CN109415768B - Variable region sequence library construction method, sequencing method and kit thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a variable region sequence library construction method, a sequencing method and a kit thereof. The invention discloses a method for constructing a variable region sequence library, which comprises the following steps: step one, obtaining a DNA sample containing a coding variable region; step two, using the DNA sample as a template, amplifying the DNA sequence coding the variable region through a first primer group to obtain a first amplification product library; and step three, amplifying the DNA sequence coding the variable region by using the first amplification product library as a template through a second primer group and a primer of the first joint to obtain a variable region sequence combination product. The invention is used for solving the technical defects of low amplification efficiency, bias amplification and easy loss of sequence information of the variable region sequence library in the prior art for constructing the variable region sequence library of TCR or BCR.

Description

Variable region sequence library construction method, sequencing method and kit thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a variable region sequence library construction method, a sequencing method and a kit thereof. This application claims the benefit of PCT (international application number PCT/CN2018/088989) filed on 30/5/2018, which is hereby incorporated by reference in its entirety.

Background

The immunity is an extremely important self-defense function of human bodies, various diseases with huge varieties can be resisted by means of the immunity of the human bodies, and almost all the diseases in the human bodies are closely related to the immunity. The immune cells in the human microenvironment responsible for defending the body mainly comprise T cells, B cells, macrophages, dendritic cells and the like, and the professional immune cells have unique structures and functions and contain unique immune cell subsets and functional molecules. T cells and B cells are the main lymphocytes of the human body and are responsible for cellular immunity and humoral immunity, respectively, and the deep understanding of the composition of T cells and B cells is helpful for understanding, preventing and treating diseases. The T Cell Receptor (TCR) and the B Cell Receptor (BCR) are composed of a plurality of peptide chains, have antigen binding specificity, the amino acid composition and the arrangement sequence of the complementary determining region (also called hypervariable region) of each peptide chain present high diversity to form a TCR library and a BCR library with huge capacity, and research shows that the more subtypes, the more effective the resisting against the invasion of pathogens such as bacteria and viruses, and the less subtypes, the more easily infected diseases. In addition, age, environment, disease-inducing factors, and medication also affect the diversity of immune cells. Thus, the immunohistochemical library sequencing (IR-SEQ for short) technique has been developed: it is used for deeply digging immune repertoire and disease association by amplifying CDR region by multiplex PCR or 5' RACE technology, combining high-throughput sequencing, specially researching immune diversity of complementarity determining region of TCR and BCR from DNA or RNA level.

At present, immune diversity detection of TCR and BCR complementary determining regions is carried out from a DNA level, mainly by utilizing V genes and J gene segments which form CDR regions of TCR and BCR to carry out primer design and carry out amplification of the CDR regions, then joints are added to the amplification products of the V genes and the J gene segments, and the detection of the diversity of TCR and BCR is carried out in second-generation sequencing. In another part of research, immune diversity detection of complementary determining regions of TCR and BCR is carried out from RNA level, mainly, the terminal C region of CDR region of TCR and BCR is utilized to carry out reverse transcription reaction, extends to the V region end of CDR region, then the product is amplified, and secondary sequencing is carried out to analyze diversity of TCR and BCR.

However, the existing technology for detecting diversity of TCR and BCR still has the following problems that firstly, the CDR regions of TCR and BCR are amplified by multiplex PCR using DNA, and the main problems are that firstly, V and J at two ends of CDR regions are very diverse, and a primer set required at each end is from several primers to dozens of primers, depending on the design of primers. The primer set sets in the kit amplify, because of the large number of primers in the primer set at both ends, primer mismatching on the template is easy to occur, the amplification efficiency is relatively low, and once a main amplicon is formed, amplification bias is easy to cause. On the other hand, due to the nature of the second-generation sequencing, errors are easily introduced in the sequencing process, but the current multiplex PCR scheme cannot perform correction analysis, and great deviation is often brought to detection of diversity. Secondly, the amplification of CDR regions of TCR and BCR by reverse transcription PCR using RNA also has some problems, the processing difficulty of RNA samples is more difficult than that of DNA samples, and the RNA samples are unstable and easy to degrade, and the diversity information is more easily lost in the sample processing link. Meanwhile, some reverse transcription schemes in the prior art need to perform linker conversion in the last extension link, but the conversion rate of the prior linker conversion technology is low, if linker conversion cannot be performed successfully, part of information is lost in the subsequent links, and the diversity result has large deviation. In addition, since each T cell or B cell corresponds to a specific TCR or BCR, and there is a possibility that a large number of transcripts may be transcribed in one cell, the correspondence of each T cell or B cell to a specific TCR or BCR cannot be realized.

In summary, the technical solution for developing a variable region sequence library with high efficiency amplification, no bias, accurate analysis result and capability of comprehensively constructing TCR or BCR is a technical problem to be solved by those skilled in the art.

Disclosure of Invention

In view of this, the invention discloses a variable region sequence library construction method, a sequencing method and a kit thereof, which can effectively overcome the technical defects of low amplification efficiency, bias in amplification and easy loss of variable region sequence library sequence information in the existing variable region sequence library technology for constructing TCR or BCR.

The invention provides a construction method of a variable region sequence library and a sequencing method of a variable region sequence, which comprises the following steps:

step one, obtaining a DNA sample containing a coding variable region;

step two, using the DNA sample as a template, extending a DNA sequence coding the variable region through a first primer group to obtain a first amplification product library, wherein the first primer group comprises a first primer specifically recognizing all subtypes of coding sequences of the J region, the first primer comprises a nucleotide sequence specifically recognizing the coding sequences of the J region, a proofreading random section and a first joint, the nucleotide sequence of the coding sequences of the J region, the proofreading random section and the first joint are sequentially connected, and the sequences of the proofreading random sections of the first primer group are different from each other;

step three, using the first amplification product library as a template, amplifying the DNA sequence coding for the variable region by using a second primer group and a primer of the first joint to obtain a variable region sequence combination product, wherein the second primer group comprises a second primer which specifically recognizes the coding sequence of all subtypes of the V region; the second primer comprises a nucleotide sequence specifically recognizing the coding sequence of the V region and a second linker, and the nucleotide sequence specifically recognizing the coding sequence of the V region and the second linker are connected with each other; the primer of the first linker comprises a nucleotide sequence that specifically recognizes the first linker.

