge tubes or 96-well plates with 200μl or more.

3.2. Mix AMPure XPBeads and the second PCR product (36μl AMPureBeads + 40μl PCR product) in a volume of 0.9: 1, and mix by blowing at least 10 times.

3.3 Incubate at room temperature for 10mins.

3.4 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.5. Transfer 70 μl of the supernatant to a new centrifuge tube.

3.6. Mix AMPure XP Beads and the supernatant obtained in the previous step (70 μl AMPure Beads + 70 μl supernatant) in a volume of 1: 1, and pipette at least 10 times to fully mix.

3.7 Incubate at room temperature for 10mins.

3.8 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.9 Aspirate the supernatant and discard. Be careful not to suck the magnetic beads. The amount of aspiration can be adjusted to 5 μl less than the total volume for aspiration.

3.10. Keep the centrifuge tube on the magnetic base, add 200 μl of 80% ethanol in volume concentration, and incubate at room temperature for 30secs. Aspirate and discard all the supernatant.

3.11. Repeat step 3.10 once (there are two washings with a volume concentration of 80% ethanol).

3.12. Remove the residual solution with a thin pipette.

3.13 Dry the centrifuge tube at room temperature for 10mins.

3.14. Remove the centrifuge tube from the magnetic base, add 17.5 μl Resuspension buffer, and blow at least 10 times to mix thoroughly.

3.15. Incubate at room temperature for 2mins.

3.16. Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.17. Aspirate 15 μl of the supernatant into a new PCR tube for storage.

Fourth, the third PCR:

1. Preparation of library PCR system (TRB library):

ingredient	volume
Phusion 2 × MM	25μl
Sequencing Primer 1	5μl
Sequencing Primer 2	5μl
100ng First elution DNA + ddH2O	15μl
Total	50μl

Preparation of library PCR system (Igh library)

ingredient	volume
Phusion 2 × MM	25μl
Sequencing Primer 1	5μl
Sequencing Primer 2	5μl
100ng First elution DNA + ddH2O	15μl
Total	50μl

Among them, sequencing primer 1 includes a nucleotide sequence that specifically recognizes the first linker (SEQ ID NO: 86) and sequencing linker A; sequencing primer 2 includes a nucleotide sequence that specifically recognizes the second linker (SEQ ID NO: 87) and Sequencing adapter B, Sequencing adapter A and Sequencing adapter B are primers for illumina sequencer.

2. Library PCR program:

3. The third magnetic bead purification:

3.1. Pre-operation: AMPure XP is warmed to room temperature before use, and aliquoted into a centrifuge tube; 80% alcohol by volume must be freshly prepared; Purify uses a 1.5ml centrifuge tube or a 96-well plate with 200μl or more.

3.2. Mix AMPure XP Beads and the third PCR product (50 μl AMPure Beads + 50 μl third PCR product) in a volume of 1: 1, and blow at least 10 times to mix thoroughly.

3.3 Incubate at room temperature for 10mins.

3.4 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.5. Aspirate the supernatant and discard. Be careful not to suck the magnetic beads. The amount of pipette can be adjusted to 5μl less than the total volume for pipetting.

3.6. Keep the centrifuge tube on the magnetic base, add 200 μl of 80% ethanol in volume concentration, and incubate at room temperature for 30 secs. Aspirate and discard all the supernatant.

3.7. Repeat step 3.6 once (there are two washings with a volume concentration of 80% ethanol).

3.8. Absorb the remaining solution with a thin pipette.

3.9. Dry the centrifuge tube at room temperature for 10mins.

3.10. Remove the centrifuge tube from the magnetic base, add 22.5 μl Resuspension buffer, and blow at least 10 times to mix thoroughly.

3.11 Incubate at room temperature for 2mins.

3.12 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.13. Aspirate 20 μl of the supernatant into a new centrifuge tube for storage.