Wherein the first primer group comprises a plurality of first primers with different sequences, the sequences of the proofreading random sections of each first primer are different from each other, each first primer comprises a sequence of a coding sequence for specifically recognizing one subtype of the J region, the first primer group comprises sequences of coding sequences for specifically recognizing all subtypes of the J region, for example, the first primer A comprises a sequence of a coding sequence for specifically recognizing a subtype of the J region A, the first primer B comprises a sequence of a coding sequence for specifically recognizing a subtype of the J region B, and the like, and the first primer group comprises primers of the first primer A, the first primer B and the like; the second primer group comprises a plurality of second primers with different sequences, each second primer comprises a sequence of a coding sequence which specifically recognizes one subtype of the V region, the second primer group comprises a sequence of a coding sequence which specifically recognizes all subtypes of the V region, for example, the second primer A comprises a sequence of a coding sequence which specifically recognizes a subtype of the V region A, the second primer B comprises a sequence of a coding sequence which specifically recognizes a subtype of the V region B, and the like, and the second primer group comprises primers of the second primer A, the second primer B and the like.

Wherein the first linker and the second linker are sequences used for constructing a library, and the constructed library comprises a sequencing library or a gene library.

Wherein the nucleotide sequence of the coding sequence specifically recognizing the V region and the second linker are linked to each other.

Wherein the coding sequence of the J region is the sequence of all subtypes of J region of the receptor coding gene of the B cell receptor or the T cell receptor, therefore, the first primer group comprises the nucleotide sequence of the coding sequence of the J region which specifically recognizes all subtypes of the B cell receptor or the T cell receptor, and the sequence of the nucleotide sequence of the coding sequence of the J region which specifically recognizes each of the first primers is different from each other because the coding sequences of the J regions of all subtypes of the B cell receptor or the T cell receptor are different from each other.

Wherein the coding sequence of the V region is the sequence of all subtypes of the V segment of the receptor coding gene of the B cell receptor or the T cell receptor, therefore, the second primer group comprises the nucleotide sequence of the coding sequence of the V region which specifically recognizes all subtypes of the B cell receptor or the T cell receptor, and since the coding sequences of the V regions of all subtypes of the B cell receptor or the T cell receptor are different, the sequence of the nucleotide sequence of the coding sequence of the specific recognition J region of each of the first primers is different from each other.

Preferably, the method further comprises a fourth step, wherein the fourth step specifically comprises the following steps: amplifying DNA sequences encoding the variable regions by using the variable region sequence combination product as a template through a first sequencing joint and a second sequencing joint to obtain a variable region sequence library, wherein the first sequencing joint comprises a nucleotide sequence specifically recognizing the first joint and a joint A for sequencing; the second sequencing joint comprises a nucleotide sequence specifically recognizing the second joint and a sequencing joint B, and the aim of the fourth step is to provide a sequencing joint required for high-throughput sequencing of the variable region sequence combination product.

Preferably, the sequence length of the proof reading random stretch is 8-20 nucleotides.

Preferably, the sequence length of the proof reading random stretch is 8-10 nucleotides.

Wherein, the sequence length of the proofreading random section is 8-10 nucleotides, the identification efficiency of the first primer group annealing is improved, the efficient extension is facilitated, and the yield of the product is improved.

Preferably, a plurality of the first linkers have the same sequence.

The amplification in the third step is multiplex PCR, and the multiplex PCR specifically comprises: pre-denaturation at 95 ℃ for 15 s; denaturation at 94 ℃ for 40 s; annealing at 60 deg.C for 4 min; extension at 72 ℃ for 90 s; final extension 72 ℃ for 10 s; 35 cycles.

The DNA sample is used as a template, the first primer group is used for carrying out single primer extension technology to encode the DNA sequence of the variable region, a first amplification product library is obtained, the single primer extension technology can effectively process the DNA sample, the inconvenience of RNA sample processing (the efficiency of adding a joint is low during RNA reverse transcription) is avoided, and compared with the RNA needing a conversion joint, the efficiency is also improved. After obtaining single primer extension, the multiplex PCR of step three requires only one end to perform multiplex PCR using the first adapter primer, and the efficiency of multiplex PCR is also improved.

Preferably, the variable region sequence is a variable region sequence of a B cell receptor or a T cell receptor.

Preferably, the DNA sample containing the coding variable region is whole genome DNA extracted from peripheral blood of the animal.

Preferably, the sequences of the proofreading random fragments of the first primer group do not generate primer dimers from each other, thereby improving the efficiency of introducing the proofreading random fragments.

The invention also provides a kit for constructing the variable region sequence library, which comprises the following primers: a first primer group, a first adapter primer, and a second primer group;

wherein the first primer group comprises first primers that specifically recognize coding sequences of all subtypes of the J region;

the first primer comprises a nucleotide sequence of a coding sequence of a specific recognition J region, a proofreading random section and a first joint, the nucleotide sequence of the coding sequence of the specific recognition J region, the proofreading random section and the first joint are sequentially connected, and the sequences of the proofreading random sections of the first primer group are different from each other;

the second primer group comprises second primers that specifically recognize coding sequences of all subtypes of the V region;

the second primer comprises a nucleotide sequence specifically recognizing the coding sequence of the V region and a second linker, and the nucleotide sequence specifically recognizing the coding sequence of the V region and the second linker are connected with each other;

the primer of the first linker comprises a nucleotide sequence that specifically recognizes the first linker.

Preferably, the DNA sample encoding the variable region is a sequence of a T cell receptor, and the first primer set comprises SEQ ID NO: 1-13.

Preferably, the DNA sample encoding the variable region is a sequence of a T cell receptor, and the second primer group comprises SEQ ID NO: 14-65.

Preferably, the DNA sample encoding the variable region is a sequence of a B cell receptor, and the first primer set comprises SEQ ID NO: 66-71.

Preferably, the DNA sample encoding the variable region is a sequence of a B cell receptor, and the second primer set comprises SEQ ID NO: 72-85.

Preferably, the first linker is SEQ ID NO: 86.

Preferably, the second linker is SEQ ID NO: 87, SEQ ID NO: 87 has the sequence: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG are provided.

The kit for constructing the variable region sequence library further comprises a first sequencing joint and a second sequencing joint;

wherein the first sequencing linker comprises a nucleotide sequence that specifically recognizes the first linker and a sequencing linker A; the second sequencing linker comprises a nucleotide sequence specifically recognizing the second linker and a sequencing linker B.

Preferably, the sequencing adaptor A and the sequencing adaptor B are special primers for a second-generation sequencer or a third-generation sequencer.

The invention also provides a kit for constructing the variable region sequence library, which comprises: SEQ ID NO: 1-SEQ ID NO: 87 and PCR amplification reagents.

Wherein, the PCR amplification reagent comprises enzymes, NTPs, Buffer and Buffer which are commonly used in PCR.

The invention also discloses a sequencing method of the variable region sequence, which comprises the steps of constructing a variable region sequence library by the method or the kit for constructing the variable region sequence library; and performing high-throughput sequencing on the variable region sequencing library to obtain a variable region sequence.

Optionally, the high throughput sequencing is performed using at least one selected from Hiseq, Miseq, 454, SOLiD, Ion Torrent, and CG sequencing platforms, depending on the sequence of the adapter primer, and the adapter primer of the embodiments of the invention is an illumina sequencing primer.

Wherein the proofreading random section specifically comprises a randomly synthesized DNA sequence.

The invention also discloses application of the construction method of the variable region sequence library in the library establishment method of the precise analysis of TCR/BCR.

The invention aims at overcoming the defects of the prior technology for constructing a TCR or BCR variable region sequence library by using DNA and RNA, and discloses a method for constructing a variable region sequence library, which comprises the following three steps: step one, obtaining a DNA sample containing a coding variable region; step two, using the DNA sample as a template, extending the DNA sequence coding the variable region through a first primer group to obtain a first amplification product library, wherein the first primer group comprises a plurality of first primers with different sequences, the first primers comprise nucleotide sequences of coding sequences of specific recognition J regions, proofreading random sections and first joints, the nucleotide sequences of the coding sequences of the specific recognition J regions, the proofreading random sections and the first joints are sequentially connected, the sequences of the proofreading random sections of each first primer are different from each other, the nucleotide sequence of the coding sequence of each specific recognition J region comprises a sequence of coding sequences of specific recognition J regions of one subtype, and the first primer group comprises sequences of coding sequences of specific recognition J regions of all subtypes; and step three, amplifying the DNA sequence coding the variable region by using the first amplification product library as a template through a second primer group and a primer of a first joint to obtain a variable region sequence combination product, wherein the second primer group comprises a plurality of second primers with different sequences, the second primers comprise nucleotide sequences specifically recognizing the coding sequences of the V regions and the second joint, the primer of the first joint comprises nucleotide sequences specifically recognizing the first joint, the nucleotide sequence of each coding sequence of the specifically recognizing V regions comprises a sequence specifically recognizing the coding sequence of one subtype of the V region, and the second primer group comprises sequences specifically recognizing the coding sequences of all subtypes of the V regions. The proofreading random section is equivalent to a random barcode, and is added into a DNA sample in the second step by extension, high-throughput sequencing is needed after a variable region library is constructed to obtain a complete sequence of the variable region library, in the process, a variable region sequence combination product is subjected to multiple PCR (polymerase chain reaction) during sequencing, so that different PCR errors are introduced, the proofreading random section is added into the DNA sample, and each template is provided with a unique random section, namely, the random sections are in one-to-one correspondence, and in the PCR process, the random sections and the connected PCR sections are amplified simultaneously to obtain a large number of amplicons. When a part of PCR fragments exist in a large amount of amplification under the condition that mutation introduced by PCR errors exists, due to the one-to-one correspondence relationship, other correct PCR products identified by the same random fragment can be used for comparing, and the mutation products are compared (the correct PCR products are determined to be more correct when the correct rate is more than 50%); meanwhile, because the introduction of the proofreading random section leads each template to be provided with a unique proofreading random section, when the data quantity of a fixed number of the proofreading random sections is determined to carry out the comparison between samples, in the detection of the immune cell receptor polymorphism, the polymorphism evaluation and the individual polymorphism comparison can be better realized only by the comparison under the same effective data, therefore, the method of the invention can realize the comparison between different samples. In addition, in step three, the DNA sequence encoding the variable region is amplified by the second primer and the primer of the first linker, the primer of the first linker is a single primer, and the second primer group comprises the nucleotide sequence specifically recognizing the coding sequence of the V region and the second linker, so that the amplification efficiency in step three and the yield of the variable region sequence combination product can be ensured by performing multiplex PCR with 1 pair. In addition, the invention selects DNA samples to realize the one-to-one correspondence of each T cell or B cell to a specific TCR or BCR, which is favorable for comprehensively evaluating the diversity of the TCR or BCR of the organism.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a schematic flow chart showing a method for constructing a variable region sequence library according to the present invention;

FIG. 2 is a schematic diagram illustrating a biasing process of the corrected random section of the present invention;

FIG. 3 shows a TCR unique clone number analysis of example 1 provided by the invention;

FIG. 4 shows BCR unique clone number analysis of example 1 provided by the present invention;

the kit comprises a DNA sample 1 for coding a variable region, a coding sequence 11 of a J region, a coding sequence 12 of a V region, a first joint 2, a proofreading random section 3, a nucleotide sequence 4 for specifically recognizing the coding sequence of the J region, a first amplification product library 5, a second joint 6, a nucleotide sequence 7 for specifically recognizing the coding sequence of the V region, a variable region sequence combination product 8, a primer 9 of the first joint, a second sequencing joint 10, a variable region sequence library 11 and a first sequencing joint 12.

Detailed Description

The invention provides a kit for constructing a variable region sequence library and a method for constructing the variable region sequence library, which are used for solving the technical defects of low amplification efficiency, bias in amplification and easy loss of sequence information of the variable region sequence library in the conventional technology for constructing the variable region sequence library of TCR or BCR.

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Referring to FIG. 1, the present invention discloses a method for constructing a variable region sequence library, comprising the following steps:

step one, obtaining a DNA sample 1 containing a coding variable region;

step two 101, using the DNA sample 1 as a template, extending the DNA sequence coding the variable region by a first primer group to obtain a first amplification product library 5, wherein the first primer group comprises a plurality of different first primers, the first primers comprise a nucleotide sequence 4 specifically identifying the coding sequence of the J region, a proofreading random section 3 and a first joint 2, the nucleotide sequence 4 specifically identifying the coding sequence of the J region, the proofreading random section 3 and the first joint 2 are sequentially connected, the sequences of the proofreading random sections 3 of each first primer are different from each other, the nucleotide sequence of the coding sequence of each specific identification J region comprises a sequence specifically identifying the coding sequence of a subtype J region, and the first primer group comprises sequences specifically identifying the coding sequences of all subtypes of the J regions;

and step three 102, amplifying the DNA sequence coding for the variable region by using a second primer group and a primer 9 of the first joint by using the first amplification product library as a template to obtain a variable region sequence combination product 8, wherein the second primer group comprises a plurality of second primers with different sequences, the second primers comprise a nucleotide sequence 7 and a second joint 6 which specifically recognize the coding sequence of the V region, the primer 9 of the first joint comprises a nucleotide sequence which specifically recognizes the first joint 2, the nucleotide sequence of each coding sequence which specifically recognizes the V region comprises a sequence which specifically recognizes the coding sequence of the V region of one subtype, and the second primer group comprises a sequence which specifically recognizes the coding sequence of the V region of all subtypes.