Comparative example

I. Primer preparation

The primers of the comparative example had 52 TRBV, 13 TRBJ, 14 IgHV, 6 IgHJ, all of which were reconstituted to 100 μM as stock primer (storage primer). As shown in Table 1, 52 TRBVs were each diluted by 1 μl into 48 μl ddH ₂ O to prepare 100 μl TRBV working primers; as shown in Table 6, 13 TRBJs were each diluted by 3 μl and diluted to 11 μl ddH ₂ O, and prepared into 50 μl. TRBJ working primers; as shown in Table 3, 14 IgHVs were each diluted to 36 μl ddH ₂ O to prepare 50 μl IgHV working primers; as shown in Table 7, 6 IgHJs were each diluted to 3 μl to 32 μl ddH ₂ O , Formulated into 50μl IghJ working primer.

Table 6 TRBJ working primers

Primer name	Sequence (5’-3 ’)
TRBJ1-1	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCTACAACTGTGAGTCTGGTGCCTTGTCCAAA
TRBJ1-2	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTACAACGGTTAACCTGGTCCCCGAACCGAA
TRBJ1-3	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTACAACAGTGAGCCAACTTCCCTCTCCAAA
TRBJ1-4	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCAAGACAGAGAGCTGGGTTCCACTGCCAAA
TRBJ1-5	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTAGGATGGAGAGTCGAGTCCCATCACCAAA
TRBJ1-6	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGTCACAGTGAGCCTGGTCCCGTTCCCAAA
TRBJ2-1	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGGTGAGCCGTGTCCCTGGCCCGAA
TRBJ2-2	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCAGTACGGTCAGCCTAGAGCCTTCTCCAAA
TRBJ2-3	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTGTCAGCCGGGTGCCTGGGCCAAA
TRBJ2-4	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGAGCCGGGTCCCGGCGCCGAA
TRBJ2-5	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGAGCCGCGTGCCTGGCCCGAA
TRBJ2-6	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTCAGCCTGCTGCCGGCCCCGAA
TRBJ2-7	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTGAGCCTGGTGCCCGGCCCGAA

Table 7 IghJ working primers

IgHJ1	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGTGCTGGAAGTATTCAGC
IgHJ2	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGAGATCGAAGTACCAGTAG
IgHJ3	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCCAGATATCAAAAGCATC
IgHJ4	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGCCCCAGTAGTCAAAGTAG
IgHJ5	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCAGGGGTCGAACCAGTTG
IgHJ6	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCAGACGTCCATGTAGTAG

Second, the first PCR:

1. Multiplex PCR system preparation (J-V region of TRB):

ingredient	volume
Qiagen Multiplex PCR 2xMM	25μl
TRBV working primer	5μl

TRBJ working primers	2.5
100ng DNA + ddH 2 O	17.5 μl
Total	50μl

Multiplex PCR system preparation (Igh's J-V region):

ingredient	volume
Qiagen Multiplex PCR 2xMM	25μl
IghV working primer	5μl
IghJ working primer	2.5
100ng DNA + ddH 2 O	17.5 μl
Total	50μl

2. Multiplex PCR program:

3. The first magnetic bead purification and size selection:

3.1. Pre-operation: AMPure XP is warmed to room temperature before use, and aliquoted into a centrifuge tube; 80% alcohol by volume must be freshly prepared; Purify uses a 1.5ml centrifuge tube or a 96-well plate with 200μl or more.

3.2. Mix AMPure XP Beads and the multiplex PCR product from step 2 (36 μl AMPure Beads + 40 μl multiplex PCR product) in a volume of 0.9: 1, and mix by pipetting at least 10 times.

3.3 Incubate at room temperature for 10mins.

3.4 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.5. Transfer 70 μl of the supernatant to a new centrifuge tube. Do not discard the supernatant.

3.6. Mix AMPure XP Beads and the supernatant obtained in the previous step (70 μl AMPure Beads + 70 μl supernatant) in a volume of 1: 1, and pipette at least 10 times to mix thoroughly.

3.7 Incubate at room temperature for 10mins.

3.8 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.9 Aspirate the supernatant and discard. Be careful not to suck the magnetic beads. The amount of aspiration can be adjusted to 5 μl less than the total volume for aspiration.