Further, the embodiment of the present invention further includes a fourth step 103, where the fourth step 103 specifically includes: amplifying a DNA sequence coding the variable region by a first sequencing joint 12 and a second sequencing joint 10 by using the variable region sequence combination product 8 as a template to obtain a variable region sequence library 11, wherein the first sequencing joint comprises a nucleotide sequence specifically recognizing the first joint and a joint A for sequencing; the second sequencing linker 10 comprises a nucleotide sequence that specifically recognizes the second linker and a sequencing linker B.

The raw materials used in the following examples are all commercially available or self-made.

Example 1

The embodiment of the invention provides a specific method for constructing a variable region sequence library, which comprises the following steps:

firstly, the method comprises the following steps: template preparation

1. Collecting 5-10ml of peripheral blood of a human body in an anticoagulation tube;

2. adding fresh blood into RBC lysine buffer with three times volume, and slightly turning over the centrifuge tube to mix the blood uniformly;

3. standing and reacting for 15 minutes at normal temperature;

4. centrifugation at 450Xg for 10min, the supernatant was carefully removed, leaving the pellet of cells;

5. if the pellet is obviously red, adding RBC lysis buffer with the volume twice of the original blood volume, and repeating the step 2 and the step 3;

6. suspending pellet evenly with 600. mu.l PBS, taking 200. mu.l and extracting DNA with TIANAmp Genomics DNA kit;

7. primer preparation:

7.1, Primer total 52 TRBV, 13 TRBJ random, 14 IgHV, 6 IgHJ random, 1 overlap, all with 100 μ M of resolubilization as stock Primer (storage Primer).

7.2 As shown in Table 1, 1. mu.l of each of the 52 TRBV strips was diluted to 48. mu.l of ddH₂And O, preparing 100 mu l of TRBV working primer, wherein the second primer is the TRBV working primer and comprises the nucleotide sequence shown in SEQ ID NO: 14-65 ofA nucleotide sequence;

7.3 As shown in Table 2, 3. mu.l of each of the 13 TRBJ randoms was diluted to 11. mu.l of ddH₂O, preparing 50 mu l of TRBJ random working primer, wherein random is a proofreading random section, the number of fragments of random is 18 nucleotides, the first primer group is TRBJ random working primer, and the TRBJ random working primer comprises SEQ ID NO: 1-13;

7.4 As shown in Table 3, 1. mu.l of each of the 14 IgHV strips was diluted to 36. mu.l of ddH₂O, preparing 50 μ l of IgHV working primer, the second primer being an IgHV working primer comprising SEQ ID NO: 72-85;

7.5 As shown in Table 4, 3. mu.l of each of 6 IgHJ randoms was diluted to 32ul ddH₂And O, preparing 50 mu l of IghJ random working primer, wherein random is a proofreading random segment, the number of segments of random is 18 nucleotides, the first primer group is the IghJ random working primer, and the IghJ random working primer comprises SEQ ID NO: 66-71;

7.6, as shown in table 5, 10 × dilution (10 μ M) of Overhang was performed to prepare 50 μ l of Overhang working primer, where the first linker is Overhang, the first linker is SEQ ID NO: 86, and the second linker is SEQ ID NO: 87.

Among them, TRB is a heavy chain of a T cell receptor, and the partial sequence contains a CDR3 region that determines T cell receptor diversity. IgH is the heavy chain of a B cell receptor and this partial sequence contains the CDR3 region that determines the diversity of the B cell receptor.

TABLE 1TRBV working primers

TABLE 2TRBJ random working primers (N in the following Table is nucleotide of the proofreading random section)

TABLE 3IgHV working primers

TABLE 4IghJ random working primers (N in the table below is the nucleotide of the proofreading random fragment)

TABLE 5

Primer name	Numbering	Sequence (5 '-3')
			SEQ ID NO：86	Overhang (first joint)	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

II, secondly: first PCR (annealing + extension):

1. PCR preparation (TRB J region extension)

Composition (I)	Volume of
		Phusion 2×MM	10μl
TRBJ random working primer	2μl
		100ng DNA+ddH2O	8μl
Total	20μl

PCR preparation (IgH J region extension)

Composition (I)	Volume of
		Phusion 2×MM	10μl
IghJ random working primer	2μl
		100ng DNA+ddH2O	8μl
Total	20μl

2. First PCR procedure:

3. first magnetic bead purification:

3.1, front operation: the AMPure XP is warmed to room temperature before being used and is subpackaged into tube for use; alcohol with volume concentration of 80% needs to be prepared fresh; purify uses 1.5ml centrifuge tubes or 96-well plates of 200. mu.l or more.

3.2 mixing AMPure XP Beads and the first PCR product (30. mu.l AMPure Beads + 20. mu.l PCR product) in a volume of 1.5:1, and beating at least 10 times to mix them thoroughly.

3.3, incubating for 10mins at room temperature;

3.4, putting the centrifuge tube of 3.3 on a magnetic seat for 2mins or waiting until the liquid is clear;

3.5, aspirate the supernatant and discard, being careful not to aspirate the beads. The liquid absorption amount can be adjusted to be less than 5 mu l of the total volume for absorption;

3.6, keeping the centrifuge tube on a magnetic seat, adding 200 mul of ethanol with volume concentration of 80%, incubating for 30secs at room temperature, and sucking out and discarding all supernatant;

3.7, repeat step 3.6 once (a total of two 80% ethanol washes);

3.8, sucking the residual solution by a thin suction pipe;

3.9, drying the centrifugal tube for 10mins at room temperature;

3.10, taking the centrifugal tube away from the magnetic seat, adding 20 mu l of Resuspension buffer, and blowing for at least 10 times to fully mix the materials;

3.11, incubating for 2mins at room temperature;

3.12, putting the 3.11 centrifuge tube on a magnetic seat for 2mins or waiting until the liquid is clear;

3.13, sucking 17.5 μ l of supernatant into a new centrifuge tube for preservation.

Third, second PCR:

1. multiplex PCR System (multiplex PCR for TRB V region):

composition (I)	Volume of
		Qiagen Multiplex PCR 2×MM	25μl
TRBV working primer	5μl
		overhang working primer	2.5
100ng DNA+ddH2O	17.5μl
		Total	50μl

Multiplex PCR System (multiplex PCR for Igh V region):

composition (I)	Volume of
		Qiagen Multiplex PCR 2×MM	25μl
IghJ working primer	5μl
		overhang working primer	2.5
100ng DNA+ddH2O	17.5μl
		Total	50μl

2. Multiplex PCR procedure:

3. second bead purification and size selection:

3.1, front operation: the AMPure XP is warmed to room temperature before being used and is subpackaged into tube for use; alcohol with volume concentration of 80% needs to be prepared fresh; purify uses 1.5ml centrifuge tubes or 96-well plates of 200. mu.l or more.

3.2 mixing AMPure XP Beads and a second PCR product (36. mu.l AMPure Beads + 40. mu.l PCR product) in a volume of 0.9:1, and whipping at least 10 times to mix well.

3.3, incubating for 10mins at room temperature.

And 3.4, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.5, transfer 70. mu.l of the supernatant to a new centrifuge tube.

3.6 mixing AMPure XP Beads and the supernatant obtained in the previous step (70. mu.l AMPure Beads + 70. mu.l supernatant) in a volume of 1:1, and beating at least 10 times to mix them thoroughly.

3.7, incubating for 10mins at room temperature.

And 3.8, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.9, aspirate the supernatant and discard, being careful not to aspirate the beads. The amount of the liquid to be aspirated was adjusted to be 5. mu.l less than the total volume.

3.10, keep the centrifuge tube on the magnetic seat, add 200. mu.l volume concentration of 80% ethanol, incubate 30secs at room temperature, aspirate all supernatants and discard.

3.11, repeat step 3.10 once (two total 80% ethanol washes).

3.12, sucking the residual solution out by a thin pipette.

3.13, drying the centrifuge tube for 10mins at room temperature.

3.14, taking the centrifuge tube away from the magnetic seat, adding 17.5 μ l of Resuspension buffer, and blowing for at least 10 times to fully mix the components.

3.15, incubating for 2mins at room temperature.

And 3.16, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.17, pipette 15. mu.l of supernatant into a new PCR tube and store.

Fourth, third PCR:

1. preparing a library construction PCR system (TRB library construction):

composition (I)	Volume of
		Phusion 2×MM	25μl
Sequencing primer 1	5μl
		Sequencing primer 2	5μl
100ng First elution DNA+ddH2O	15μl
		Total	50μl

Preparation of library-building PCR System (Igh library building)

Composition (I)	Volume of
		Phusion 2×MM	25μl
Sequencing primer 1	5μl
		Sequencing primer 2	5μl
100ng First elution DNA+ddH2O	15μl
		Total	50μl

Wherein the sequencing primer 1 comprises a nucleotide sequence (SEQ ID NO: 86) for specifically recognizing the first joint and a joint A for sequencing; the sequencing primer 2 comprises a nucleotide sequence (SEQ ID NO: 87) for specifically recognizing the second joint and a joint B for sequencing, wherein the joint A for sequencing and the joint B for sequencing are special primers for an illumina sequencer.

2. Library construction PCR program:

3. and (3) magnetic bead purification for the third time:

3.1, front operation: the AMPure XP is warmed to room temperature before being used and is subpackaged into a centrifuge tube for use; alcohol with volume concentration of 80% needs to be prepared fresh; purify uses 1.5ml centrifuge tubes or 96-well plates of 200. mu.l or more.

3.2 mix AMPure XP Beads and third PCR product (50 μ l AMPure Beads +50 μ l third PCR product) in a 1:1 volume, and blow-beat at least 10 times to mix well.

3.3, incubating for 10mins at room temperature.

And 3.4, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.5, aspirate the supernatant and discard, being careful not to aspirate the beads. The amount of the liquid to be aspirated was adjusted to be 5. mu.l less than the total volume.

3.6, keep the centrifuge tube on the magnetic seat, add 200. mu.l volume concentration of 80% ethanol, incubate 30secs at room temperature, aspirate all supernatants and discard.

3.7, repeat step 3.6 once (two total 80% ethanol washes).

And 3.8, sucking the residual solution out by a thin sucker.

3.9, drying the centrifuge tube for 10mins at room temperature.

3.10, taking the centrifuge tube away from the magnetic seat, adding 22.5 mul of Resuspension buffer, and blowing for at least 10 times to fully mix the components.

3.11, incubating for 2mins at room temperature.

And 3.12, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.13, 20. mu.l of the supernatant was pipetted into a new centrifuge tube and stored.

Comparative example

First, Primer preparation

The primers of the comparative examples had 52 TRBV, 13 TRBJ, 14 IgHV, 6 IgHJ, all redissolved at 100. mu.M as stock primers. As shown in Table 1, 1. mu.l of each of 52 TRBV was diluted to 48. mu.l of ddH₂Preparing 100 mu l of TRBV working primer in O; as shown in Table 6, 3. mu.l of each of 13 TRBJs was diluted to 11. mu.l of ddH₂O, preparing 50 mu l of TRBJ working primer; as shown in Table 3, 1. mu.l of each of the 14 IgHV strips was diluted to 36. mu.l of ddH₂O, preparing 50 mu l of IgHV working primer; as shown in Table 7, 3. mu.l of each of 6 IgHJ was diluted to 32. mu.l of ddH₂O, preparing 50 μ l of IghJ working primer.

TABLE 6TRBJ working primers

TABLE 7IghJ working primers

IgHJ1	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGTGCTGGAAGTATTCAGC
		IgHJ2	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGAGATCGAAGTACCAGTAG
IgHJ3	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCCAGATATCAAAAGCATC
		IgHJ4	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGCCCCAGTAGTCAAAGTAG
IgHJ5	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCAGGGGTCGAACCAGTTG
		IgHJ6	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCAGACGTCCATGTAGTAG

Second, first PCR:

1. multiplex PCR System formulation (J-V region of TRB):

composition (I)	Volume of
		Qiagen Multiplex PCR 2xMM	25μl
TRBV working primer	5μl
		TRBJ working primer	2.5
100ng DNA+ddH2O	17.5μl
		Total	50μl

Multiplex PCR System formulation (J-V region of Igh):

composition (I)	Volume of
		Qiagen Multiplex PCR 2xMM	25μl
IghV working primer	5μl
		IghJ working primer	2.5
100ng DNA+ddH2O	17.5μl
		Total	50μl

2. Multiplex PCR procedure:

3. first bead purification and size selection:

3.1, front operation: the AMPure XP is warmed to room temperature before being used and is subpackaged into a centrifuge tube for use; alcohol with volume concentration of 80% needs to be prepared fresh; purify uses 1.5ml centrifuge tubes or 96-well plates of 200. mu.l or more.

3.2 mixing AMPure XP Beads and the multiplex PCR product of step 2 (36 mul AMPure Beads +40 mul multiplex PCR product) in a volume of 0.9:1, and beating at least 10 times to mix well.

3.3, incubating for 10mins at room temperature.

And 3.4, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.5, 70. mu.l of the supernatant was transferred to a new centrifuge tube without discarding the supernatant.

3.6 mixing AMPure XP Beads and the supernatant obtained in the previous step (70. mu.l AMPure Beads + 70. mu.l supernatant) in a volume of 1:1, and beating at least 10 times to mix them thoroughly.

3.7, incubating for 10mins at room temperature.