3.10. Keep the centrifuge tube on the magnetic base, add 200 μl of 80% ethanol in volume concentration, and incubate at room temperature for 30secs. Aspirate and discard all the supernatant.

3.11. Repeat step 3.10 once (there are two washings with a volume concentration of 80% ethanol).

3.12. Remove the residual solution with a thin pipette.

3.13. Air dry the centrifuge tube for 10mins.

3.14. Remove the centrifuge tube from the magnetic base, add 17.5 μl Resuspension buffer, and blow at least 10 times to mix thoroughly.

3.15. Incubate at room temperature for 2mins.

3.16. Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.17. Aspirate 15 μl of the supernatant into a new PCR tube for storage.

Third, the second PCR:

1. Preparation of library PCR system:

ingredient	volume
Phusion 2 × MM	25μl
Sequencing Primer 1	5μl
Sequencing Primer 3	5μl
100ng First elution DNA + ddH2O	15μl
Total	50μl

Among them, sequencing primer 1 includes a nucleotide sequence that specifically recognizes the first linker (SEQ ID NO: 86) and sequencing linker A; sequencing primer 3 includes a nucleotide sequence that specifically recognizes GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG and sequencing linker B, sequencing The adaptor A and the adaptor B for sequencing are primers for the illumina sequencer.

2. Library PCR program:

3. The second magnetic bead purification:

3.1. Pre-operation: AMPure XP is warmed to room temperature before use, and aliquoted into a centrifuge tube; 80% alcohol by volume must be freshly prepared; Purify uses a 1.5ml centrifuge tube or a 96-well plate with 200μl or more.

3.2. Mix AMPure XPBeads and the second PCR product (50μl AMPureBeads + 50μl second PCR product) in a volume of 1: 1, and blow at least 10 times to mix thoroughly.

3.3 Incubate at room temperature for 10mins.

3.4 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.5. Aspirate the supernatant and discard. Be careful not to suck the magnetic beads. The amount of pipette can be adjusted to 5μl less than the total volume for pipetting.

3.6. Keep the centrifuge tube on the magnetic base, add 200 μl of 80% ethanol in volume concentration, and incubate at room temperature for 30 secs. Aspirate and discard all the supernatant.

3.7 Repeat step 3.6 once (there are two washings with a volume concentration of 80% ethanol)

3.8. Absorb the remaining solution with a thin pipette.

3.9. Dry the centrifuge tube at room temperature for 10mins.

3.10. Remove the centrifuge tube from the magnetic base, add 22.5 μl Resuspension buffer, and blow at least 10 times to mix thoroughly.

3.11 Incubate at room temperature for 2mins.

3.12 Place the centrifuge tube on the magnetic stand for 2mins or wait until the liquid is clear.

3.13. Aspirate 20 μl of the supernatant into a new centrifuge tube for storage.

According to the above experimental procedure, three samples were taken in the same individual, and the DNA extracted from each sample was divided into two parts, one for the library construction (TRB and Igh) for the protocol of Example 1, and the other for For the library of the comparative scheme, sequencing, analysis, and screening were performed, and the comparative analysis was performed through the reads with quality requirements, and the data of 3 samples were analyzed. Please refer to FIG. 2. When performing sequencing, multiple PCRs are performed on the variable region library to introduce different PCR errors. Compared with the comparative example, Example 1 adds a proofreading random segment to the variable region library, which is beneficial for sequencing analysis. Correcting PCR errors at time will ensure that subsequent sequencing results can be biased by proofreading random segments, greatly improving the accuracy of variable region library sequencing, and randomly selecting 2M reads for unique clone number analysis. The three results were averaged and the coefficient of variation. It can be seen from FIG. 3 that the 2M sequencing Reads on the left side of the abscissa of FIG. 3 is the data of the number of TCR clones performed after the comparative library is built, and the 2M sequencing Reads + random barcode on the right side is the TCR clone of the library built in the TRB VJ area of Example 1 The coefficient of variation of the number of data is shown in FIG. 3. The coefficient of variation of the number of TCR clones in the comparative example is 24.8%, and the coefficient of variation of the number of TCR clones in Example 1 is 3.9%, which illustrates the results produced by the scheme of Example 1. It is relatively stable. The average number of TCR clones in the comparative example is 46,906 unique clones, and the average number of TCR clones in Example 1 is 65,741 unique clones, indicating that the unique clones generated in Example 1 are more abundant. However, the results produced by the comparative example scheme fluctuated greatly, and the number of unique clones produced at the same time was relatively small.