And 3.8, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.9, aspirate the supernatant and discard, being careful not to aspirate the beads. The amount of the liquid to be aspirated was adjusted to be 5. mu.l less than the total volume.

3.10, keep the centrifuge tube on the magnetic seat, add 200. mu.l volume concentration of 80% ethanol, incubate 30secs at room temperature, aspirate all supernatants and discard.

3.11, repeat step 3.10 once (two total 80% ethanol washes).

3.12, sucking the residual solution out by a thin pipette.

3.13, air drying the centrifugal tube for 10 mins.

3.14, taking the centrifuge tube away from the magnetic seat, adding 17.5 μ l of Resuspension buffer, and blowing for at least 10 times to fully mix the components.

3.15, incubating for 2mins at room temperature.

And 3.16, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.17, pipette 15. mu.l of supernatant into a new PCR tube and store.

Third, second PCR:

1. preparing a library-building PCR system:

composition (I)	Volume of
		Phusion 2×MM	25μl
Sequencing primer 1	5μl
		Sequencing primer 3	5μl
100ng First elution DNA+ddH2O	15μl
		Total	50μl

Wherein the sequencing primer 1 comprises a nucleotide sequence (SEQ ID NO: 86) for specifically recognizing the first joint and a joint A for sequencing; the sequencing primer 3 comprises a nucleotide sequence for specifically recognizing GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG and a sequencing joint B, wherein the sequencing joint A and the sequencing joint B are primers special for an illumina sequencer.

2. Library construction PCR program:

3. and (3) second magnetic bead purification:

3.1, front operation: the AMPure XP is warmed to room temperature before being used and is subpackaged into a centrifuge tube for use; alcohol with volume concentration of 80% needs to be prepared fresh; purify uses 1.5ml centrifuge tubes or 96-well plates of 200. mu.l or more.

3.2 mixing AMPure XP Beads and a second PCR product (50 mul AMPure Beads +50 mul second PCR product) in a volume of 1:1, and blowing at least 10 times to fully mix.

3.3, incubating for 10mins at room temperature.

And 3.4, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.5, aspirate the supernatant and discard, being careful not to aspirate the beads. The amount of the liquid to be aspirated was adjusted to be 5. mu.l less than the total volume.

3.6, keep the centrifuge tube on the magnetic seat, add 200. mu.l volume concentration of 80% ethanol, incubate 30secs at room temperature, aspirate all supernatants and discard.

3.7 repeat step 3.6 once (two total 80% ethanol washes by volume)

And 3.8, sucking the residual solution out by a thin sucker.

3.9, drying the centrifuge tube for 10mins at room temperature.

3.10, taking the centrifuge tube away from the magnetic seat, adding 22.5 mul of Resuspension buffer, and blowing for at least 10 times to fully mix the components.

3.11, incubating for 2mins at room temperature.

And 3.12, placing the centrifugal tube on a magnetic seat for 2mins or waiting until the liquid is clear.

3.13, 20. mu.l of the supernatant was pipetted into a new centrifuge tube and stored.

According to the experimental procedure described above, 3 samplings were performed in the same individual, and the DNA extracted from each sample was divided into two parts, one for library construction (TRB library construction and Igh library construction) according to the protocol of example 1 and the other for comparative protocol, and sequencing, analysis, screening, comparison analysis with reads of quality requirements, and analysis of the data obtained from 3 samplings were performed. Referring to fig. 2, multiple PCR will be performed on the variable region library during sequencing, so as to introduce different PCR errors, and compared to the comparative example, the embodiment 1 adds the calibration random segment to the variable region library, which is beneficial to correcting PCR errors during sequencing analysis, so as to ensure that the subsequent sequencing result can be biased through the calibration random segment, thereby greatly improving the accuracy of sequencing of the variable region library, and randomly selecting 2M reads for unique clone number analysis. The mean of the three results and their coefficient of variation were determined. As can be seen from FIG. 3, the left 2M sequencing Reads on the abscissa of FIG. 3 is the data of the number of TCR clones performed after the preparation of the comparative example, and the right 2M sequencing Reads + random barcode is the data of the number of TCR clones prepared in the V-J region of TRB of example 1. As can be seen from the coefficient of variation of FIG. 3, the coefficient of variation of the number of TCR clones of the comparative example is 24.8%, and the coefficient of variation of the number of TCR clones of example 1 is 3.9%, which indicates that the results generated by the protocol of example 1 are relatively stable, the mean value of the number of TCR clones of the comparative example is 46906 unique clones, the mean value of the number of TCR clones of example 1 is 65741 unique clones, and indicates that the unique clones generated by example 1 are more abundant. Whereas the solution using the comparative example produced a larger fluctuation in results, while producing relatively fewer unique clones.

As can be seen from FIG. 4, the left 2M sequencing Reads on the abscissa of FIG. 4 is the data of the number of BCR clones performed after the bank was created in the comparative example, and the right 2M sequencing Reads + random barcode is the data of the number of BCR clones created in the IgH V-J region of example 1. As can be seen from the coefficient of variation of FIG. 4, the coefficient of variation of the number of BCR clones in the comparative example is 32.7%, and the coefficient of variation of the number of BCR clones in example 1 is 3.7%, which indicates that the results generated by the protocol of example 1 are relatively stable, the mean value of the number of BCR clones in the comparative example is 55861 unique clones, and the number of BCR clones in example 1 is 76370 unique clones, indicating that the unique clones generated in example 1 are more abundant. The results produced by the scheme using the comparative example had a large fluctuation, and relatively fewer unique clones were produced

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Guangzhou harmonious medical science and technology Co., Ltd

<120> kit for constructing variable region sequence library and method for sequencing variable region sequence

<160> 87

<170> SIPOSequenceListing 1.0

<210> 1

<211> 87

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 1

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnttacctac 60

aactgtgagt ctggtgcctt gtccaaa 87

<210> 2

<211> 85

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 2

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnacctacaa 60

cggttaacct ggtccccgaa ccgaa 85

<210> 3

<211> 85

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 3

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnacctacaa 60

cagtgagcca acttccctct ccaaa 85

<210> 4

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 4

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnccaagaca 60

gagagctggg ttccactgcc aaa 83

<210> 5

<211> 85

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 5

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnacctagga 60

tggagagtcg agtcccatca ccaaa 85

<210> 6

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 6

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnctgtcaca 60

gtgagcctgg tcccgttccc aaa 83

<210> 7

<211> 77

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 7

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nncggtgagc 60

cgtgtccctg gcccgaa 77

<210> 8

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 8

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnccagtacg 60

gtcagcctag agccttctcc aaa 83

<210> 9

<211> 78

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 9

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnactgtcag 60

ccgggtgcct gggccaaa 78

<210> 10

<211> 74

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 10

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnagagccgg 60

gtcccggcgc cgaa 74

<210> 11

<211> 74

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 11

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnggagccgc 60

gtgcctggcc cgaa 74

<210> 12

<211> 75

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 12

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nngtcagcct 60

gctgccggcc ccgaa 75

<210> 13

<211> 75

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 13

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nngtgagcct 60

ggtgcccggc ccgaa 75

<210> 14

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcgtcggcag cgtcagatgt gtataagaga cagaacaaag gagaagtctc agatggctac 60

ag 62

<210> 15

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tcgtcggcag cgtcagatgt gtataagaga caggataaag gagaagtccc cgatggctat 60

gt 62

<210> 16

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcgtcggcag cgtcagatgt gtataagaga caggacaaag gagaagtctc agatggctat 60

ag 62

<210> 17

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tcgtcggcag cgtcagatgt gtataagaga caggccaaag gagaggtccc tgatggctac 60

aa 62

<210> 18

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tcgtcggcag cgtcagatgt gtataagaga cagctctaga ttaaacacag aggatttccc 60

ac 62

<210> 19

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tcgtcggcag cgtcagatgt gtataagaga cagaaggaga agtccccgat ggctacaatg 60

ta 62

<210> 20

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tcgtcggcag cgtcagatgt gtataagaga cagaaggaga agtccccaat ggctacaatg 60

tc 62

<210> 21

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tcgtcggcag cgtcagatgt gtataagaga caggacaaag gagaagtccc gaatggctac 60

aac 63

<210> 22

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tcgtcggcag cgtcagatgt gtataagaga caggttccca atggctacaa tgtctccaga 60

tc 62

<210> 23

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tcgtcggcag cgtcagatgt gtataagaga caggtcccca atggctacaa tgtctccaga 60

tt 62

<210> 24

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tcgtcggcag cgtcagatgt gtataagaga caggtccctg atggttatag tgtctccaga 60

gc 62

<210> 25

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

tcgtcggcag cgtcagatgt gtataagaga cagatctctg atggatacag tgtctctcga 60

ca 62

<210> 26

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tcgtcggcag cgtcagatgt gtataagaga cagtttcctc tgagtcaaca gtctccagaa 60

ta 62

<210> 27

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tcgtcggcag cgtcagatgt gtataagaga cagtcctgaa gggtacaaag tctctcgaaa 60

ag 62

<210> 28

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tcgtcggcag cgtcagatgt gtataagaga cagctctgag aggtatcatg tttcttgaaa 60

ta 62

<210> 29

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

tcgtcggcag cgtcagatgt gtataagaga cagtcctgag gggtacagtg tctctagaga 60

ga 62

<210> 30

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

tcgtcggcag cgtcagatgt gtataagaga cagtatagct gaagggtaca gcgtctctcg 60

gg 62

<210> 31

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tcgtcggcag cgtcagatgt gtataagaga cagctgaatg ccccaacagc tctctcttaa 60

ac 62

<210> 32

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tcgtcggcag cgtcagatgt gtataagaga cagctgaatg ccccaacagc tctcacttat 60

tc 62

<210> 33

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tcgtcggcag cgtcagatgt gtataagaga cagcctgaat gccctgacag ctctcgctta 60

ta 62

<210> 34

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tcgtcggcag cgtcagatgt gtataagaga cagcctaaat ctccagacaa agctcactta 60

aa 62

<210> 35

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tcgtcggcag cgtcagatgt gtataagaga cagctcacct gactctccag acaaagctca 60

t 61

<210> 36

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tcgtcggcag cgtcagatgt gtataagaga cagttcagct aagtgcctcc caaattcacc 60

ct 62

<210> 37

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tcgtcggcag cgtcagatgt gtataagaga caggattctc atctcaatgc cccaagaacg 60

c 61

<210> 38

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tcgtcggcag cgtcagatgt gtataagaga cagattttct gctgaatttc ccaaagaggg 60

cc 62

<210> 39

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tcgtcggcag cgtcagatgt gtataagaga cagattcaca gctgaaagac ctaacggaac 60

gt 62

<210> 40

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

tcgtcggcag cgtcagatgt gtataagaga cagtcttagc tgaaaggact ggagggacgt 60

at 62

<210> 41

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tcgtcggcag cgtcagatgt gtataagaga cagttcgatg atcaattctc agttgaaagg 60

cc 62

<210> 42

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tcgtcggcag cgtcagatgt gtataagaga cagttgattc tcagcacaga tgcctgatgt 60

<210> 43

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

tcgtcggcag cgtcagatgt gtataagaga caggcgattc tcagctgaga ggcctgatgg 60

<210> 44

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (39)..(55)