It can be seen from FIG. 4 that the 2M sequencing Reads on the left side of the abscissa of FIG. 4 is the data of the number of BCR clones performed after the comparative library is built, and the 2M sequencing Reads + random barcode on the right is the BCR clone of the library built in the IgH VJ area of Example 1. From the coefficient of variation shown in Figure 4, the coefficient of variation of the number of BCR clones in the comparative example is 32.7%, and the coefficient of variation of the number of BCR clones in Example 1 is 3.7%, indicating that the results produced by the solution of Example 1 are relatively stable. The average number of BCR clones in the comparative example is 55,861 unique clones, and the number of BCR clones in Example 1 is 76,370 unique clones, indicating that the unique clones generated in Example 1 are more abundant. However, the results produced by the comparative example scheme have relatively large fluctuations and relatively few unique clones.

The above is only a preferred embodiment of the present invention. It should be noted that, for those of ordinary skill in the art, without departing from the principle of the present invention, a number of improvements and retouches can be made. These improvements and retouches also It should be regarded as the protection scope of the present invention.

Claims (21)

1. A method for constructing a variable region sequence library includes the following steps:

   Step 1: Obtain a DNA sample containing a variable region;

   Step 2: Use the DNA sample as a template to extend a DNA sequence encoding the variable region through a first primer group to obtain a first amplification product library, wherein the first primer group includes a specific recognition region for the J region. First primers of all subtype coding sequences, the first primers include a nucleotide sequence that specifically recognizes the coding sequence of the J region, a proofreading random segment, and a first linker, and the code that specifically recognizes the J region The nucleotide sequence of the sequence, the proofreading random segment and the first linker are sequentially connected, and the sequences of the proofreading random segment of the first primer group are different from each other;

   Step 3: Using the first amplification product library as a template, a DNA sequence encoding the variable region is amplified by primers of a second primer group and a first adapter to obtain a variable region sequence combination product, wherein the The second primer group includes a second primer that specifically recognizes coding sequences of all subtypes of the V region; the second primer includes a nucleotide sequence and a second linker that specifically recognizes coding sequences of the V region, and the The nucleotide sequence that specifically recognizes the coding sequence of the V region and the second linker are connected to each other; the primers of the first linker include a nucleotide sequence that specifically recognizes the first linker.
2. The method for constructing a variable region sequence library according to claim 1, further comprising step four, which specifically comprises: using the combination product of the variable region sequence as a template, passing a first sequencing adapter and a second A sequencing adapter amplifies a DNA sequence encoding the variable region to obtain a variable region sequence library, wherein the first sequencing adapter includes a nucleotide sequence that specifically recognizes the first adapter and a sequencing adapter A; The second sequencing linker includes a nucleotide sequence that specifically recognizes the second linker and a linker B for sequencing.
3. The method for constructing a variable region sequence library according to claim 1 or 2, wherein the sequence length of the proofreading random segment is 8-20 nucleotides.
4. The method for constructing a variable region sequence library according to any one of claims 1 to 3, wherein the sequence length of the proofreading random segment is 8-10 nucleotides.
5. The method for constructing a variable region sequence library according to any one of claims 1 to 4, wherein the sequences of a plurality of the first linkers are identical to each other.
6. The method for constructing a variable region sequence library according to any one of claims 1 to 5, wherein the extension specifically comprises: denaturation 98 ° C, 40s; extension 60 ° C, 2min; final extension 72 ° C, 2min; 1 cycle.
7. The method for constructing a variable region sequence library according to any one of claims 1 to 6, wherein the amplification in step 3 is multiplex PCR.
8. The method for constructing a variable region sequence library according to claim 7, wherein the multiplex PCR specifically comprises: pre-denaturation 95 ° C, 15s; denaturation 94 ° C, 40s; annealing 60 ° C, 4min; extension 72 ° C, 90s; final extension 72 ° C, 10s; 35 cycles.
9. The method for constructing a variable region sequence library according to any one of claims 1 to 8, wherein the variable region sequence is a variable region sequence of a B cell receptor or a T cell receptor.
10. The method for constructing a variable region sequence library according to any one of claims 1 to 9, wherein the DNA sample containing the variable region encoding is a whole genomic DNA extracted from animal peripheral blood.
11. The method for constructing a variable region sequence library according to any one of claims 1 to 10, wherein the sequences of the proofreading random segments of the first primer group do not generate primer dimers with each other.
12. A kit for constructing a variable region sequence library, comprising the following primers: a first primer group, a primer for a first linker, and a second primer group;

    Wherein, the first primer group includes first primers that specifically recognize coding sequences of all subtypes of the J region;

    The first primer includes a nucleotide sequence that specifically recognizes the coding sequence of the J region, a proofreading random segment, and a first linker, and the nucleotide sequence that specifically recognizes the coding sequence of the J region, and the proofreading random segment. Connected to the first link in sequence, and the sequences of the proofreading random segments of the first primer group are different from each other;

    The second primer group includes second primers that specifically recognize coding sequences of all subtypes of the V region;

    The second primer includes a nucleotide sequence that specifically recognizes the coding sequence of the V region and a second adapter, and the nucleotide sequence that specifically recognizes the coding sequence of the V region and the second linker are connected to each other;

    The primer of the first linker includes a nucleotide sequence that specifically recognizes the first linker.
13. The kit for constructing a variable region sequence library according to claim 12, wherein the DNA sample encoding the variable region is a sequence of a T cell receptor, and the first primer group includes SEQ ID NO: 1-13 Nucleotide sequence shown.
14. The kit for constructing a variable region sequence library according to claim 12 or 13, wherein the DNA sample encoding the variable region is a sequence of a T cell receptor, and the second primer group includes SEQ ID NO: 14 The nucleotide sequence shown at -65.
15. The kit for constructing a variable region sequence library according to any one of claims 12 to 14, wherein the DNA sample encoding the variable region is a sequence of a B cell receptor, and the first primer group includes SEQ ID NO: 66-71 nucleotide sequence.
16. The kit for constructing a variable region sequence library according to any one of claims 12 to 15, wherein the DNA sample encoding the variable region is a sequence of a B cell receptor, and the second primer group includes SEQ ID NO: 72-85 nucleotide sequence.
17. The kit for constructing a variable region sequence library according to any one of claims 12 to 16, wherein the first linker is a nucleotide sequence represented by SEQ ID NO: 86.
18. The kit for constructing a variable region sequence library according to any one of claims 12 to 17, wherein the second linker is a nucleotide sequence represented by SEQ ID NO: 87.
19. The kit for constructing a variable region sequence library according to any one of claims 12 to 18, further comprising a first sequencing adapter and a second sequencing adapter;

    Wherein, the first sequencing adapter includes a nucleotide sequence that specifically recognizes the first adapter and sequencing adapter A; the second sequencing adapter includes a nucleotide sequence that specifically recognizes the second adapter and sequencing Use connector B.
20. The kit for constructing a variable region sequence library according to claim 19, wherein the sequencing adapter A and the sequencing adapter B are special primers of a second-generation sequencer or a third-generation sequencer.
21. A method for sequencing a variable region sequence, comprising the method according to any one of claims 1 to 11 or the reagent for constructing a variable region sequence library according to any one of claims 12 to 20 Cassette to construct a variable region sequence library;

    And, performing high-throughput sequencing on the variable region sequencing library to obtain a variable region sequence.

Images