<223> n is degenerate base

<400> 44

tcgtcggcag cgtcagatgt gtataagaga cagtcgatnc ncagctaaga tgccnaatgc 60

<210> 45

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

tcgtcggcag cgtcagatgt gtataagaga cagttctcag cagagatgcc tgatgcaact 60

tta 63

<210> 46

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

tcgtcggcag cgtcagatgt gtataagaga cagggttctc tgcagagagg cctaagggat 60

ct 62

<210> 47

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

tcgtcggcag cgtcagatgt gtataagaga caggctgccc agtgatcgct tctttgcaga 60

aa 62

<210> 48

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

tcgtcggcag cgtcagatgt gtataagaga cagggcggcc cagtggtcgg ttctctgcag 60

ag 62

<210> 49

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

tcgtcggcag cgtcagatgt gtataagaga cagatgatcg gttctctgca gagaggcctg 60

agg 63

<210> 50

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

tcgtcggcag cgtcagatgt gtataagaga cagagtgatc gcttctctgc agagaggact 60

gg 62

<210> 51

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

tcgtcggcag cgtcagatgt gtataagaga cagggctgcc caacgatcgg ttctttgcag 60

t 61

<210> 52

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

tcgtcggcag cgtcagatgt gtataagaga cagtccccgt gatcggttct ctgcacagag 60

gt 62

<210> 53

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

tcgtcggcag cgtcagatgt gtataagaga cagctaagga tcgattttct gcagagaggc 60

tc 62

<210> 54

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

tcgtcggcag cgtcagatgt gtataagaga cagctgatcg attctcagct caacagttca 60

gt 62

<210> 55

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

tcgtcggcag cgtcagatgt gtataagaga cagtggtcga ttctcagggc gccagttctc 60

ta 62

<210> 56

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

tcgtcggcag cgtcagatgt gtataagaga cagtaatcga ttctcagggc gccagttcca 60

tg 62

<210> 57

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

tcgtcggcag cgtcagatgt gtataagaga cagtcctaga ttctcaggtc tccagttccc 60

ta 62

<210> 58

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

tcgtcggcag cgtcagatgt gtataagaga cagggaaact tccctcctag attttcaggt 60

cg 62

<210> 59

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

tcgtcggcag cgtcagatgt gtataagaga cagaagagga aacttccctg atcgattctc 60

agc 63

<210> 60

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

tcgtcggcag cgtcagatgt gtataagaga cagggcaact tccctgatcg attctcaggt 60

ca 62

<210> 61

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

tcgtcggcag cgtcagatgt gtataagaga caggttccct gacttgcact ctgaactaaa 60

c 61

<210> 62

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

tcgtcggcag cgtcagatgt gtataagaga caggccgaac acttctttct gctttcttga 60

c 61

<210> 63

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

tcgtcggcag cgtcagatgt gtataagaga caggacccca ggaccggcag ttcatcctga 60

gt 62

<210> 64

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

tcgtcggcag cgtcagatgt gtataagaga cagatgcaag cctgaccttg tccactctga 60

ca 62

<210> 65

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

tcgtcggcag cgtcagatgt gtataagaga cagcatcagc cgcccaaacc taacattctc 60

aa 62

<210> 66

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 66

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nncagtgctg 60

gaagtattca gc 72

<210> 67

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 67

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnagagatcg 60

aagtaccagt ag 72

<210> 68

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 68

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnccccagat 60

atcaaaagca tc 72

<210> 69

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<400> 69

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nnggccccag 60

tagtcaaagt ag 72

<210> 70

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 70

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nncccagggg 60

tcgaaccagt tg 72

<210> 71

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (35)..(52)

<223> n is a, c, g, or t

<400> 71

gtctcgtggg ctcggagatg tgtataagag acagnnnnnn nnnnnnnnnn nncccagacg 60

tccatgtagt ag 72

<210> 72

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 72

tcgtcggcag cgtcagatgt gtataagaga cagagttcca gggcagagtc ac 52

<210> 73

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 73

tcgtcggcag cgtcagatgt gtataagaga cagagtttca gggcagggtc ac 52

<210> 74

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 74

tcgtcggcag cgtcagatgt gtataagaga cagagttcca ggaaagagtc ac 52

<210> 75

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 75

tcgtcggcag cgtcagatgt gtataagaga cagaattcca ggacagagtc ac 52

<210> 76

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 76

tcgtcggcag cgtcagatgt gtataagaga cagaaggccc tggagtggct tgc 53

<210> 77

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 77

tcgtcggcag cgtcagatgt gtataagaga cagctccagg gaaggggctg g 51

<210> 78

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 78

tcgtcggcag cgtcagatgt gtataagaga cagggctcca ggcaaggggc t 51

<210> 79

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 79

tcgtcggcag cgtcagatgt gtataagaga cagactgggt ccgccaggct cc 52

<210> 80

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 80

tcgtcggcag cgtcagatgt gtataagaga caggaagggg ctggagtggg t 51

<210> 81

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 81

tcgtcggcag cgtcagatgt gtataagaga cagaaaaggt ctggagtggg t 51

<210> 82

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 82

tcgtcggcag cgtcagatgt gtataagaga cagagggvct ggagtggatt ggg 53

<210> 83

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 83

tcgtcggcag cgtcagatgt gtataagaga cagggccasg tcaccatctc agc 53

<210> 84

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 84

tcgtcggcag cgtcagatgt gtataagaga caggccttga gtggctggga agg 53

<210> 85

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 85

tcgtcggcag cgtcagatgt gtataagaga cagggcttga gtggatggga tgg 53

<210> 86

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 86

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 87

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 87

tcgtcggcag cgtcagatgt gtataagaga cag 33

Claims (5)

1. A method for constructing a library of variable region sequences, comprising the steps of:

step one, obtaining a DNA sample containing a coding variable region;

step two, using the DNA sample as a template, extending the DNA sequence coding the variable region through a first primer group to obtain a first amplification product library, wherein the first primer group comprises a first primer specifically recognizing all subtypes of coding sequences of the J region, the first primer comprises a nucleotide sequence specifically recognizing the coding sequences of the J region, a proofreading random section and a first joint, the nucleotide sequence of the coding sequences of the J region, the proofreading random section and the first joint are sequentially connected, and the sequences of the proofreading random sections of the first primer group are different from each other;

step three, using the first amplification product library as a template, amplifying the DNA sequence coding for the variable region by using a second primer group and a primer of the first joint to obtain a variable region sequence combination product, wherein the second primer group comprises a second primer which specifically recognizes the coding sequence of all subtypes of the V region; the second primer comprises a nucleotide sequence specifically recognizing the coding sequence of the V region and a second linker, and the nucleotide sequence specifically recognizing the coding sequence of the V region and the second linker are connected with each other; the primer of the first linker comprises a nucleotide sequence that specifically recognizes the first linker;

and step four, taking the variable region sequence combination product as a template, amplifying the DNA sequence coding the variable region through a first sequencing joint and a second sequencing joint to obtain a variable region sequence library, wherein the first sequencing joint comprises a nucleotide sequence specifically recognizing the first joint and a joint for sequencing, the second sequencing joint comprises a nucleotide sequence specifically recognizing the second joint and a joint for sequencing, and the nucleotide sequence of the first sequencing joint is SEQ ID NO: 86, and the nucleotide sequence of the second sequencing linker is SEQ ID NO: 87 is shown;

the DNA sample for encoding the variable region is a sequence of a T cell receptor or a sequence of a B cell receptor;

the DNA sample for coding the variable region is a sequence of a T cell receptor, and the nucleotide sequence of the first primer group is shown as SEQ ID NO: 1-13, and the nucleotide sequence of the second primer group is shown as SEQ ID NO: 14-65;

the DNA sample for coding the variable region is a sequence of a B cell receptor, and the nucleotide sequence of the first primer group is shown as SEQ ID NO: 66-71, and the nucleotide sequence of the second primer group is shown as SEQ ID NO: 72-85.

2. The method of claim 1, wherein the extension comprises: denaturation at 98 ℃ for 40 s; extending at 60 ℃ for 2 min; final extension at 72 deg.C for 2 min; 1 cycle.

3. The method of claim 1, wherein the amplification in step three is multiplex PCR.

4. The method for constructing a library of variable region sequences according to claim 3, wherein the multiplex PCR specifically comprises: pre-denaturation at 95 ℃ for 15 s; denaturation at 94 ℃ for 40 s; annealing at 60 deg.C for 4 min; extension at 72 ℃ for 90 s; final extension 72 ℃ for 10 s; 35 cycles.

5. The method of claim 1, wherein the DNA sample containing the encoded variable region is whole genome DNA extracted from peripheral blood of an animal.

Images